CN1404872A - Method for producing antithrombotic medicine by using silk-worm - Google Patents
Method for producing antithrombotic medicine by using silk-worm Download PDFInfo
- Publication number
- CN1404872A CN1404872A CN 01142144 CN01142144A CN1404872A CN 1404872 A CN1404872 A CN 1404872A CN 01142144 CN01142144 CN 01142144 CN 01142144 A CN01142144 A CN 01142144A CN 1404872 A CN1404872 A CN 1404872A
- Authority
- CN
- China
- Prior art keywords
- silkworm
- annexin
- molecular weight
- low molecular
- weight urokinase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The method for producing antithrombotic medicine by using silkworm utilizes the Bombyx noriNuclear polyhedrosis virus expression system to recombine fusion protein gene with human Annexin V and low molecular weight urokinase to obtain recombinant virus. Said recombinant virus is inoculated in bombyx mori larva and chrysalis to make expression, through separation, purification and freeze-drying, the invented antithrombotic oral liquor and injection can be made up. The animal tests show that it possesses obvious antithrombotic action, and is a new type thrombolytic medicine.
Description
Technical field
The present invention relates to by baculovirus expression vector system and prepare the method for the fusion rotein of Annexin V and low molecular weight urokinase, the invention still further relates to the method that the fusion rotein of producing Annexin V and low molecular weight urokinase with silkworm larva and pupa prepares antithrombotic reagent with silkworm larva and pupa.
Background technology
Thrombosis is one of disease of harm people life security, and according to statistics, China is annual suffers from more than patient Yue Da 3,000,000 people of acute myocardial infarction and cerebral thrombosis.Thromboembolism treatment has been successfully used to the treatment of clinical thrombus disease such as myocardial infarction.The thrombolytic drug of clinical practice at present mainly contains urokinase, streptokinase and tissue-type plasminogen activator etc., but since lack the thrombosis specificity or in vivo the half-life shorter, clinical practice tends to occur the hemorrhage side effect of Denging.Therefore, the thrombolytic drug of seeking novel carrier development targeting thrombus just seems very important.Annexin V is the abundantest a kind of calbindin (Iwasaki of content in the Annexin protein family, 1987), it has high-affinity to Phosphatidylserine (PS), at some during in particular cases as platelet activation, PS just is exposed to the outside of film, therefore Annexin V has high-affinity (Thiagarajan etc., 1990) to activated blood platelet.Zoopery shows, mainly is gathered in aortic blood spigot position (Tait etc., 1994) after the isotope-labeled Annexin V intravenous injection.Because Annexin V has targeting to thrombosis, therefore can its thrombolytic drug for carrier development targeting thrombus.Annexin V itself has anticoagulating active, can prevent the formation again of thrombosis after the thromboembolism, and not have immunogenicity.External existing human chemical method has obtained the coupled product of Annexin V and urokinase B chain, and its thrombolysis activity has improved nearly 4 times (Tanaka etc., 1996) than urokinase.But chemical method exists complex operation, the uneven first-class shortcoming of product.Baculovirus expression vector system (Bombyxmori Nuclear polyhedrosis Virus) is an eukaryotic expression system; this technology is since initiatives such as nineteen eighty-three Smith; existing hundred kinds of exogenous genes are at this system expression (" insect viruses molecular biology "; 1998; 547-578); because a large amount of proteic protective effect of silkworm lymph principal body and the effect of some unknown mechanisms are arranged, and the albumen of silkworm expression can be produced oral drugs.
Summary of the invention
For this reason, the present invention adopts baculovirus expression vector system (Bombyx mori Nuclear polyhedrosisVirus), respectively at bombyx mori cell, express people Annexin V and low molecular weight urokinase fusion rotein in silkworm larva and the Pupa bombycis with high clinical value, make injection and oral drugs, by animal experiment, all have significant anti thrombotic action, become a kind of novel method for preparing the targeting thrombolytic drug.Promptly the invention provides a kind of method of producing antithrombotic reagent with silkworm with higher clinical value.
The invention provides the plasmid pUC-UKAV that contains Annexin V and low molecular weight urokinase, with Chinese's nephrocyte cell mRNA is template, increase by RT-PCR, introduce the BamHI restriction enzyme site at 5 ' end, introduce XhoI site and hirudin polypeptide nucleotide sequence at 3 ' end, the PCR product cloning is entered the HindII site of pUC19, makes up plasmid pUC-UK; To contain people's Placenta Hominis mRNA is template, cDNA by RT-PCR amplification AnnexinV, introduce the XhoI restriction enzyme site at 5 ' end, introduce the EcoRI site at 3 ' end, the PCR product enters XhoI and the EcoRI site of pUC-UK through Xho I and EcoRI enzyme cutting clone, make up plasmid pUC-UKAV, entirely true through its nucleotide sequence of order-checking proof.
The present invention also provides the baculovirus transferring plasmid that contains Annexin V and low molecular weight urokinase fusion gene pBac-UKAV.Earlier with BamHI and EcoRI enzyme action, the clone enters the pBacPAK8 with BamHI and EcoRI enzyme action, makes up to contain Annexin V and low molecular weight urokinase fusion gene transferring plasmid pBac-UKAV (Fig. 1) with plasmid pUC-UKAV.
The present invention also provides the recombinant baculovirus BmBacUKAV that contains Annexin V and low molecular weight urokinase fusion gene.Transferring plasmid pBac-UKAV and silkworm wild virus DNA are carried out cotransfection silkworm (Bombyx mori) cells BmN, carry out 10 and take turns plaque and the Southern dot blot filters out the recombinant baculovirus BmBacUKAV that contains AnnexinV and low molecular weight urokinase fusion gene.This virus has submitted to China Committee for Culture Collection of Microorganisms common micro-organisms center to preserve, and the address is in the BeiJing ZhongGuanCun, and preservation date is July 2 calendar year 2001, and deposit number is GMCC NO:0595.
The present invention also provides Annexin V and the expression product of low molecular weight urokinase fusion gene in silkworm larva and pupa.Recombinant baculovirus BmBacUKAV is infected the BmN cell carry out virus amplification, recombinant baculovirus BmBacUKAV after will increasing then be injected to five age silkworm larva and pupal cell in, the silkworm of getting respectively 24,48,72,96 and 120 hours is drenched the blood crust, show that with fibrin-agarose plate method mensuration expression product has tangible fibrinolytic, can be neutralized by the monoclonal antibody of urokinase, the urokinase activity in the 6th day hemolymph that infects reaches 6 * 10
4More than the IU/ml, reach 8 * 10 in the activity of the 6th day pupa hemolymph that infects
4IU/ml.The anticoagulant experiment shows that expression product also has the anticoagulating active of Annexin V.The film binding specificity studies show that Annexin V is identical with Annexin V to activatory hematoblastic affinity with the low molecular weight urokinase fusion rotein.
The present invention also provides the Annexin V and the low molecular weight urokinase fusion rotein of expressing at silkworm larva to carry out purification.Collected in the 6th day that infects silkworm serum earlier on behind centrifugal and the ammonium sulfate precipitation Sephadex G100 post separate with the MonoQ post, each sample of collecting is all surveyed alive through ELISA, determine its active existence, further use HPLC cation exchange column purification, acquisition purity is 99% recombiant protein.
The present invention also silkworm larva and pupal cell is expressed Annexin V and the low molecular weight urokinase fusion rotein is made oral drugs.Express Annexin V and low molecular weight urokinase fusion rotein at silkworm larva and pupal cell, through filtering (100KD ultrafiltration), 30000rmp is centrifugal after after the lyophilization, be that inserts is mixed with oral drugs with the silkworm pupa.
The present invention also silkworm larva and pupal cell is expressed Annexin V and the low molecular weight urokinase fusion rotein has carried out animal experiment, and 50 of SD rats (being provided by the Academy of Medical Sciences, Zhejiang animal center) are provided, 8 groupings at random, 10 of every treated animals.Earlier with rat with 30g.L
-1Pentobarbital sodium is pressed 40mg.kg
-1Behind the intraperitoneal injection of anesthesia, after cutting the about 3cm of skin, open abdomen, the abdomen median line separates postcava, in left renal vein below cordonnet ligation postcava, skin suture.2h begins vein and oral administration behind the ligation postcava, and with the positive contrast of urokinase, every rat administration volume is 2ml.1h puts to death animal after the administration, opens abdomen again, and 2cm place folder closes blood vessel below ligation, cuts blood vessel open, and removal of thromboses takes by weighing thrombus weight, calculates the thrombolytic percentage rate.Find when peeling off the rat vein thrombosis that the thrombosis of blank group is full of whole section vein blood vessel basically fully.Behind intravenous injection and the orally give medicinal liquid, each treated animal phlebothrombosis accounts for the tube chamber area and obviously reduces, and the results are shown in Table 1.The result shows: intravenous injection and oral administration all possess the effect of remarkable minimizing postcava wet weight of thrombus, and with heavy dose group thrombolytic effect maximum, the thrombolytic rate reaches 35.2%, demonstrate the relevant trend of dose-effect between each dosage.Compare with urokinase, expressed proteins of the present invention is not only effective, and using dosage significantly is less than urokinase.
Comprehensively described, advantage of the present invention is as follows: with the prokaryotic expression urokinase in clinical practice, have all deficiencies (for example lack the thrombosis specificity or in vivo the half-life shorter, clinical practice tends to occur the hemorrhage side effect of Denging) to compare, the expression product in silkworm larva and Pupa bombycis has higher clinical value; Silkworm is can aseptic extensive raising economic insects, can raise on a large scale at low cost; Multiple native protein protective agent is arranged in the silkworm body, expression product is had protective effect, make gene expression product very stable; The albumen that silkworm produces can be oral, the misery and the infected threat of injection have been removed for the patient, produce Annexin V and low molecular weight urokinase fusion rotein, the molten activity that had both had low molecular weight urokinase, and activated blood platelet also had high-affinity, and prove that by animal experiment its anti-blood fastens effect, make it become a kind of thrombolytic drug of novel thrombus targeting, not only effective, and using dosage significantly is less than urokinase.
Description of drawings Fig. 1: the insect baculovirus transferring plasmid pBac-UKAV (descriptive name: 3 ' FS/5 ' FS: autographa california polyhedrosis virus polyhedral body promoter 3 ' end/5 ' end flanking sequence that contains Annexin V and low molecular weight urokinase fusion gene; P: autographa california polyhedrosis virus polyhedral body promoter; A (Polyhedin Poly A
+Signal) polyhedron gene polyadenylation signal; M13ori:M13 phage replication starting point; Amp: ampicillin gene; The ori:pUC replication origin)
The specific embodiment
The present invention is further elaborated by following example, but does not limit the scope of the invention.The structure of embodiment 1, Annexin V and low molecular weight urokinase fusion gene
Get Chinese's nephrocyte, grind under the low temperature, add GIBCOBRL company and produce Trizol RNA extracting solution 1ml, shake gently and add 500 μ l chloroforms (Zhejiang Deyer Pharmaceutical Co., Ltd.) after 10 minutes, at room temperature placed 10 minutes, centrifugal 10 minutes of 12000rpm, get supernatant, add 2 times of volume of ethanol, behind the mixing, centrifugal 10 minutes of 12000rpm, abandon supernatant, add reverse transcription 1000 units (GIBCOBRL company) and 4dNTP (GIBCOBRL company) and carry out reverse transcription, 37 ℃, 1 hour, obtain by the synthetic cDNA of mRNA reverse transcription.According to the urokinase gene design primer (Nagai etc. that delivered, Gene, 1985,36:183), we have designed two couples of primer P1 and P2:P1:5 ' GGGGATCCATGTTAAAATTTCAGTGTGGCAAAAGAC3 ' P2:5 ' GGGCTCGAGATATTCTTCTGGAATTTCTTCGAAATCGCCGAGGGCCAGGCCATTCT C3 ', with cDNA is template, is that primer carries out pcr amplification with P1, P2.The PCR condition is: 94 ℃ of 1min, 55 ℃ of 1.5min, 72 ℃ of 1.5min, totally 35 circulations.The PCR product is behind the low melting point glue purification, and the clone enters the HindII site of pUC19, makes up plasmid pUC-UK.The low molecular weight urokinase cDNA sequence of order-checking proof pcr amplification is correct.Nucleotide sequence (Iwasaki etc. according to Annexin V, J Biochem, 1987,102:1261) a pair of primer P3:5 ' GGGCTCGAGATGGCACAGGTTCTCAGAGG 3 ' of design and P4:5 ' GGGGAATTCTTAGTCATCTTCTCCACAGAGC 3 '.To contain the synthetic cDNA of people's Placenta Hominis mRNA reverse transcription is template, is primer with P3, P4, by the cDNA of above-mentioned PCR condition amplification Annexin V.The PCR product enters XhoI and the EcoRI site of pUC-UK through XhoI and EcoRI enzyme cutting clone, makes up plasmid pUC-UKAV, and is entirely true through its nucleotide sequence of order-checking proof.Embodiment 2, contain the insect baculovirus transferring plasmid of Annexin V and urokinase fusion gene
Plasmid pUC-UKAV is used BamHI and EcoRI enzyme action earlier, the clone enters the pBaePAK8 (CLONTECH company) with BamHI and EcoRI (GIBCOBRL company) enzyme action, structure contains AnnexinV and low molecular weight urokinase fusion gene transferring plasmid pBac-UKAV, identifies correct through enzyme action.(Fig. 2) embodiment 3, contain the acquisition of the recombinant baculovirus of Annexin V and low molecular weight urokinase fusion gene
Get insect baculovirus transferring plasmid pBac-UKAV and the polygonal virus-virus DNA of the wild caryogram of 6ul silkworm that 5ul contains Annexin V and low molecular weight urokinase fusion gene and carry out cotransfection.The TC-100 culture medium of getting 6ulLipofectin (GIBCOBRL company) adding 100ul serum-free is mixed.With BmN cell TC-100 (GIBCOBRL company) the culture medium washed twice of serum-free of cultivating in advance in 35mm Dish, and dropwise add transferring plasmid and Lipofectin mixture, cultivated 4-5 days, and collected supernatant and carry out first round plaque select for 27 ℃.Get the BmN cell among the 5ul supernatant infection 35mm Dish, supernatant discarded adds the TC-100 culture medium and the low melting-point agarose of mixed in equal amounts after 1 hour.Picking plaque after 4-5 days infected Bm N cell 3-4 days, preserved supernatant, and cell is used for Southern hybridization with the NaOH cracking, and the supernatant of getting positive colony carries out the 10th and takes turns plaque select.The supernatant of getting positive colony infects Bm N cell amplification, can obtain a large amount of recombinant baculovirus BmBacUKAV that contains Annexin V and low molecular weight urokinase fusion gene.This virus has submitted to China Committee for Culture Collection of Microorganisms common micro-organisms center to preserve, and the address is in the BeiJing ZhongGuanCun, and preservation date is July 2 calendar year 2001, and deposit number is GMCC NO:0595.Embodiment 4, Annexin V and the expression of low molecular weight urokinase fusion gene in silkworm larva and pupa
The recombinant baculovirus BmBacUKAV that gets amplification be expelled to five age silkworm (Bombyx mori) larva and pupa in (applicant raises voluntarily), (titre is 1 * 10 about every injection 2ul
7/ ml), get the silkworm lymph blood of expressing in 24,48,72,96 and 120 hours respectively, with fibrin-agarose plate method measure fibrinolytic (method is with reference to Biochem Biophys Acta, 1975,27:278).The result shows that expression product has tangible fibrinolytic, can be neutralized by the monoclonal antibody of urokinase, illustrates that expression product has the fibrinolytic identical with natural urokinase, and the urokinase activity in the 6th day hemolymph that infects reaches 6 * 10
4More than the IU/ml, reach 8 * 10 in the 6th day pupa hemolymph activity that infects
4IU/ml.The anticoagulant experiment shows that expression product also has the anticoagulating active of Annexin V.The film binding specificity studies show that Annexin V is identical with Annexin V to activatory hematoblastic affinity with the low molecular weight urokinase fusion rotein.Embodiment 5, contain the purification of Annexin V and low molecular weight urokinase fusion rotein
With playing silkworm 30,000 five ages, every tribal chief worker inoculated recombinant virus and makes it morbidity, collected silkworm serum 10000ml altogether at the 6th day that infects, and every bottle of 500ml is stored in-20 ℃.Silkworm serum through 5000rpm centrifugal 1 hour is earlier got supernatant at 25000rpm centrifugal 30 minutes, goes up Sephadex G100 post and separate behind ammonium sulfate precipitation, collects sample at every turn and all surveys through ELISA and live, and determines its active existence.After crossing the active part mixing of Sephadex G100 post, last MonoQ post, flow velocity 0.5ml/ minute, 5ml/ managed collection.Earlier use 20mM Tris-HCl, the drip washing of pH7.5 buffer, when not having albumen to be eluted, the buffer that reuse 75ml pH7.5 20mM Tris-HCl buffer+75ml contains 1M NaCl carries out linear gradient elution.Further use HPLC cation exchange column purification, acquisition purity is 99% recombiant protein.The preparation of embodiment 6, Annexin V and low molecular weight urokinase fusion rotein oral drugs
Express Annexin V and low molecular weight urokinase fusion rotein at silkworm larva and pupal cell (applicant raises voluntarily), through filtering (100KD ultrafiltration), 30000rmp is centrifugal after after the lyophilization, be that inserts is mixed with oral drugs with the silkworm pupa.The animal experiment of embodiment 7, Annexin V and low molecular weight urokinase fusion rotein
Get 50 of SD rats (providing), 8 groupings at random, 10 of every treated animals by the Academy of Medical Sciences, Zhejiang animal center.Earlier with rat with 30g.L
-1Pentobarbital sodium is pressed 40mg.kg
-1Behind the intraperitoneal injection of anesthesia, it is fixing to lie on the back.After cutting the about 3cm of skin, open abdomen, the abdomen median line separates postcava, in left renal vein below cordonnet ligation postcava, skin suture.Separate rat left side external jugular vein, the intubate administration.2h begins vein and oral administration behind the ligation postcava, intravenously administrable is the albumen of embodiment 5 purification, oral administration is the oral drugs of example 6, and with the positive contrast of urokinase (the general Biochem Pharma Inc in sky, Guangdong product), every rat administration volume is 2ml.60min puts to death animal after the administration, opens abdomen again, and 2cm place folder closes blood vessel below ligation, cuts blood vessel open, and removal of thromboses takes by weighing thrombus weight, calculates the thrombolytic percentage rate.
Find when peeling off the rat vein thrombosis that the thrombosis of blank group is full of whole section vein blood vessel basically fully.Behind intravenous injection and the orally give medicinal liquid, each treated animal phlebothrombosis accounts for the tube chamber area and obviously reduces, and the results are shown in Table 1.The result shows that intravenous injection and oral administration all possess the effect of remarkable minimizing postcava wet weight of thrombus, and with heavy dose group thrombolytic effect maximum, the thrombolytic rate reaches 35.2%, demonstrates the relevant trend of dose-effect between each dosage.Compare with urokinase, expressed proteins of the present invention is not only effective, and using dosage significantly is less than urokinase.
The venothrombotic thrombolytic effect that table 1 pair ligation rat postcava forms
| Grouping | Dosage (Ukg -1) | Wet weight of thrombus (mg) | The thrombolytic rate |
| Blank | ????26.1±2.89 | ||
| Annexin V and low molecular weight urokinase fusion rotein oral drugs | ????50000 | ????24.1±2.63 * | ????7.6％ |
| ????100000 | ????22.9±3.39 * | ????12.3％ | |
| ????150000 | ????22.2±2.77 * | ????14.9％ | |
| Annexin V and low molecular weight urokinase fusion rotein (injection) | ????5000 | ????20.0±2.43 ** | ????23.3％ |
| ????10000 | ????19.0±2.28 ** | ????27.2％ | |
| ????20000 | ????16.9±2.44 ** | ????35.2％ * | |
| Urokinase (injection) | ????50000 | ????19.8±2.53 ** | ????24.1％ |
**P＜0.01，
*P＜0.05
Claims (7)
1. method of producing antithrombotic reagent with silkworm: wherein said people Annexin V and low molecular weight urokinase fusion rotein are to produce by expressing in recombinant silkworm baculovirus (the Bombyx mori Nuclear polyhedrosis Virus) infected silkworm larva of band people Annexin V and low molecular weight urokinase fusion gene and the pupal cell, the recombinant silkworm baculovirus of the described people of containing Annexin V and low molecular weight urokinase fusion gene is BmBacUKAV, this virus has submitted to China Committee for Culture Collection of Microorganisms common micro-organisms center to preserve, the address is in the BeiJing ZhongGuanCun, preservation date is July 2 calendar year 2001, and deposit number is GMCC NO:0596.
2. a kind of method of producing antithrombotic reagent with silkworm according to claim 1 is characterized in that: also comprise separation, the people Annexin V of purification silkworm expression and the step of low molecular weight urokinase fusion rotein.
3. a kind of method of producing antithrombotic reagent with silkworm according to claim 2 is characterized in that: also comprise with the silkworm being the step that filler prepares oral drugs.
4. a kind of method of producing antithrombotic reagent with silkworm according to claim 1 is characterized in that: also comprise the silkworm and the pupa of expressing human Annexin V and low molecular weight urokinase fusion rotein are made oral drugs after lyophilization step.
5. a kind of method of producing antithrombotic reagent with silkworm according to claim 1 is characterized in that: BmBacUKAV carries out the cotransfection bombyx mori cell with insect baculovirus transferring plasmid pBac-UKAV and wild virus DNA to take turns plaque select and Southern hybridization speckle screening acquisition through 10.
6. a kind of method of producing antithrombotic reagent with silkworm according to claim 1, it is characterized in that: the structure of described insect baculovirus transferring plasmid pBac-UKAV is by synthetic human urokinase of RT-PCR method and Annexin V genetic fragment, make up people Annexin V and low molecular weight urokinase fusion gene, Annexin V and low molecular weight urokinase fusion gene cloning are entered among the transfer vector pBacPAK-8 recombinant transfer vector plasmid pBac-UKAV of acquisition.
7. a kind of method of producing antithrombotic reagent with silkworm according to claim 1 is characterized in that: described people Annexin V and the expression product of low molecular weight urokinase fusion gene in silkworm larva and pupa be by recombinant baculovirus BmBacUKAV be injected to five age silkworm larva and pupal cell in express and produce.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01142144 CN1277581C (en) | 2001-09-14 | 2001-09-14 | Method for producing antithrombotic medicine by using silk-worm |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01142144 CN1277581C (en) | 2001-09-14 | 2001-09-14 | Method for producing antithrombotic medicine by using silk-worm |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1404872A true CN1404872A (en) | 2003-03-26 |
| CN1277581C CN1277581C (en) | 2006-10-04 |
Family
ID=4676653
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 01142144 Expired - Fee Related CN1277581C (en) | 2001-09-14 | 2001-09-14 | Method for producing antithrombotic medicine by using silk-worm |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1277581C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7635676B2 (en) | 2001-02-21 | 2009-12-22 | Alavita Pharmaccuticals, Inc. | Modified annexin proteins and methods for their use in organ transplantation |
| US7635680B2 (en) | 2001-02-21 | 2009-12-22 | Alavita Pharmaceuticals, Inc. | Attenuation of reperfusion injury |
| US7645739B2 (en) | 2001-02-21 | 2010-01-12 | Alavita Pharmaceuticals, Inc. | Modified annexin compositions and methods of using same |
| CN101880655A (en) * | 2009-05-06 | 2010-11-10 | 中国人民解放军军事医学科学院生物工程研究所 | Method of purifying CHO cell expressing prourokinase |
-
2001
- 2001-09-14 CN CN 01142144 patent/CN1277581C/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7635676B2 (en) | 2001-02-21 | 2009-12-22 | Alavita Pharmaccuticals, Inc. | Modified annexin proteins and methods for their use in organ transplantation |
| US7635678B2 (en) | 2001-02-21 | 2009-12-22 | Alavita Pharmaceuticals, Inc. | Modified annexin compositions and methods of using same |
| US7635680B2 (en) | 2001-02-21 | 2009-12-22 | Alavita Pharmaceuticals, Inc. | Attenuation of reperfusion injury |
| US7645739B2 (en) | 2001-02-21 | 2010-01-12 | Alavita Pharmaceuticals, Inc. | Modified annexin compositions and methods of using same |
| CN101880655A (en) * | 2009-05-06 | 2010-11-10 | 中国人民解放军军事医学科学院生物工程研究所 | Method of purifying CHO cell expressing prourokinase |
| CN101880655B (en) * | 2009-05-06 | 2013-12-04 | 中国人民解放军军事医学科学院生物工程研究所 | Method of purifying CHO cell expressing prourokinase |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1277581C (en) | 2006-10-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bozic et al. | Expression and biologic characterization of the murine chemokine KC. | |
| EP0691988B1 (en) | Inhibitor of stem cell proliferation and uses thereof | |
| EP0213180B1 (en) | Neovascularization inhibitors and methods for their production and use | |
| WO2009065292A1 (en) | Fusion protein comprising tumor necrosis factor related apoptosis inducing ligand and integrin ligand and use thereof | |
| US8003109B2 (en) | Pharmaceutical compositions containing the long pentraxin PTX3 | |
| JP5215723B2 (en) | Use of anti-CX3CR1 antibody, anti-fractalkine antibody and fractalkine | |
| JPH06506948A (en) | Method of inhibiting leukocyte adhesion to endothelial cells | |
| WO2018136725A1 (en) | Innate immune cell inducible binding proteins and methods of use | |
| Strauss | Role of granulocyte/neutrophil transfusions for haematology/oncology patients in the modern era | |
| JPH08507201A (en) | Lymphotoxin-β, lymphotoxin-β complexes, their pharmaceutical preparation and therapeutic use | |
| JPH08508884A (en) | Macrophage inflammatory protein variant | |
| WO2013003987A1 (en) | Tumor-targeted tumor necrosis factor-related apoptosis ligand variant and use thereof | |
| CA2226911A1 (en) | Methods of treatment of neurological diseases by interferon antagonists | |
| CN1277581C (en) | Method for producing antithrombotic medicine by using silk-worm | |
| JPH02502877A (en) | Human granulocyte-macrophage colony-stimulating factor and its mutin | |
| CN112210005A (en) | anti-C5 humanized monoclonal antibody with low immunogenicity and low ADCC/CDC function and application thereof | |
| CN103623393A (en) | Effects of galectin-9 on systemic lupus erythematosus or similar inflammatory diseases | |
| US8106002B2 (en) | Anti-cancer agent comprising protein C inhibitor | |
| JPH06501689A (en) | Plant proteins useful in treating tumors and HIV infection | |
| KR930004596B1 (en) | Process for preparing lymphokin and monoclonal antibody | |
| TW528761B (en) | MPL ligand analogs | |
| EP0333517A2 (en) | Method and agent for inhibiting the binding of human polymorphonuclear leukocytes to endothelium and compositions therefor | |
| CN109609553B (en) | Method for improving NK cell targeting effect and application of CCR5 gene | |
| WO1992006697A1 (en) | Anti-inflammatory composition | |
| CN114249837B (en) | Polypeptide, and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20061004 Termination date: 20160914 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |