CN1375007A - A gene encoding a novel threonyl-tRNA synthetase, its uses and the preparing methods - Google Patents

Abstract

The present invention relatives to a polynucleotide sequence encoding a novel human threonyl-tRNA synthetase, the invention also relatives to the methods for preparing said polynucleotide and the protein it encoded by recombinant technology, the invention discloses the uses of the human threonyl-tRNA synthetase and the polynucleotide sequence encoding said polypeptide in preparing pharmaceutical composition for treating to the diseases resulting from low or lack of function of human threonyl-tRNA synthetase, such as various tumors. The invention also discloses the methods for preparing antibodies against said polypeptides, screening agonists, as well as their uses in treatment.

Description

A gene encoding a novel threonyl-tRNA synthetase, its uses and the preparing methods

Encode a kind of gene of new threonine tRNA synthetase

And its application and preparation method invention field

The present invention relates to a kind of polynucleotide sequence for encoding new human threonine tRNA synthetase, the invention further relates to the purposes of the preparation method of the polynucleotides and its protein of coding, and the protein of the polynucleotides and its coding.Background of invention

Aminoacyl-tRNA synthetase（AminoacyMRNA synthetases) be an enzyme extended familys, the amino acid ammonia barefoot tRNA synthetase of at least 20 kinds different shapes in prokaryotes, and there was only the amino acid aminoacyl-tRNA synthetase of two kinds of forms in eucaryote, i.e.,：Cytosolic and Mitochondrial form, they have common quaternary structure, and their subunit then has a variety of change [Schimmd P. biochemistry yearbooks（ Annu. Rev. Biochem. ) 56:125-158 (1987)] aminoacyl-tRNA synthetases can be divided into two groups：Group I is mainly kinases and dehydrogenase, and remaining synzyme ranges Group II.Group II synzyme has three characteristic sequence motifs, motif 1 is dimer interface, motif 2 and 3 is avtive spot, when amino acid and ATP binding site carry out haptoreaction, Group II synzyme can produce the folding in structure, and this folding mode is different from the Rossmann folding modes of Group I.Group II synthol can be further subdivided into 2a Group（Respectively proline, threonine, histidine and serine etc.）With 2b groups（Respectively aspartic acid, aspartoyl and lysine etc.）, in addition to above-mentioned ii is combined into the common characteristic of alcohol, each also have some important motif [Cusack S. etc., nucleic acids research（ Nucleic Acids Res ) 1991 19(13):3489-98】.Two histidyl- tRNA synthetases can activated amino acid, the amino acid activated is gone on specific tRNA molecules in the first step of Protein synthesis, but be attached to ATP's Site is different：Group I enzyme is attached on 2, hydroxyl, and Group II enzyme is then attached on 3, hydroxyl [Eriani G. etc., molecular evolution magazine（ J Mol Evol ) 1995 40(5):499- 508】.

Threonyl tRNA synthetase（Hereinafter referred to as thrS) it is one of member of aminoacyl-tRNA synthetase extended familys, it has the 26S Proteasome Structure and Function that above-mentioned amino acyl transfer ribonucleic acid He Cheng Pickled have.The Soviet Union's ammonia barefoot tRNA synthetase found in human threonine tRNA synthetase and yeast cells matter, yeast mitochondrial, hay bacillus has very high homology.Detailed understanding to the threonyl tRNA synthetase and its signal transduction path of gold-coloured staphylococci has been discovered that some mechanism [Hodgson, etc. United States Patent (USP), 5795757] of diseases associated with inflammation and proliferation out of control disease.CDNA, oligonucleotides, polypeptide and its antibody of human threonine tRNA synthetase that the present invention is provided etc. has important value for disease, Return choosings Soviet Union's ammonia barefoot tRNA synthetase inhibitor related to ammonia barefoot tRNA synthetase imbalance of reviving of signal transduction, diagnosis in research different tissues and cell or for the medicine for treating these diseases.Summary of the invention

It is an object of the present invention to provide the synthesis of the threonyl transfer ribonucleic acid of separation is liquor-saturated.

It is a further object to provide the polynucleotide sequence of coding Soviet Union ammonia barefoot tRNA synthetase.

It is a further object to provide the recombinant expression carrier of the polynucleotides containing coding Soviet Union ammonia barefoot tRNA synthetase.

It is a further object to provide the host cell of the recombinant expression carrier comprising the polynucleotides with coding threonyl transfer ribonucleic acid synthol.

It is a further object to provide the method for production Soviet Union ammonia barefoot tRNA synthetase. It is a further object to provide the antibody of Soviet Union's ammonia barefoot tRNA synthetase for the present invention.

Another object of the present invention is to provide the antagonist for polypeptide of the present invention.It is a further object to provide the method for the diagnoses and treatment disease related to threonyl tRNA synthetase dysfunction.

The other side of the present invention, due to the disclosure of this paper technology, is obvious to those skilled in the art.Detailed description of the invention

In the first embodiment, the invention provides a kind of substantially pure threonyl tRNA synthetase, it is substantially by SEQ ID NO:Amino acid sequence composition shown in 2.Threonyl transfer ribonucleic acid synthol is characterized in have an aminoacyl-tRNA synthetase functional domain.

As used in the present invention, " substantially pure " is Soviet Union's ammonia barefoot transfer ribonucleic acid synthesis hemiculeer leucisculus substantially free of natural relative other albumen, lipid, carbohydrate or other materials.Those skilled in the art can be purified with the purified technology of protein of standard Soviet Union ammonia barefoot tRNA synthetase.Substantially pure polypeptide can produce single master tape in non-reducing polyacrylamide gel.The purity of Soviet Union's ammonia barefoot tRNA synthetase can use amino acid sequence analysis.

The polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthesis polypeptide, preferably recombinant polypeptide.

Present invention additionally comprises the fragment of the polypeptide, derivative and analog.As used in the present invention, term " fragment ", " derivative " and " analog " refer to be kept substantially polypeptide identical biological function of the present invention or active polypeptide.

As used in the present invention, polypeptide of the present invention such as SEQ ID NO:2 fragment, derivative or the like can be：（I) such a polypeptide, wherein one or more amino acid are residual Base is guarded or nonconserved amino acid residues（Preferably conservative amino acid residues）Substitution, and the amino acid replaced may or may not be what is encoded by genetic codon；Or（II) such a polypeptide, wherein one or more amino acid residues include substituent；Or

(III) such a polypeptide, wherein mature polypeptide are merged with another compound；Or

(IV) such a polypeptide, wherein plus Amino Acid is integrated into mature polypeptide, and it is used for Purified mature polypeptide.By this paper elaboration, such fragment, derivative and the like are considered as within the knowledge of those skilled in the art.

In another embodiment, the invention provides the polynucleotides of separation, it substantially has SEQ ID NO by coding:The polynucleotides composition of the polypeptide of 2 amino acid sequences.The polynucleotide sequence of the present invention is included in SEQ ID NO:1 nucleotide sequence.

The polynucleotides of the present invention are found from the cDNA library of Human fetal brain.The polynucleotide sequence total length that it is included is 2741 bases, and its open reading frame encodes 718 amino acid.According to amino acid sequence homologous it was found that, this polypeptide has 61% homology with the thrS in yeast mitochondrial, and the polypeptide has the conservative base of thrS gene families, it can be inferred that the new human threonine tRNA synthetase has the similar 26S Proteasome Structure and Function of thrS gene families.

As used in the present invention, " separation " refers to that material is separated from its primal environment（If crude, primal environment is natural surroundings）.As the polynucleotides and polypeptide under the native state in active somatic cell are not isolated and purified, but same polynucleotides or polypeptide such as from native state with being separated in other materials existed, then be to separate Pureization.

The polynucleotides of the present invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be single-stranded or double-strand.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be with SEQ ID NO:Coding region sequence shown in l is identical or degeneracy variant.As used in the present invention, " degeneracy variant " is in the present invention Referring to coding has SEQ ID NO:2 protein or peptide but due to codon cylinder and property and with SEQ ID NO:The different nucleotide sequence of coding region sequence shown in l.

Encode SEQ ID NO:The polynucleotides of 2 mature polypeptide include：The only coded sequence of mature polypeptide；The coded sequence of mature polypeptide and various additional coding sequences；The coded sequence of mature polypeptide（With optional additional coding sequence）And non-coding sequence.

Term " polynucleotides of coded polypeptide " refers to include to encode the polynucleotides of this polypeptide and the polynucleotides including additional code and/or non-coding sequence.

The invention further relates to the variant of foregoing description polynucleotides, it is encoded has the polypeptide of identical amino acid sequence or the fragment of polypeptide, analogs and derivatives with the present invention.The variant of this polynucleotides can be the variant that the allelic variant or non-natural naturally occurred occurs.These nucleotide variants include substitution variants, Deletion variants and insert variation.As known in the art, allelic variant is the alternative forms of a polynucleotides, and it is probably substitution, missing or the insertion of one or more nucleotides, but will not substantially change the function of the polypeptide of its coding.

The invention further relates to polynucleotides that can be with sequence hybridization described above（Between two sequences have at least 70%, preferably with 80%, more preferably with 90%, or 95% the phase same sex）.The present invention is more particularly directed under strict conditions with the interfertile polynucleotides of polynucleotides of the present invention.In the present invention, " stringent condition " refers to：（1) hybridization and elution under compared with low ionic strength and higher temperature, such as 0.2xSSC, 0.1%SDS, 60 "；Or add during (2) hybridization and use denaturant, such as 50% (v/v) first barefoot amine, 0.1% calf serum/0.1%Ficoll, 42 etc.；Or the phase same sex of (3) only between two sequences at least more than 95%, just hybridizes when more preferably more than 97%.Also, the polypeptide of interfertile polynucleotide encoding and SEQ ID NO:Mature polypeptide shown in 2 has identical biological function and activity.

The invention further relates to the nucleic acid fragment with sequence hybridization described above.As used in the present invention, the length of " nucleic acid fragment " at least contains 15 nucleotides, preferably at least It is more than 20-30 nucleotides, preferably more preferably at least 50-60 nucleotides, at least 100 nucleotides.Nucleic acid fragment can be used for the amplification technique (such as PCR) of nucleic acid to determine and/or separate the polynucleotides of coding threonyl tRNA synthetase.

The host cell produced the present invention also relates to the carrier of the polynucleotide sequence comprising the present invention and with the carrier of the present invention through gene engineering method, and the method through recombinant technique generation polypeptide of the present invention.

The DNA sequence dna of the present invention can be obtained with several method.For example, separating DNA with hybridization technique well known in the art.These technologies include but is not limited to：1) hybridized to detect homologous nucleotide sequences with probe and genome or cDNA library, and 2) antibody screening of expression library to detect the DNA fragments of the common clone with architectural feature.

The specific DNA fragment sequence of coding threonyl transfer ribonucleic acid synthol is produced and can also obtained with following method：1) double chain DNA sequence is separated from genomic DNA；2) chemical synthesising DNA sequence is so that in the method for the double-stranded DNA of polypeptide needed for obtaining-mentioned above, isolated genes group DNA is the most commonly used.When known to the whole amino acid sequence of the polypeptide product of needs, the direct chemical synthesis of DNA sequence dna is also optional method.If the whole sequence of required many amino acid is not known, the direct chemical synthesis of DNA sequence dna is impossible, and the method for selection is the separation of cDNA sequences.Separation cDNA interested standard method is from the high donorcells separation mRNA for expressing the gene and carries out reverse transcription, forms shield grain or bacteriophage cDNA library.The mRNA existing a variety of ripe technologies of method are extracted, kit is also commercially obtained（ Qiagene ) .And construction cDNA library is also usual way（Sambrook^ etc., Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).It also can obtain the cDNA library of commercial offers, the different cDNA libraries of such as Clontech companies.When polymerase chain reaction technique is used in combination, it can also be cloned even if few expression product. The gene of the present invention can be screened from these cDNA libraries with conventional method.These methods include（But it is not limited to）：（1) DNA-DNA or DNA-RNA hybridization；(2) function of marker gene occurs or lost；（3) level of the transcript of threonyl transfer ribonucleic acid synthol is determined；（4) applied immunology technology or measure biological activity detect the protein product of gene expression.The above method can be alone, also can a variety of method use in conjunction.

（1) in kind method, hybridization probe used is any a part of homologous nucleotide sequence with the polynucleotides of the present invention, at least 15 nucleotides of its length, preferably 20-30 nucleotides, it is more than more preferably 50-60 nucleotides, preferably 100 nucleotides.Probe used herein is typically the DNA sequence dna of the chemical synthesis on the basis of the gene DNA sequence information of the present invention.The gene of the present invention is in itself or fragment is it is of course possible to being used as probe.The mark of DNA probe can use radio isotope, fluorescein or enzyme（Such as alkaline phosphatase）Deng.

（4) in kind method, the protein product of detection threonyl tRNA synthetase gene expression can use immunological technique such as Western traces, radioimmunoprecipitation, enzyme linked immunosorbent assay（ELISA) etc..

Using PCR technologies DNA amplification/RNA method（Saiki, etc. science 1985;230:It can 1350-1354) be preferentially used the gene for obtaining the present invention.Particularly it is difficult to when the cDNA of total length is obtained from library, preferably use RACE methods（ RACE:CDNA ends rapid amplification）, primer used be able to can be properly selected according to the sequence information of invention disclosed herein in terms of above-mentioned PCR, and available conventional method synthesis.The DNA/RNA fragments of amplification such as can be separated and purified by gel electrophoresis with conventional method.

The gene of the invention obtained as described above, or the measure of the nucleotide sequence of various DNA fragmentations etc. can use conventional method such as dideoxy chain termination（The such as Sanger PNAS, 1977,74： 5463-5467 ) .This kind of nucleotide sequencing can also use business Industry sequencing kit etc..In order to obtain the cDNA sequence of total length, sequencing need to be repeated.Sometimes for the cDNA sequence for determining multiple clones, the cDNA sequences of total length can be just spliced into.

According to common recombinant DNA technology, Soviet Union's ammonia barefoot tRNA synthetase of restructuring is can be used to express or produced using the polynucleotide sequence of the present invention（Science, 1984; 224： 1431 ) .In general there are following steps：

(1) polynucleotides of the coding threonyl transfer ribonucleic acid synthol of the present invention（Or variant）Or the recombinant expression carrier containing the polynucleotides converts suitable host cell；

(2) host cell that is cultivated in suitable culture medium；

(3) is separated from culture medium or cell, is purified target protein.

In the present invention, Soviet Union's ammonia barefoot tRNA synthetase polynucleotide sequence can be plugged into recombinant expression carrier.Term " recombinant expression carrier " refers to bacterial plasmid well known in the art, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus or other carriers.Applicable carrier includes but is not limited in the present invention：The expression vector based on T7 expressed in bacterium（Rosenberg, etc. gene, 1987,56:125 )；The pMSX D expression vectors expressed in mammalian cell（Lee and Nathans, journal of biological chemistry, 263:3521,1988) carrier from baculoviral and in insect cell expressed.In a word, as long as can be replicated in host and stably, any plasmid and carrier can be used.One key character of expression vector is to usually contain replication orgin, promoter, marker gene and translation control element.

Method well-known to those having ordinary skill in the art can be used to build the DNA sequences encoding of tRNA synthetase containing threonyl and the expression vector of suitable transcription/translation control signal.These methods include the (Sambroook such as recombinant DNA technology in vi, DNA synthetic technologys, In vivo recombination technology, Deng Molecular Cloning, a laboratory Manual, cold Spring Harbor laboraty. New York, 1989).Described DNA sequences can be effectively connected in the appropriate promoter in expression vector, to instruct mRNA to synthesize.There is representational example in these promoters：Lac the or trp promoters of Escherichia coli；Bacteriophage lambda p_LPromoter；Eukaryotic promoter includes CMV immediate early promoters, HSV thymidines and swashs alcohol promoter, the promoter of the expression of early and late SV40 promoters, the LTR promoters of retroviruse and some other known controllable gene in protokaryon or eukaryotic or its virus.Expression vector also includes the ribosome bind site and transcription terminator of translation initiation.

In addition, expression vector preferably includes one or more selected markers, to provide the phenotypic character for the host cell for being used to select conversion, such as it is used for dihydrofolate reduction alcohol, neomycin resistance and the green fluorescent protein of eukaryotic culture（), or tetracycline or amicillin resistance for Escherichia coli GFP.

Carrier comprising above-described appropriate DNA sequence dna and appropriate promoter or control sequence can be used for converting appropriate host cell, allow it to marking protein.

Host cell can be prokaryotic, such as bacterial cell；Or low eukaryotic, such as yeast cells；Or higher eucaryotic cells, such as mammalian cell.Representational example has：Escherichia coli, streptomyces；The bacterial cell of salmonella typhimurium；The fungal cell of such as yeast；Plant cell；Drosophila S2 or Sf9 insect cell；Zooblast of CHO, COS or Bowes melanoma cells etc..

When the polynucleotides of the present invention are expressed in higher eucaryotic cells, if will be strengthened transcription when inserting an enhancer sequence in the carrier.Enhancer is DNA cis-acting factors, generally about there is 10 to 300 base-pairs, acts on promoter to strengthen the transcription of gene.Can illustrated example be included in the Side of replication origin late period one 100 to 270 base-pairs SV40 enhancers, in the Side of replication origin late period one polyoma enhancer and adenovirus cancers etc..

Persons skilled in the art are aware that how to select appropriate carrier, promoter, Enhancer and host cell.

It can be carried out with recombinant DNA conversion host cell with routine techniques well known to those skilled in the art.When host is prokaryotes such as large intestine pestle bacterium, the DNA general harvesting after exponential phase of growth of competent cell can be absorbed by preparing, and use CaCl₂Method processing, step used gathers generally well-known in the art.Alternative is to use MgCl₂.If desired, conversion can also be carried out with the method for electroporation.When host is eucaryote, following DNA transfection methods can be used：Bony sour calcium coprecipitation, conventional mechanical methods such as show note of the ancient Chinese injection, electroporation, liposome packaging.

The transformant of acquisition can use conventional method culture, express the polypeptide of the coded by said gene of the present invention.According to host cell used, culture medium used may be selected from various conventional mediums in culture.Cultivated under conditions of suitable for host cell growth.After host cell growth is to appropriate cell density, suitable method is used（Such as temperature transition or chemical induction）The promoter of selection is induced, cell is further cultured for a period of time.

Required recombinant polypeptide is coated in intracellular, extracellular or expresses or be secreted on cell membrane and be extracellular in the above methods.If desired, can be separated using its physics, chemistry and other characteristics by various separation methods and purification of Recombinant albumen.These methods are mostly well-known to those skilled in the art.More specifically, it can mention, conventional renaturation process, be handled with protein precipitant（Salting-out method）, centrifugation, the broken bacterium of infiltration, super processing, ultracentrifugation, sieve chromatography（Gel filtration）, adsorption chromatography, ion-exchange chromatography, high performance liquid chroma- tography（HPLC) and other various liquid chromatography technologies and these methods combination.

The threonyl tRNA synthetase albumen or polypeptide of restructuring are of use in many ways.These purposes include（But it is not limited to）Directly as the disease caused by drug therapy threonyl tRNA synthetase hypofunction or forfeiture, and promote or resist the antibody of threonyl tRNA synthetase function, polypeptide or other parts for sieving ease.For example, antibody can be used for the function of activating or suppress threonyl tRNA synthetase. / NOO/0 75 selects peptide library to can be used for finding the peptide molecule that can suppress or irritate threonyl tRNA synthetase function for having therapeutic value with the restructuring threonyl tRNA synthetase Dan Bai Return of expression.

Present invention provides screen medicine to identify raising（Activator）Or check（Antagonist）The method of the medicament of Soviet Union's ammonia barefoot tRNA synthetase.Activator, which improves threonyl tRNA synthetase and stimulated cellular proliferation, waits biological function, and antagonist is prevented and treats relevant with cell hyperproliferation disorder such as various cancers.For example, the film preparation of mammalian cell or expression threonyl tRNA synthetase can be cultivated in the presence of medicine together with the threonyl tRNA synthetase of mark.Then the ability that medicine improved or checked this interaction is determined.

The antagonist of threonyl tRNA synthetase albumen includes antibody, compound, acceptor the missing thing and analog etc. that Recording is selected.The antagonist of human threonine tRNA synthetase albumen can be with human threonine tRNA synthetase protein binding and eliminating its function, or suppress the generation of human threonine tRNA synthetase albumen, or combined with the avtive spot of polypeptide and prevent polypeptide from playing biological function.

When screening compounds are as antagonist, the ammonia chen transfer ribonucleic acids that such a new people can be revived synthesize dark albumen and added in bioanalysis measure, by determining whether compound influences the interaction between such a new human threonine transfer ribonucleic acid synthol albumen and its acceptor to determine whether compound is antagonist.The Shang Shu Return of Yi select the same method of compound, can filter out the acceptor missing thing and analog of antagonist action.

The polypeptide of the present invention can be used as peptide and know analysis well, for example, polypeptide available physical, the specific cutting of chemical or enzyme progress, and carry out one-dimensional two-dimentional or three-dimensional gel electrophoresis analysis.

A variety of methods can be used for production for the antibody of Soviet Union ammonia barefoot tRNA synthetase antigenic determinant.These antibody include（But it is not limited to）The fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragments and Fab expression libraries are produced. The antibody of anti-threonyl tRNA synthetase can be used in immunohistochemistry technology, the threonyl tRNA synthetase in detection biopsy specimen.

The monoclonal antibody combined with threonyl tRNA synthetase can also use labelled with radioisotope, be injected in vivo its traceable position and distribution.This radiolabeled antibody can be used for the positioning of tumour cell as a kind of noninvasive diagnosis method and determine whether transfer.

Antibody in the present invention can be used for treating or preventing the disease related to ammonia barefoot tRNA synthetase of reviving.Generation or the activity of threonyl tRNA synthetase can be stimulated or block by giving the antibody of suitable dosage.

Antibody can also be used for immunotoxin of the design for internal a certain privileged sites.Monoclonal antibody such as threonyl tRNA synthetase high-affinity can be with bacterium or phytotoxin（Such as diphtheria toxin, ricin, abrine etc.）Covalent bond.A kind of usual way is, with thiol crosslinkers such as SPDP, to attack the amino of antibody, by the exchange of disulfide bond, toxin is incorporated on antibody, and this hybrid antibody can be used for killing the positive cell of threonyl tRNA synthetase.

The production of polyclonal antibody can use threonyl tRNA synthetase albumen or polypeptide immune animal, such as rabbit, mouse, rat etc..A variety of adjuvants can be used for enhancing immune response, including but not limited to Freund's adjuvant etc..

Monoclonal antibody for threonyl tRNA synthetase can be produced with hybridoma technology（Kohler and Milstein. is naturally, 1975,256:495-497 ).The chimeric antibody that the variable region in human constant region and inhuman source is combined can produce (Morrison etc., PNAS, 1985,81 with existing technology:6851 ) .And the technology of existing production single-chain antibody（United States Patent (USP) 4946778) it can also be used for producing the single-chain antibody of anti-threonyl tRNA synthetase.

The peptide molecule that can be combined with Soviet Union's ammonia barefoot transfer ribonucleic acid synthol can by screen by it is various may the amino acid that combine be incorporated into random peptide library that solid formation constitutes and obtain .When Recording is selected, it is necessary to which Soviet Union's ammonia barefoot tRNA synthetase molecule is marked.The polypeptide of the present invention can be applied in combination with suitable pharmaceutical carrier.This composition includes the polypeptide of therapeutically effective amount, and medicinal acceptable carrier or excipient.Such carrier includes but is not limited to salt solution, Slow and rushes salt solution, glucose, water, glycol, ethanol and combinations thereof.These preparations should be suitable for method of application.

The present invention also provides the Pharmaceutical composition composition equipped with one or more present invention in medicine box or kit containing one or more containers, container.Together with these containers, can there is a prompting for the instruction form that the government authorities by manufacture, use or sale medicine or biological products provide, the prompting reflect production, using or the government authorities of sale permit it to be applied on human body.In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

Pharmaceutical composition can be administered in a convenient way, such as pass through local, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intracutaneous approach.Threonyl tRNA synthetase is to effectively treat and/or prevent the amount of specific indication to be administered.The threonyl transfer ribonucleic acid for being applied to patient synthesizes dark amount and dosage range will depend on many factors, such as administering mode, is intended to the natural conditions of curer and the judgement of diagnostician.

The invention further relates to qualitatively and quantitatively detect the diagnostic testing process of Soviet Union's ammonia barefoot tRNA synthetase level.These experiments are known in the art, and are determined and radiommunoassay including FLISH.The threonyl tRNA synthetase level detected in experiment may be used as explaining importance of Soviet Union's ammonia barefoot tRNA synthetase in various diseases, and for diagnosing the disease that threonyl tRNA synthetase can work.

The polynucleotides of coding Soviet Union ammonia barefoot transfer ribonucleic acid synthol can also be used for the diagnosis and treatment of threonyl tRNA synthetase relevant disease.In terms of diagnosis, the polynucleotides of coding threonyl tRNA synthetase can be used for the expression of detection threonyl tRNA synthetase, or threonyl transfer ribonucleic acid is synthesized under morbid state The unconventionality expression of enzyme.The polynucleotide sequence of Soviet Union's ammonia barefoot tRNA synthetase is such as encoded available for the hybridization to biopsy specimen, to judge that threonyl transfer ribonucleic acid synthesizes dark abnormal expression.Hybridization technique includes Southern traces, Northern traces, in situ hybridization etc..These technical methods are all disclosed mature technologies, and related kit is all commercially obtained.Part or all of the polynucleotides of the present invention can be fixed on microarray as probe（) or DNA chip Microarray（DNA Chip) on be used for analyze the Differential expression analysis of gene and gene diagnosis in tissue.RNA- polymerase chain reactions are carried out with the special primer of threonyl tRNA synthetase（RT-PCR) amplification in vitro also can detect the transcription product of threonyl tRNA synthetase.

The mutation of detection threonyl tRNA synthetase encoding gene can also be used for diagnosing the related disease of threonyl transfer ribonucleic acid synthol.The form that ammonia barefoot tRNA synthetase of reviving is mutated includes point mutation, transposition, missing, restructuring and other any exceptions compared with normal wild type threonyl transfer ribonucleic acid synthol DNA sequences etc..It can be mutated with existing technology such as Southern traces, DNA sequence analysis, PCR and in situ hybridization detection.In addition, mutation is possible to influence the expression of albumen, therefore it can judge gene whether there is mutation indirectly with Northern traces, western blot.

The sequence pair Chromosome Identification of the present invention is also valuable.Certain human chromosome particular location is directed to the sequence-specific and can be simultaneously hybrid with it.Need to identify each specific site on chromosome at present.Now, it is only seldom based on actual sequence data（Repeat Polymorphism）Chromosomal marker thing can be used for marker chromosome position.According to the present invention, these sequences are associated with disease related gene, these D N A sequences are exactly positioned on chromosome by its important first step.

In brief, PCR primer is prepared according to c D N A（It is preferred that 15-25bp), sequence can be positioned on chromosome.Then, these primers are used for P C R and screen the body cell hybrid cell containing each bar human chromosome.Only those hybrid cells contained corresponding to the people's gene of primer can produce the fragment of amplification. The P C R positioning modes of body cell hybrid cell, are the quick methods that D N A are navigated to specific chromosome.Using the Oligonucleolide primers of the present invention, by similar approach, sub- positioning is realized using one group of fragment or lots of genes group clone from specific chromosome.Chromosome prescreening and hybridization of other similar strategies including in situ hybridization, with the airflow classification of mark available for chromosome mapping is preselected, so as to build the special c D N A storehouses of chromosome.

C D N A clones are subjected to FISH with metaphase chromosome（FISH), chromosome mapping can be accurately carried out in one step.The summary of this technology, referring to Verma etc., human chromosome：Basic fundamental handbook (Human Chromosomes: a Manual of Basic Techniques ) ,Pergamon Press, New York(1988).

Once sequence is positioned to accurate chromosome position, the physical location of this sequence on chromosome just can be associated with gene diagram data.These data are found in for example, V. Mckusick, Mendelian Inheritance in Man (by with Johns Hopkins University Welch Medical Librar are online to obtain）.Then can be by linkage analysis, the relation for determining gene and navigating to already between the disease on chromosomal region.

Then, it is necessary to determine the c D N A or genome sequence difference between ill and non-diseased individuals.If observing certain mutation in some or all of diseased individuals, and the mutation is not observed in any normal individual, then the mutation is probably the cause of disease of disease.Compare ill and non-diseased individuals, be usually directed to the change for first looking for structure in chromosome, it is such as visible or with the detectable missings of P C R based on c D N A sequences or transposition from Chromosome level.

Current physical mapping and the resolution capability of assignment of genes gene mapping technology, are pinpointed to the c D N A of the chromosomal region relevant with disease, can be one kind between 50 to 500 potential Disease-causing genes（It is assumed that 1 megabasse mapping resolution capability and every 20kb correspond to a gene）. The polynucleotides of coding threonyl tRNA synthetase can also be used for a variety of therapeutic purposes.Gene therapy technology can be used for cell propagation, development or metabolic disorder of the treatment caused by the expression of the threonyl tRNA synthetase without expression or exception/inactive of threonyl tRNA synthetase.The gene therapy vector of restructuring（Such as viral vector）The threonyl tRNA synthetase of expression variance is may be designed to, for suppressing endogenic threonyl tRNA synthetase activity.For example, a kind of Soviet Union's ammonia barefoot tRNA synthetase of variation can be the Soviet Union's ammonia barefoot transfer ribonucleic acid synthol for truncating, having lacked signal transduction functional domain, though Binding Capacity that can be with downstream, lacks signaling activity.Therefore the gene therapy vector of restructuring can be used for the disease of the ammonia barefoot transfer ribonucleic acid synthol expression for the treatment of Soviet Union or active caused by abnormal.From expression vector such as the retrovirus of virus, adenovirus, adeno-associated virus, herpes simplex virus, parvovirus etc. available for by threonyl tRNA synthetase gene transfer to intracellular.The method for building the recombinant viral vector for carrying Soviet Union's ammonia barefoot tRNA synthetase gene is found in existing document（Sambrook etc.）.In addition restructuring threonyl tRNA synthetase gene can be packaged into liposome be transferred to it is intracellular.

Suppress Soviet Union ammonia barefoot tRNA synthetase mRNA oligonucleotides（Including antisense RNA and DNA) and core it is dark also within the scope of the invention.Core alcohol is a kind of specific R A of energy specific cleavage enzyme sample RNA molecule, and its mechanism of action is the liquor-saturated molecule of core with carrying out endonuclease effect after complementary target RNA-specific hybridization.The RNA and DNA and ribozyme of antisense can be obtained with existing any synthesis RNA or DNA technology, and the technology of such as solid phase phosphoamide chemical synthesis synthetic oligonucleotide has been widely used.Antisense rna molecule can transcribe acquisition in vitro or in vivo by encoding the DNA sequence dna of the RNA.This DNA sequence dna has been integrated into the downstream of the RNA polymerase promoter of carrier.In order to increase the stability of nucleic acid molecules, it can be modified with a variety of methods, such as increase the connection application phosphorothioate bond or peptide bond rather than bony acid diesters key between two Side sequence length, ribonucleotide. Polynucleotides, which import tissue or intracellular method, to be included：Polynucleotides are directly injected into in-vivo tissue；Or pass through carrier in vitro（Such as virus, bacteriophage or plasmid）First polynucleotides are imported in cell, then transplanted cells into internal etc..

The present invention will be further illustrated in the following examples, but is not to limit the present invention with this.Embodiment

Embodiment 1:Encode the cDNA of threonyl tRNA synthetase clone：

Human fetal spleen total serum IgE is extracted with guanidinium isothiocyanate/expect/chloroform one-step method.With Quik mRNA separating kits（Qiegene poly (A) mRNA) is separated from total serum IgE.2ug poly (A) mRNA are through reverse transcription formation cDNA. Smart cDNA clone kits（Purchased from Clontech) cDNA fragments orientation is inserted on vector multiple cloning site, conversion escherichia coli DH5a formation cDNA library.3028 clones are obtained altogether.The sequence of the 5' and 3' ends of all clones is determined with dideoxy.The cDNA sequence of measure is compared with existing public DNA sequence data storehouse, it is new DNA as a result to find the DNA sequence dna for having a clone (215H11).Two-way measure is carried out by synthesizing a series of contained DNA sequence dna of primer pair 215H11 clones.Computer analysis shows, the contained full-length cDNA of 215H11 clones is a new DNA sequence dna（As shown in swSeq ID Nol）, the sequence is stored in PBS plasmids（), pBS-thrS there is 2156bp ORF from 53bp to 2209bp, encode a new protein（As shown in Seq ID No 2）.This protein is named as Soviet Union's ammonia barefoot tRNA synthetase by us.Embodiment 2:Expression and purifying of the threonyl tRNA synthetase albumen in E. coli system

According to new people Soviet Union corresponding gene order of ammonia barefoot tRNA synthetase albumen, a pair of specificity amplification primers are designed, sequence is as follows： Primer 1:5, GGGAGAAGCGGCGATAATCTG 3'

Primer 2: 5' GTTTGTATTTATTTATTTATTTATT 3'

The two sequences contain Ndel and Hindlll restriction enzyme sites respectively, thereafter respectively target gene 3, end and 5, the coded sequence at end, using the pBS plasmids containing total length target gene as template, enter performing PCR reaction.Ndel and Hindlll restriction enzyme site is corresponding to the liquor-saturated site of selective inscribe on expression vector plasmid PTSA-18.Digestion is carried out to extension increasing sequence and plasmid PTSA-18 respectively with Ndel and Hindlll and connected.Recombinant plasmid transformed is entered into Host Strains e. coli bl21 (DE3) plySs, and IPTG inductions are expressed.Expression product passes through carrying out ultrasonic bacteria breaking and thermal denaturation, then upper DEAE posts, the destination protein purified.Embodiment 3:The Homology search of cDNA clones

The sequence of polynucleotides and its protein sequence of coding of the new human threonine tRNA synthetase albumen provided with the present invention carry out Homology search to databases such as Genbank, Swissport, and the program for retrieval is Blast (Basic local Alignment search tool) (1993 Proc Nat Acad Sci 90:5873- 5877), Blast can find out many genes with threonyl tRNA synthetase albumen homology, the gene for the genetic homology maximum wherein invented with us, its albumen encoded can be recalled in Genbank access number gene or protein sequence that for M63180., these are retrieved from Genbank databases.The sequence recalled can use the Pileup (multisequencing in GCG software kits）With Gap (two sequences）Program, which is done even to match somebody with somebody, to be compared.The function prediction of new albumen can be analyzed with Motif programs.The result of Homology search is as follows, and human threonine tRNA synthetase albumen of the human threonine tRNA synthetase albumen that the result display present invention is provided with being provided in Genband databases has 61% homology（Refer to following table）. -61-

Z L d333V0) { ^ofqS d 33V a++ 3 of 03 Ι Shang of SH Week δ 3 269

9032 dI33VNdAaXN6l3A1M5AVa fflZ

169 siiH30HA¾NaHXHiNAioii)iH>i30MiidNAi3vn5VNan)f ixaodaiaiawu va ZZ9 ^ofqs

The a a+a++ V of+30+0 Λ Λ JNA V15V of+NCIM Shang Μ+3 Μ of Ι Ν Λ Shang 9

The beautiful H Shang HI of ￡ UZ dl Knitting ina console M) ISC) 35 {) Md6dNAHni3 Ring SirWSaV That SA13W δ

IS9 HJ55HAN5VA3a31dDAdAAWA&adSlttddVl)I90AN3niVI 3AS01IVaHAIAciaM 2 9 :13「qS δ+ +VA3+ OAd+A+Ab dSlM d MOO +31+ ++H3AS01+\¾H++AdH+

C96I HlS56V3¾VA3353S0AdIAMBJdSlAnd- ¾000S3VlA9na3AS01A¾HnAda3 Z8ZI :^n(5 us Ma3oaHSAAnNd¾icn5daii3iiv3C)HAii9iva¾i5iai¾d{)AJV3a3SNi3 )i30d3N 219 ： w「qs

9 enter l+dM+cHCUaiClI Shang δ Η H3+Va++ ai dOAdV9aOSN1+M 30J3

98ΖΪ !-VOVOOMAiDiadincnOdai5lX33i5Hda01VaHlHAaiMdOA₁JVDaOSNiaMd30J3¾ 0Ϊ9Τ ： ^anO

ITS lSN3l5¾3V5a 3ia01J)13dyiSlNlMdSJ0JASAAXHlJaiD0 iaa3l63WVDdIH Z9f :l。fqS 1+ +Ί +3V0aAl+ aOld dHlSl Λ+ΑΛ+H D +13 3+0+ DdlH

6091 lVb¾lA03V5aM13da01dOSdHlSlV1HdSd01AVAASinjaiDS8I3V3l5aXX3JIH 0£Π ：^"5

1 ^ vaa60dM anonv3si3NMHi30davimcn3iiAisadMHajwiSHDd3NWd ivJi3 26ε :i." the Η Η ojaviaidiHaMSHdHH dm H d of qs ν α α δ ω Η+Η Π Ο i os 3 along d+

6S vaao(5d3aiano9ioosv3VHHivodavimcn3aMsadaHVdwioHVd3 Wd)nviia οζζι ：^"& z+ =¾¾^ %%SL) iz pz =^Y^ '(%i9) ιζε/86τ =^H f

901-38*8 = d '901-38*8 = ^t ⁴(^sHq l*99£) 01^01

S,Z00/00ND/lDd 66661/10 OM Embodiment 4:The generation Peptide synthesizer of anti-threonyl tRNA synthetase antibody（PE-ABI following threonyl transfer ribonucleic acids) are synthesized and synthesize dark specific polypeptide： H2-Leu Tyr Gin Arg Trp Arg Cys Leu Arg Leu-COOH.The polypeptide is coupled to form compound with hemocyanin and bovine serum albumin(BSA) respectively, method referring to：Avrameas, etc. immunochemistry（ . Immunochemistry ),1969; 6:43.Complete Freund's adjuvant immunizing rabbit is added with the above-mentioned hemocyanin polypeptide complexes of 4mg, adds incomplete Freund's adjuvant booster immunization once with hemocyanin polypeptide complex again after 15 days.Using through 15 μ₈The coated titer plates of bovine serum albumin polypeptide compound of/π ι 1 do the titre that ELISA determines antibody in rabbit anteserum.Total I is separated from the rabbit anteserum of antibody positive with albumin A-Sepharose_gG.Polypeptide is incorporated on the Sepharose 4B posts of cyanogen bromide-activated, anti-peptide antibody is separated from total IgG with affinity chromatography.Immuno-precipitation proves that the antibody of purifying can be combined specifically with threonyl tRNA synthetase.

Sequence table

(1) general information:

(i) applicant：

(A) name：Shengyuan Gene Development Co., Ltd., Shanghai

(B) street：The Room 610 of Beijing East Road 668

(C) city：Shanghai

(E) it is national：China

(F) postcode： 200001

(ii) denomination of invention：Encode the gene and its application and preparation method of a kind of new threonyl tRNA synthetase

(iii) sequence number： 2

(1) general information：

(2)SEQ ID NO:1 information：

(i) sequence signature：

(A) length： 2741bp

(B) type：Nucleic acid

(C) chain：Double-strand

(D) topological structure：Linearly

(ii) molecule type： cDNA

(xi) sequence description： SEQ ID NO: 1:

1 GGGAGAAGCGGCGATAATCTGTTTGAGGATGTAGGCACTGGTGTGAAGGAACATGGCCCT 61 GTATCAGAGGTGGCGGTGTCTCCGGCTCCAAGGTTTACAGGCTTGCAGGCTACACACGGC 121 AGTTGTGTCGACCCCTCCACGCTGGTTGGCAGAGCGGCTTGGCCTTTTTGAGGAGCTGTG 181 GGCTGCTCAGGTAAAGAGATTAGCAAGCATGGCACAGAAGGAACCCCGGACTATTAAGAT

241 ATCACTTCCTGGAGGCCAGAAAATTGATGCTGTGGCATGGAACACAACCCCCTACCAACT 301 AGCCCGGCAGATCAGTTCAACACTGGCAGATACTGCAGTGGCTGCTCAAGTGAATGGAGA

361 ACCTTATGATCTGGAGCGGCCCTTGGAGACAGATTCTGACCTCAGATTTCTGACATTCGA

421 TTCCCCAGAGGGGAAAGCAGTGTTCTGGCACTCCAGCACCCATGTCCTGGGGGCAGCAGC

481 TGAACAATTCCTAGGTGCTGTTCTCTGCAGAGGTCCAAGTACAGAATATGGCTTTTACCA

541 TGATTTCTTCCTGGGAAAGGAGAGGACAATCCGGGGCTCAGAGCTGCCTGTTTTGGAGCG

601 GATTTGCCAGGAACTTACAGCTGCTGCTCGACCCTTCCGGAGGCTAGAGGCTTCACGGGA

661 TCAGCTTCGCCAGTTGTTCAAGGATAACCCCTTTAAGCTTCACTTGATTGAGGAGAAAGT

721 GACAGGTCCAACAGCAACAGTATATGGGTGTGGCACATTGGTTGACCTTTGCCAGGGCCC

781 CCACCTTCGGCATACTGGACAGATTGGAGGACTGAAGCTGCTATCGAACTCATCATCCTT

841 ATGGAGGTCTTCAGGGGCCCCAGAGACACTGCAGAGAGTGTCAGGGATTTCCTTCCCTAC

901 AACAGAATTGCTGAGGGTCTGGGAAGCATGGAGGGAGGAAGCAGAATTGCGGGACCACCG

961 GCGCATTGGGAAGGAACAGGAGCTCTTCTTCTTCCATGAACTGAGCCCTGGGAGCTGCTT

1021 CTTCCTGCCACGAGGGACAAGGGTGTATAATGCACTAGTGGCGTTTATCAGGGCTGAGTA

1081 TGCCCATCGTGGTTTCTCCGAGGTGAAAACTCCCACACTGTTTTCTACGAAGCTCTGGGA

1141 ACAGTCAGGGCACTGGGAGCATTATCAGGAAGACATGTTTGCCGTGCAGCCCCCAGGCTC

1201 TGACAGGCCTCCCAGCTCCCAGAGTGACGATTCTACCAGGCATATCACAGATACACTCGC

1261 CCTCAAGCCTATGAACTGCCCTGCACACTGCCTGATGTTCGCCCACCGGCCCAGATCCTG

1321 GCGGGAACTGCCCCTGCGACTAGCTGACTTTGGGGCTCTACACCGGGCCGAAGCCTCTGG

1381 TGGTCTGGGGGGACTGACCCGACTGCGGTGCTTCCAGCAGGATGACGCTCACATCTTCTG

1441 TACAACAGATCAGCTGGAAGCAGAGATCCAAAGCTGTCTTGATTTCCTCCGTTCCGTCTA

1501 TGCCGTTCTTGGCTTCTCCTTCCGCCTGGCACTGTCCACCCGGCCATCTGGCTTCCTGGG

1561 GGACCCTTGCCTTTGGGACCAGGCCGAACAGGTCCTTAAACAGGCCCTGAAGGAATTTGG

1621 AGAACCCTGGGACCTCAACTCTGGAGATGGTGCCTTCTATGGACCTAAGATTGACGTGCA

1681 CCTCCACGATGCCCTGGGCCGGCCACATCAGTGTGGGACAATTCAGCTTGACTTCCAACT

1741 GCCCCTGAGATTTGACCTCCAGTATAAGGGGCAGGCGGGTGCCCTGGAGCGTCCAGTCCT

1801 CATTCACCGAGCAGTGCTCGGTTCTGTGGAAAGACTGTTGGGAGTGCTGGCAGAAAGCTG 1861 CGGGGGGAAATGGCCACTGTGGCTGTCCCCGTTCCAGGTGGTGGTCATCCCTGTGGGGAG 1921 TGAGCAAGAGGAATACGCCAAAGAGGCACAGCAGAGCCTGCGGGCTGCAGGACTGGTCAG 1981 TGACCTGGATGCAGACTCTGGACTGACCCTCAGCCGGAGAATCCGCCGGGCCCAGCTTGC 2041 CCACTACAATTTTCAGTTTGTGGTTGGCCAGAAAGAGCAAAGTAAGAGAACAGTGAACAT 2101 TCGGACTCGAGATAATCGTCGCCTTGGGGAGTGGGACTTGCCTGAGGCTGTGCAGCGACT 2161 GGTGGAGCTACAGAACACGAGGGTCCCAAATGCCGAAGAAATTTTCTGAGCCTTTGTACA 2221 TAGATGAGGCAAAAACCTGCGAGTGCCATCAGCCTCCCTCACATGGGAGACCCCAACCCA 2281 GCTGACAATGTGGAGCCCCCAGAACTTCAGAACTGTGTGGAGGCACATGTCTGCTCTCCT 2341 GAAAAGAGACTTGGTTTGGGGACCCCACAAAAGGAGGGAAGCTGTAGCTGTTTGGATGTG 2401 AGGAGAATGAAACTACAAAAAAAATAAATTGGGCCAGGCGCAGTGGCTCATGCCTGTAAT 2461 CCCAGCACTCTGGGAGGCTGAGGCGGACGGATCATGAGGTCAGGAGATCAAGACCACCCT 2521 GGCTAACACGGTGAAACCCTGTCTCTACTAAAAATACAAAAAATTAGCCGGGCATGGTGG 2581 CACACGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG 2641 AGGTAGAGGTTGCAGTGAGCTGAGATTGCGCCACTGCACCCCCCTAGGCGACAGAGCGAG 2701 ACTCTGTCTCTAAATAAATAAATAAATAAATAAATACAAAC

(2)SEQ ID NO:2 information：

(i) sequence signature：

(A) length：718 amino acid

(B) type：Amino acid

(D) topological structure：Linearly

(ii) molecule type：Polypeptide

(xi) sequence description： SEQ ID NO: 2:

1 Met Ala Leu Tyr Gin Arg Trp Arg Cys Leu Arg Leu Gin Gly Leu

16 Gin Ala Cys Arg Leu His Thr Ala Val Val Ser Thr Pro Pro Arg

31 Trp Leu Ala Glu Arg Leu Gly Leu Phe Glu Glu Leu Trp Ala Ala

46 Gin Val Lys Arg Leu Ala Ser Met Ala Gin Lys Glu Pro Arg Thr

61 lie Lys lie Ser Leu Pro Gly Gly Gin Lys lie Asp Ala Val Ala

76 Trp Asn Thr Thr Pro Tyr Gin Leu Ala Arg Gin lie Ser Ser Thr

91 Leu Ala Asp Thr Ala Val Ala Ala Gin Val Asn Gly Glu Pro Tyr 。·¾ ΐ¾ "TO na 90Z

"TO ^ΐθ naq 169

•IV V ： V V ΐ^ΒΛ •ias "TO 9Z9

I ■IV ： V 31 91 dsy^BTV dsy 9^9 dsy 9 9S "Ti "TO "TO IC9

jag na dj:The w V ns OJJ TO Γ " TO 109 of Shang 1

TO ΐΒΛ 0 ³Ί T¾ 8JV 989

II T¾ ⁰The TO TO ^ θ Shang Ζ 9 of 2-cV 31

19 naq o_tj nsq i f) uiO J¾ 9S9 TO 。 "TO ^SV ^STH dsy I f 9 U 9

^SV Shang a S Q OJJ dsy 3Md o-id s^v iMX V Shang I is S

"TO ID "10 dsy

■〇 dsy V TO a naq I f

：The TV of Shang 0^STH nsq 9St dsy ¾" V ^ηθΊ naq ⁹10 Shang 3JV Zf STH^BTV ^s d 9Ί SXQ H •id 0 usy o¾ 90

V H S dsy dsy 16

TO 9S S •id dsy 0 ΐ^ΒΛ ^BTV aqd 9i ￡ SV 9 TO iA Shang " the s TO of TO H 10 " TO d>I Shang T9S ^d 0^aThe S of 91 usy Shang l ￡ Z JV Shang Md ■ ■ of Md ^TD 9K Η B Shang TO 3jy Π 13 " the IV BIV of 10 9IS Η M3,13 TO TO ■ IV 3jy dsy τ ο ε naq 00 " TO Β Λ 3JV na na mz

The S 3JV TO J X η θ ILZ of TO Shang Shang S Π 3-13：- ias-tsS-is the S of V J Shang 91^SV neq 9 Z

0 si Η TH \ \Z

The ■ Shang Β Λ m Shang 9ZZ of Β Λ ^3 0

ID 0 0 si Η s ο¾ usy dsy Π Ζ Ί 0 ^SV nsq 961

TV 0 n 3-iy niO naq Ϊ8Ϊ

Π "TO na 99ΐ

'Md ^dsThe Bay s^D TST of V sin Shang 9iy TO 19

^BTV ^3 sqd "ΐΰ 'TO Β_ΐΝ ¾τν ^Βΐν ■ΐ3 η^Ί ΐΒΛ STH 9ST

The nig '-is S dsy a ι ζ ι of C3S-I9S stn I Shang 9iy τ Λ TV sA χ 9

ΙΘΊ aqd 3JV ^SV Shang^ηΐ3 ^η31 "TO dsy 901

SZ.r00/00N3/lDd 66661/10 O

Claims (1)

1. Claim

   1. a kind of Soviet Union's ammonia barefoot transfer ribonucleic acid synthesis of separation is dark, it, which is included, has the polypeptide of amino acid sequence shown in SEQ ID No. 2 or its conservative variation's polypeptide or its active fragment or its reactive derivative.

   2. polypeptide as claimed in claim 1, it is the polypeptide with the amino acid sequences of SEQ ID No. 2.

   3. a kind of a kind of polynucleotides of separation, its nucleotides sequence included with being selected from the group shows the nucleotide sequence of at least 70% phase same sex：

   (a) polynucleotides of polypeptide as claimed in claim 1 or 2 are encoded；

   (b) with（A) polynucleotides of the polynucleotides complementation in.

   4. polynucleotides as claimed in claim 3, it encodes the polypeptide with amino acid sequence shown in SEQ ID No. 2.

   5. polynucleotides as claimed in claim 3, it is a kind of polynucleotide sequence in being selected from the group：

   (a) there is the sequence of 53-2209 in SEQ ID No. 1；

   (b) there is the sequence of 1-2741 in SEQ ID No. 1.

   6. a kind of polynucleotide sequence Chong Group carriers containing described in claim 3,4 or 5.

   7. a kind of genetically engineered host cell, it is a kind of host cell being selected from the group：

   (a) with the carrier conversion described in claim 6 or the host cell of transduction；

   (b) with the polynucleotides conversion described in claim 3,4 or 5 or the host cell of transduction.

   8. a kind of preparation method for the active polypeptide of ammonia barefoot tRNA synthetase of being revived with people, it includes： (a) under conditions of suitable expression threonyl transfer ribonucleic acid synthesis is dark, the host cell described in culture claim 7；

   (b) polypeptide with threonyl tRNA synthetase activity is isolated from culture.

   9. a kind of antibody that can be specifically bound with threonyl tRNA synthetase described in claim 1.

   10. a kind of screen simulation, promotion, antagonism or the method for suppressing the compound of Soviet Union's ammonia barefoot transfer ribonucleic acid synthol activity described in claim 1, including the use of the polypeptide described in claim 1.

   11. the compound that method as claimed in claim 10 is obtained, it has simulation, promotion, antagonism or the activity for suppressing threonyl transfer ribonucleic acid synthol activity described in claim 1.

   12. compound regulation threonyl tRNA synthetase described in a kind of application claim 11 in vivo, the method for external activity.

   13. the method for-kind of the detection disease related to the polypeptide described in claim 1 or 2 or disease susceptibility, it is characterized in that the exception of the expression quantity of polypeptide and/or activity described in test right requirement 1, or detection cause the mutation in polypeptide nucleotide sequence described in the expression quantity and/or the abnormal coding claim 1 of activity of polypeptide described in claim 1.

   14. the purposes of polypeptide as claimed in claim 1 or 2, it is used to screening the activator for promoting threonyl transfer ribonucleic acid synthol activity, or screening suppresses the antagonist of threonyl tRNA synthetase activity or be used for peptide fingerprinting to know identification well.

   15.-kind of pharmaceutical composition, it contains the polypeptide and pharmaceutically acceptable carrier described in the claim 1 of therapeutically effective amount.

   16. the polypeptide of claim 1 or the compound of claim 11 prepare be used to treat and ammonia barefoot tRNA synthetase of reviving the abnormal related disease of activity pharmaceutical composition in purposes.

   17. the purposes described in claim 16, wherein the disease is threonyl tRNA synthetase hypofunction or loses caused disease, including various cancers.