CN1366066A - Process, primer and probe for detecting and discriminating enterovirus - Google Patents
Process, primer and probe for detecting and discriminating enterovirus Download PDFInfo
- Publication number
- CN1366066A CN1366066A CN 01100622 CN01100622A CN1366066A CN 1366066 A CN1366066 A CN 1366066A CN 01100622 CN01100622 CN 01100622 CN 01100622 A CN01100622 A CN 01100622A CN 1366066 A CN1366066 A CN 1366066A
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- primer
- enterovirus
- pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The application of nucleotide primer to detecting enterovirus, the synthetic nucleotide sequence for specific hybridization reaction with message strand of enterovirus nucleic acid or the relative nucleic acid. The detection method and the reagent kit are disclosed.
Description
The present invention has disclosed nucleotide primer to the application in the whether existence of enterovirus in detecting a corpse or other object for laboratory examination and chemical testing.The present invention also discloses and can or be relevant to the synthetic property nucleotide sequence that the nucleic acid of this sense strand carries out the specific hybrid reaction with the sense strand of enterovirus nucleic acid.The invention provides and detect method that whether enterovirus nucleic acid exists and the test kit of detection enterovirus in a corpse or other object for laboratory examination and chemical testing in a corpse or other object for laboratory examination and chemical testing.The present invention provides method and the test kit that detects and differentiate enterovirus 71 types in the corpse or other object for laboratory examination and chemical testing and/or coxsackie virus A 16-type especially.
Enterovirus belongs to Picornaviridae (Picornaviridae).This Viraceae is represented very large RNA viruses family on number of members, but all be one of minimum on virion size and complexity.The virosome of enterovirus comprises by 60 sub-cells and being formed that each sub-cell centers on the genosome that is formed by strand justice RNA by four kinds of protein (VP1-VP4) with the icosahedron symmetric mode.Enterovirus is of short duration to dwell in the human digestive road, also can separate from enteron aisle back segment or throat.The enterovirus of human origin comprises poliomyelitis virus (serotype 1 to 3), CA group (CAV, serotype 1 to 22 and 24) and Coxsackie B virus group (CBV, serotype 1 to 6), the lonely virus of intestinal cell pathology (serotype 1 to 9,11 to 27 and 29 to 33) and enterovirus (serotype 68-71).Human enterovirus infection can cause relating to nerve on a large scale, skin and mucous membrane, heart and muscle, eye, the acute symptom of respiratory tract and gastrointestinal tract disease, and the pyreticosis of not having obvious characteristic, extensive diseases in infants and diabetes.In the enterovirus of non-poliomyelitis, some unfiled infection that serotype caused prevail in some country and regional, for example enterovirus 70 types and 71 types in summer and early autumn especially.Enterovirus 71 types were once separated on one's body by the paralysis patient who suffers from meningitis, encephalitis and similar poliomyelitis myelitis, still the major cause of fatal central nervous system disease in the world the time.Moreover this C-type virus C causes the outburst of human hand-foot-mouth disease in some areas, for example in Japan, and Sweden and Taiwan.
Enteroviral general diagnostic generally includes virus results and serological test.The separation of virus can comprise that larynx water, throat cotton are wiped away from gargling, ight soil, rectum cotton are wiped away middle isolated viral, sometimes can be from celiolymph (in the situation of aseptic meningitis) isolated viral.To be seeded to breeding and evaluation in tissue culture or the suckling mouse (latter is Coxsackie virus specially) through the viral sample of separation.The viral results program of this kind expended for one to two week at every turn and just can finish.In addition, also need the qualified technician to participate in just being accomplished.
Neutralization test is carried out usually to detect the neutrality antibody to infective virus tool specificity in the serological test aspect.For the lonely virus of some intestinal cell pathologies, hemagglutination inhibition test can point out that serotype specificity infects.Serum antibody also can use infected cell culture to detect and titration as antigen on cover glass via immunofluorescence technique.Yet serological test is difficult to use in assessment, because the kind of serotype is a lot, unless used antigen is to be separated or separated when the outburst of typical clinical disease popularity by the unique individual.In all serological tests, the personnel that have the knack of present technique must go to judge that what person is signals (cut-off values) from reading as a result.Simultaneously, employed in these trials antigen needs special technology and for some time to prepare to reduce the incidence of heterogeneous type reaction or cross reaction usually.
Virus results and serological test all can not provide a diagnostic tool fast.Yet the acute symptom relevant with enterovirus can develop very speed, may develop into mortality in some case in a couple of days.Therefore for actually can be fast and the enteroviral method of simple detection driven demand is arranged.
The present invention relates to new oligonucleotide to whether existing at a corpse or other object for laboratory examination and chemical testing to be used for detecting enterovirus.The present invention's concrete primer is to comprising first primer and second primer, and it can be used for going out disease relevant with enterovirus or symptom via nucleic acid amplification test (as polymerase chain reaction) quick diagnosis.
The present invention makes us finding uncannily that some nucleotide sequence systems are relevant to the conservative property zone in the enterovirus nucleic acid.Therefore, the present invention and then synthetic property nucleotide sequence is provided, it can specificity be hybridized with the sense strand of enterovirus nucleic acid or the nucleic acid that is relevant to this sense strand.
On the other hand, the present invention relates to a kind of method whether enterovirus nucleic acid exists that detects in a corpse or other object for laboratory examination and chemical testing.The present invention's method comprise (a) in an amplification method with this corpse or other object for laboratory examination and chemical testing and one of the present invention Oligonucleolide primers to contacting; And (b) via the existence that detects amplified production whether existing whether with the decision enterovirus.
Preferably, in the present invention's method, this corpse or other object for laboratory examination and chemical testing can contact the Oligonucleolide primers of second couple of the present invention except first pair of primer simultaneously in amplification method.Primer second centering is different with the primer of first centering.Primer second centering can have first primer or second primer different with the corresponding primer of first centering.Preferably, two of second centering primers are all different with first pair primer.And then this corpse or other object for laboratory examination and chemical testing can contact the Oligonucleolide primers except the 3rd couple of the present invention first pair and the second pair of primer simultaneously in amplification method.Same, neither same at the primer of the 3rd centering with the primer of first pair or second centering.
On the other hand, the present invention's method can and then be included in the amplification method second Oligonucleolide primers with the product of this step (a) and the present invention to contacting.The second pair of primer is through selection and the sequence that can be used to increase in an amplification method, and this sequence is same as or is contained in the sequence that can obtain in the amplification method that uses first pair of primer.
The inventive method on the other hand, at least one the synthetic property nucleotide sequence in the detected amplified production of step (b) and the present invention can be carried out specific hybrid reaction.
On the other hand, the present invention is relevant to a kind of method that detects and differentiate enterovirus 71 types in a corpse or other object for laboratory examination and chemical testing.This method comprises (a) and in an amplification method this corpse or other object for laboratory examination and chemical testing is contacted with at least one pair of Oligonucleolide primers of the present invention; (b) via the existence that detects amplified production whether existing whether with decision enterovirus 71 types; And (c) will carry out specific hybrid and react at the detected amplified production of step (b) and the present invention's the synthetic property nucleotide sequence that contains sequence SEQ ID NO:12 or SEQ ID NO:13.Preferably, detected amplified production system and the present invention's the synthetic property nucleotide sequence that contains sequence SEQ ID NO:12 and SEQ ID NO:13 carries out the specific hybrid reaction.
On the other hand, the present invention relates to a kind of method that in a corpse or other object for laboratory examination and chemical testing, detects and differentiate coxsackie virus A 16-type.This method comprises (a) and in an amplification method this corpse or other object for laboratory examination and chemical testing is contacted with at least one pair of Oligonucleolide primers of the present invention; (b) via the existence that detects amplified production whether existing whether with the decision coxsackie virus A 16-type; And (c) will carry out specific hybrid and react at the detected amplified production of step (b) and the present invention's the synthetic property nucleotide sequence that contains sequence SEQ ID NO:14 or SEQ ID NO:15.Preferably, detected amplified production system and the present invention's the synthetic property nucleotide sequence that contains sequence SEQ ID NO:14 and SEQ ID NO:15 carries out the specific hybrid reaction.
On the other hand, the present invention relates to a kind of method that in a corpse or other object for laboratory examination and chemical testing, detects and differentiate enterovirus 71 types and/or coxsackie virus A 16-type.This method comprises (a) and in an amplification method this corpse or other object for laboratory examination and chemical testing is contacted with at least one pair of Oligonucleolide primers of the present invention; (b) via the existence that detects amplified production whether existing whether with decision enterovirus 71 types and/or coxsackie virus A 16-type; And (c) will contain the synthetic property nucleotide sequence of sequence SEQ IDNO:12 or SEQ ID NO:13 and synthetic property nucleotide sequence that at least one contains sequence SEQ ID NO:14 or SEQ ID NO:15 and carry out specific hybrid and react at least one of the detected amplified production of step (b) and the present invention.Preferably, detected amplified production system and the present invention's the synthetic property nucleotide sequence that contains sequence SEQID NO:12, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:15 carries out the specific hybrid reaction.
On the other hand, the invention provides the test kit that detects enterovirus in a corpse or other object for laboratory examination and chemical testing, it comprises at least one pair of Oligonucleolide primers of the present invention.Preferably, the present invention's test kit comprises and surpasses a pair of Oligonucleolide primers of the present invention.In the present invention on the other hand, this test kit can and then comprise the synthetic property nucleotide sequence of at least one the present invention.
On the other hand, the invention provides the test kit that detects and differentiate enterovirus 71 types in a corpse or other object for laboratory examination and chemical testing, it comprises at least one pair of Oligonucleolide primers of the present invention and at least one contains the synthetic property nucleotide sequence of sequence SEQID NO:12 or SEQ ID NO:13.Preferably, the present invention's test kit comprises and surpasses a pair of Oligonucleolide primers of the present invention.In the preferred embodiment of the invention, this test kit system comprises the synthetic property nucleotide sequence that contains sequence SEQ ID NO:12 or SEQ ID NO:13.
On the other hand, the invention provides the test kit that detects and differentiate coxsackie virus A 16-type in a corpse or other object for laboratory examination and chemical testing, it comprises at least one pair of Oligonucleolide primers of the present invention and at least one contains the synthetic property nucleotide sequence of sequence SEQ ID NO:14 or SEQ ID NO:15.Preferably, the present invention's test kit comprises and surpasses a pair of Oligonucleolide primers of the present invention.In the preferred embodiment of the invention, this test kit system comprises the synthetic property nucleotide sequence that contains sequence SEQ ID NO:14 or SEQ IDNO:15.
On the other hand, the invention provides the test kit that in a corpse or other object for laboratory examination and chemical testing, detects and differentiate enterovirus 71 types and/or coxsackie virus A 16-type, it comprises at least one pair of Oligonucleolide primers of the present invention, and at least one contains the synthetic property nucleotide sequence that sequence SEQ ID NO:12 or SEQ ID NO:13 and at least one contain sequence SEQ ID NO:14 or SEQ ID NO:15.Preferably, the present invention's test kit comprises and surpasses a pair of Oligonucleolide primers of the present invention.In the preferred embodiment of the invention, this test kit system comprises the synthetic property nucleotide sequence that contains sequence SEQ ID NO:12-15.
The synoptic diagram demonstration of Fig. 1 is relevant to one of enterovirus 71 types Partial cDNA Sequence, and the cDNA sequence system that wherein has numbering U22521 derives from the GenBank database.Sequence in frame is relevant to the present invention's primer and probe, and it is indicated with the employed name of contriver respectively.
Fig. 2 is the combination with different primers, utilizes the electrophoretic analysis figure of PCR amplification enterovirus 71 type nucleic acid.The primer of capable each use of a to h is to being: a:f1/r1, b:f2/r1, c:f3/r1, d:f5/r1, e:f1/r2, f:f2/r2, g:f3/r1, h:f5/r2.M is the big tick marks of nucleic acid, and 1 to 5 is respectively: 1: 600bp, 2: 500bp, 3: 400bp, 4: 300bp, 5: 200bp.
Fig. 3 be the nucleic acid of enterovirus 71 types and coxsackie virus A 16-type after PCR amplification with enterovirus cenotype probe (p1, p2, p3) result of hybridization.The primer of polymerase chain reaction use is paired into f5/r1, and the branch position that is fixed on the nylon membrane probe is as follows: the left side first row's the 2nd to 4 point: p1, middle row's the 2nd to 4 point: p2, the right first row's the 2nd to 4 point: p3; 1 and 2: enterovirus 71 types and coxsackie virus A 16-type nucleic acid; 3: for not containing the control group of nucleic acid.
Fig. 4 is enterovirus 71 types, the nucleic acid of the lonely virus of coxsackie virus A 16-type and intestinal cell pathology the 3rd type is respectively after multiplex PCR (multiplex PCR) amplification, with enterovirus cenotype probe (p1, p2, p3) and enterovirus 71 types, coxsackie virus A 16-type specific probe (71-2,71-3,16-1,16-2) result of hybridization.The primer of polymerase chain reaction use is paired into fS/r1 and f7/r4, the distributing position that is fixed on the nylon membrane probe is as follows: the five equilibrium that this 6 * 6 dot matrix cross is divided into 43 * 3, wherein the upper left side block belongs to enterovirus cenotype probe block, each row respectively is that 3 of 3 probes repeat, upper right block is enterovirus 71 type districts, be staggered by two specific probes, the lower-left block is the coxsackie virus A 16-type district, is staggered by two specific probes.
Term " specific hybrid " or " specific hybrid reaction " mean the complementarity hybridization between oligonucleotides and the target sequence. Term " specificity " or " specifically " mean the shown specificity of this complementarity hybridization, and it allows between this oligonucleotides and this target sequence a little mispairing to be arranged but annealing that can negative effect detection hybridization signal.
Term " corpse or other object for laboratory examination and chemical testing " means to comprise any corpse or other object for laboratory examination and chemical testing that contains the biological material of nucleic acid. Preferably, term " corpse or other object for laboratory examination and chemical testing " means to comprise whole blood, serum, and urine, saliva, celiolymph, seminal fluid, tear, the throat cotton is wiped away, and the rectum cotton is wiped away, the biological corpse or other object for laboratory examination and chemical testing of excreta etc.
Term " amplification method " means test or the method for amplifying nucleic acid sequence. For example, should " amplification method " comprise polymerase chain reaction (PCR) test, ligase chain reaction (LCR) test, Q β-replicase TRAP in vitro transcribes method, in vitro reverse transcription method and the property sequence replicating of controlling oneself.
Term " height stringent condition " means selected hybridization conditions and hangs down 5 ℃ with regard to particular sequence and set ionic strength and the lower approximately hotter melting point (Tm) of pH value. During hot melting point temperature the target sequence of (under set ionic strength and pH value) 50% can with the Probe Hybridization of pairing fully mutually. Typically, under the height stringent condition, salinity is about 0.2M and temperature is higher than 60 ℃ at least at pH 7.
Comprise the natural origin purine that in the n DNA molecule, can find of representative and code name (that is, A, the G of pyrimidine at this used base code name, T and C), and have the knack of this operator synthetic oligonucleotide known representative mix base code name (such as R, Y, S, H). About the employed code name of this case specification, A (or a) expression adenine, G (or g) represents Guanine, T (or t) represents thymidine, and C (or c) represents cytimidine, R (or r) expression adenine or Guanine, Y (or y) expression thymidine or cytimidine, S (or s) expression Guanine or cytimidine, and H (or h) expression adenine, thymidine or cytimidine.
The present invention can be used for detecting the nucleic acid derived from enterovirus. The invention provides fast and sensitive method to detect whether existing derived from the nucleic acid of enterovirus. In the preferred embodiment of the invention, the present invention's method is the test based on polymerase chain reaction (PCR). On the other hand, the invention provides very special PCR primer pair, it can be used for detecting and/or confirming specific enterovirus serotype, such as enteric virus71 type and coxsackie virus A 16-type. On the other hand, the invention provides the specificity nucleotide sequence, its can with certainly use primer of the present invention to the available nucleic acid fragment of amplification method carry out specific hybrid reaction.
Have some amplification methods all can use, but the method for PCR-based is preferred. PCR method is very detailed known in related art techniques, therefore only sketches at this. Look at for the comprehensive of PCR method and step procedure, but reference example as, U.S. patent Nos.4,683,195 and 4,683,202; 4,965,188; And the PCR step procedure that the people write " A Guide to Methods and Application " such as Innis (Academic Press, Inc., San Diego, CA. 1990). PCR reactant and method program also can the persons of getting for commercialization.
Because enterovirus is RNA virus, the first step of amplification method is for making DNA copy (cDNA) for the zone of wanting to copy. The mode that reverse transcription method can separate is carried out, or carries out in the mode of homogenieity reverse transcription-polymerase chain reaction (RT-PCR), and the latter is for being used for the polymerase chain reaction modification method of cloning RNA. Be fit to the method that enterovirus nucleic acid carries out pcr amplification seen and be set forth in Romero and it " Diagnostic Molecular Biology:Principles and Applications " pp.401-406 of Rotbart, the people such as Persing write (Mayo Foundation, Rochester, MN 1993); The people U.S. patent No.5 such as Rotbart, 075,212 and the people such as Egger, J.Clin.Microbiol.33:1442-1447 (1995).
The invention provides new Oligonucleolide primers to whether existing to be used for detecting enterovirus at a corpse or other object for laboratory examination and chemical testing. The present invention's concrete primer is to comprising the first primer and the second primer, and it can be used for via nucleic acid amplification test (for example polymerase chain reaction) quick diagnosis disease or symptom relevant with enterovirus. The present invention's primer is sought mark to sense strand or the antisense strand in the specific conservative zone of encoding. Single primer to or plural primer to particular combinations obtain the array amplified production, it can be used for detecting the enterovirus exist in a corpse or other object for laboratory examination and chemical testing. In the present invention preferably made up, the first primer comprised and is selected from the sequence that comprises following group
f1：
TTGTRCGCCTGTTTTA
(SEQ ID NO：1)，
f2：
CAAGCACTTCTGTHHCCCCGG
(SEQ?ID?NO：2)，
f3：
TACTTCGAGAARCCYAGTA
(SEQ?ID?NO：3)，
f5：
AAGAGYCTATTGAGCTA
(SEQ ID NO:4) reaches
f7：
GGI?TGG?TRS?TGG?AAR?TTI?CC
(SEQ?ID?NO：5)。
Second primer comprises and is selected from the sequence that comprises following group
R1：
CACYGGATGGCCAATCCAA
(SEQ?ID?NO：6)，
R2：
ATTGTCACCATAAGCAGCCA
(SEQ ID NO:7), and
R4：
AR?RTT?IAT?CCA?YTG?RTG?IGG
(SEQ?ID?NO：8)。
The sequence of primer of the present invention is relevant to the known enterovirus cDNA sequence in frame as shown in Figure 1.When designing these primers, correlated virus cDNA sequence is carried out the base correction also enlarge the different scope of the sequence of using these primers to detect with the efficient of promoting primer annealing.
The primer that comprises sequence SEQ ID NOs:5 of the present invention and 8 is relevant to the coding region of enterovirus genosome.The primer system that is relevant to the coding region of enterovirus genosome is intended to contain the primer that comprises the degeneracy sequence relevant with sequence SEQ ID NOs:5 and 8.Above-listed sequence SEQ IDNOs:5 and 8 is the codon of being correlated with according to these sequences and with suitable triplet (triplet) mode schematic representation.
In the present invention, combination more preferably comprises one or more pairs of following primers:
F1(SEQ?ID?NO：1)/r1(SEQ?ID?NO：6)；
f2(SEQ?ID?NO：2)/r1(SEQ?ID?NO：6)；
F3(SEQ?ID?NO：3)/r1(SEQ?ID?NO：6)；
f5(SEQ?ID?NO：4)/r1(SEQ?ID?NO：6)；
F1(SEQ?ID?NO：1)/r2(SEQ?ID?NO：7)；
f2(SEQ?ID?NO：2)/r2(SEQ?ID?NO：7)；
F3(SEQ?ID?NO：3)/r2(SEQ?ID?NO：7)；
F5 (SEQ ID NO:4)/r2 (SEQ ID NO:7); And
F7(SEQ?ID?NO：5)/r2(SEQ?ID?NO：7)。
The present invention preferred aspect, primer is specially adapted to detect in the amplification method side enterovirus 71 types (EV71) and coxsackie virus A 16-type (Cox A16) to f7 (SEQ ID NO:5)/r4 (SEQ ID NO:8).
According to Fig. 1, have the knack of this operator and can understand at least one pair of primer of the present invention of how selecting to be fit to desire in detection and/or the amplification enterovirus genosome fragment, and therefore the primer of the present invention of decision desire use is right easily.As shown in Figure 1, when first primer comprise sequence SEQ ID NO:5 or its degeneracy sequence then second primer should comprise sequence SEQ ID NO:8 or its degeneracy sequence.
In order to go the target nucleic acid sequence of amplification in a corpse or other object for laboratory examination and chemical testing via PCR, this sequence must contact (accessible) with element in the amplification system.Usually, this contact is via nucleic acid being separated in this corpse or other object for laboratory examination and chemical testing and adding their confirmation.The known different technology, particularly Yeast Nucleic Acid that in a biological corpse or other object for laboratory examination and chemical testing, extract nucleic acid in related art techniques.Perhaps, if this corpse or other object for laboratory examination and chemical testing system quite is easy to destroy, then nucleic acid does not need purifying before increasing via round pcr.Also even this corpse or other object for laboratory examination and chemical testing comprises cell (particularly peripheral blood lymphocyte or monocyte), in the cell dissolving of composition and disperse can via with cell suspension in hypotonicity solution and reach easily.
Each relevant nucleic acid double chain with primer prolongation effect gained of PCR round-robin the first step system is separated.After two strands was separated, next step was that the primer of the relevant nucleic acid chains that will separate and target sequence both sides is hybridized (promptly annealing) among the PCR.This primer is extended subsequently and forms the complementarity copy of target sequence.For the pcr amplification of success, consider that each primer designs this primer along the position that double-stranded sequence is hybridized, make separate from the extension products self-template of the synthetic gained of a primer after, as the template of the progradation of another primer.Sex change, hybridization, and the circulation of prolongation is heavily covered according to need repeatedly to obtain the deal that needs of amplification of nucleic acid.
In the preferred embodiment of PCR method, reaching that chain separates is that high temperature reaches the sufficient time via reactant being heated to fully, causes the sex change of two strands but can not cause the irreversible sex change of polysaccharase.In PCR primer to template dependency prolongation effect system (be dATP on the typical case via the polymerizability material at four kinds of an amount of deoxyribonucleoside triphosphates, dGTP, dCTP and dTTP) exist to descend in comprising suitable salt, carry out catalysis in the cultivation liquid of metal ion and pH buffering system and form.But suitable polymerizability material is the synthetic enzyme of known catalytic templating dependent DNA.In the present invention, the initial template typical case of primer prolongation effect goes up and is RNA.The ThermoScript II (RTs) that is suitable for from the synthetic cDNA of RNA template is known.
PCR is the most common to use thermophilic enzyme to carry out with automatic mode.In this method, the temperature of reaction mixture circulates via sex change scope, primer annealing scope and prolongation reaction range automatically.
As mentioned above, the present invention's preferred embodiment and contain the RT-PCR amplified reaction.Yet, have the knack of this operator cognition finished to the available any prior art method of the amplification of target sequence in a corpse or other object for laboratory examination and chemical testing, as ligase chain reaction (LCR), Q β-replicative enzyme amplification is in vitro transcribed, and holding property of son sequence replicating, more than the amplification of filling part all can be provided.
The existence that is enough to determine enterovirus on the big or small typical case who is amplified fragment (" amplified production ") that the inventive method is produced whether.Therefore, in some embodiments of the present invention, the existence that the size discrimination that is amplified fragment of institute's output (example gel electrophoretic analysis) can be used for decision enterovirus in a corpse or other object for laboratory examination and chemical testing in a corpse or other object for laboratory examination and chemical testing whether.This typical case goes up via the control group that will contain known nucleic acid to increase with the identical primer of target corpse or other object for laboratory examination and chemical testing employee that is used to increase.After according to prior art method the sequence that is amplified being indicated at electrophoresis on the sepharose and with ethidium bromide, the band kenel of a corpse or other object for laboratory examination and chemical testing and control group is compared.The extra band of corpse or other object for laboratory examination and chemical testing result and the XOR mutually that control group relatively occurs is pointed out the existence of enterovirus.
In order to determine pcr amplification result's exactness, can in an amplification method, use the primer more than a pair of.In the present invention's method, the primer that differs from one another is to using simultaneously or successively.Use simultaneously under the situation of a pair of above primer of the present invention in an amplification method, a pair of primer can be first primer or second primer with another to the different of primer, or first primer or second primer all have difference.In another kind of situation, if use continuously two pairs of primers of the present invention in an amplification method, second pair of primer can be used for the sequence of amplification, is equal to first pair of primer of use and guesses the sequence that can obtain or can obtain within the sequence scope at this in amplification method.According to Fig. 1, the implementer can be via decision use simultaneously or one of use are successively carried out the inventive method to above primer easily.
Perhaps, the present invention's amplified production can use the oligonucleotide probe to target nucleic acid tool specificity to detect.Probe is selected from the enterovirus genosome zone that the simple target sequence is had specificity usually.
The method of nucleic acid is desired in the reaction of sequence-specific probe hybridization by a kind of known very detailed detection in a corpse or other object for laboratory examination and chemical testing.Under the hybridization condition of fully strictness, probe only reacts with complementary in fact sequence generation specific hybrid.The severity of hybridization condition can be relaxed with tolerance sequence mispairing in various degree.The detection that is amplified product uses this sequence-specific hybridization to exist because of the similarity sequence from other biological or other polluted sequences so cause pseudo-male chance to determine to detect the correct target that is amplified, to reduce by this.
The present invention makes us finding uncannily that some nucleotide sequences are relevant to the conservative property zone of enterovirus nucleic acid.Therefore, the present invention and then these synthetic property nucleotide sequences are provided, it can carry out the specific hybrid reaction with the sense strand of enterovirus nucleic acid or the nucleic acid (as using the product of this sense strand as the amplified reaction of template) that is relevant to this sense strand.These synthetic property nucleotide sequences help in the test of enterovirus hybridization as probe.Preferably, these synthetic property nucleotide sequences are to be selected to comprise following group:
p1：
TCCTCCGGCCCCTGAATGCGGCTAATC
(SEQ?ID?NO：9)，
p2：
TGTCGTAACGSGCAASTCYGYRGCGGAACCGAC
(SEQ?ID?NO：10)，
p3：
TACTTTGGGTGTCCGTGTTTCHTTTTAT
(SEQ?ID?NO：11)，
71-2：
C?TTA?TAA?GCA?GAC?TCA?ACC?CGG?TGC?TGA?TG
(SEQ?ID?NO：12)，
71-3：
TGG?CAT?TCC?AAT?ATC?ACA?ATT?AAC?AGT?G
(SEQ?ID?NO：13)，
16-1：
CTC?GGC?ACT?ATC?GCA?GGA?GGG?ACC?GGG?AAT
(SEQ ID NO:14) reaches
16-2：
C?CTA?CGC?CAC?TAC?ACA?GCC?TGG?TCA?GGT?TG
(SEQ?ID?NO：15)。
The present invention's synthetic property nucleotide sequence is relevant to the known enterovirus cDNA sequence in the frame as shown in Figure 1.The nucleotide sequence that the present invention comprises sequence SEQ ID NOs:12-15 is relevant to the coding region of enterovirus genosome.The nucleotide sequence system that is relevant to the coding region of enterovirus genosome is intended to contain the nucleotide sequence that comprises the degeneracy sequence relevant with sequence SEQ ID NOs:12-15.The codon that above-listed sequence SEQ ID NOs:12-15 system is correlated with according to these sequences and with suitable triplet mode schematic representation.
According to Fig. 1, have the knack of this operator and can understand how to select at least one nucleotide sequence of the present invention, its in hybridization test of using primer of the present invention as probe, and the therefore probe of the present invention of decision desire use easily.As shown in Figure 1, when second primer that comprises sequence SEQ ID NO:8 or its degeneracy sequence was not used in amplification, then this nucleotide sequence should not comprise any sequence SEQ ID Nos:12-15 or its degeneracy sequence.And then when first primer that comprises sequence SEQID NO:5 or its degeneracy sequence was not used in amplification, then this nucleotide sequence should not comprise any sequence SEQ ID Nos:9-11 or its degeneracy sequence.
Known very detailed to some hybridization patterns in the related art techniques, these hybridization patterns include but not limited to the solution phase, solid phase, mixed phase or in situ hybridization reaction test.In solution (or liquid) phase hybridization, the free cross reaction that in reaction mixture, carries out between target nucleic acid and probe or the primer.In the test of solid phase hybridization, target or probe are connected on the solid support, can in solution, carry out and be in complementary nucleic acid.Exemplary solid facies model comprises the Southern hybridization, spotting method and similar approach.The detection of hybridization can be carried out on solid support, as the droplet plate, and filter membrane (as nitrocellulose) or microsphere (globule) or a wafer and any feasible hybridization Laemmli buffer system Laemmli.
The detection of hybridization mixture system is detected according to known very detailed technology, and this known detection critical part that is not the present invention.Can specificity and the available any typical case of mark (labeling) of the target nucleic acid probe of hybridizing on be used for detecting and undertaken by the method for the nucleic acid existence of hybridization.
The method of common detection system uses radioautograph, its use with
3H,
125I,
35S,
14C,
32P or analogue carry out the probe of mark.The selection of radioactive isotope is decided according to the preference of research, and this preference is decided on the easy degree of synthetic.The detection of hybridization can be carried out on solid support, as the droplet plate, and filter membrane (as nitrocellulose) or microsphere (globule) or a wafer and any feasible hybridization Laemmli buffer system Laemmli.
Other mark comprises part (ligand), its be with fluorophore (fluorophore), the anti-part (antiligand) or the antibodies of chemoluminescence agent or enzyme labelling.Perhaps, probe can directly and as fluorophore, the mark of chemoluminescence agent or enzyme be puted together combination.Required sensitivity is depended in the selection of mark mode, puts together the easiness that combines with probe, stability demand and available instrument and decide.
Probe of the present invention and primer can use traditional prior art method to synthesize and mark.Oligonucleotide as probe and primer can be according to Beaucage, S.L. reach Caruthers, M.H. (1981, Tetrahedron Letts., 22 (20): 1859-1862) at first the solid phase imido grpup phosphoric acid ester three ester methods of description use the automatization synthesizer to carry out chemosynthesis, and as Needham-VanDevanter, people such as D.R. are 1984, Nucleic Acid Res. is described in the 12:6159-6168.The purifying of oligonucleotide or can carry out via natural acrylamide gel electrophoretic method or via negatively charged ion-exchange resin HPLC, as Pearson, J.D. and Regnier, F.E. be 1983, J.Chrom., person described in the 255:137-149.
Above-mentioned primer and test system are used for detecting the enterovirus of a corpse or other object for laboratory examination and chemical testing, diagnosis enterovirus relative disease and symptom and determine specific symptoms or symptom combination and specific enterovirus existence between cognation (or cut off this kind related).The available medical history of application in the diagnosis and tried that individual feature is replenished and affirmation.Via the enterovirus disease of the inventive method diagnosis, syndrome and symptom comprise all and reported the disease relevant with enterovirus, syndrome and symptom in this paper and scientific literatures, comprise aseptic meningitis especially, enterovirus diabetes, enterovirus conjunctivitis, the numb low of acute limpness, acute benign pericarditis, dermexanthesis, interior fash, DCM (dilated cardiomyopathy) becomes, the stomatopod disease, chronic symptom tired out, pyreticosis and upper respiratory tract infection.Enterovirus infection and make development vaccine and methods of treatment become possibility with the detection of the cognation of syndrome.
The present invention also provides test kit, and it comprises the composition that is used to implement the inventive method for many container unit.Favourable test kit can comprise and is used for detecting the probe be intended to target nucleic acid.In some cases, this probe can be shown on suitable supporting film admittedly.This test kit will also can comprise primer provided by the present invention.Other selectivity compositions comprise in this test kit, for example, ThermoScript II or polysaccharase, the matrix ribonucleoside triphosphote, be used for the material (for example, when marker was vitamin H, it was former to contain avidin (avidin)-enzyme conjugate and enzyme substrates and color development) of mark and be used for reverse transcription, PCR, or the suitable buffer of hybridization.Except above-mentioned composition, this test kit also can comprise the indication of carrying out the inventive method.
The document of being quoted from the present invention's explanation is all incorporated this case in the mode of bibliography.
Other feature and advantage of the present invention can obviously see following preferred embodiment and claims.
The following example is used for exemplary illustration the present invention.These embodiment are intended to limit the present invention's scope never in any form, how to implement material of the present invention and method but be used for indication.
Embodiment 1: the detection of enterovirus
1.1. virus
Employed 59 enterovirus samples (seeing Table 1) or in the corpse or other object for laboratory examination and chemical testing of clinical collection, separate or derive from American type culture collection (ATCC).Enterovirus uses the immune serum that converges to be identified that now is confirmed its serotype with monotype neutrality polyclonal antibody via neutralization test.Shown in the result, 59 samples comprise different enterovirus serotype (seeing Table 1).Virus is bred in MRC5 monolayer cell culture.
1.2. extract RNA
The centrifugal sediment that viral RNA system infects the monolayer cell culture via total nucleic acid is hung oneself separates and gets.About 4-6 * 10
6Individual cell (every milliliter) is in dissolving damping fluid (50mMNaCl, 20mM Tris HCl (pH 7.5), 50 mM EDTA, 1% sodium lauryl sulphate) middle dissolving, in containing the ammonium acetate of ethanol, 2.5M precipitates with phenol-chloroform extraction three times and once, and subsequently with chloroform extraction.The nucleic acid centrifugal sediment is cleaned with 75% ethanol, and it is dry and be suspended in the sterile distilled water of 100 microlitres to carry out the universe.The RNA prepared product is stored in-80 ℃.
1.3.PCR amplification test
The first step of amplification test is DNA copy (cDNA) (being reverse transcription step) of the synthetic enterovirus rna gene body branch that will be amplified.The reverse transcription of carrying out via polymerase chain reaction is in reaction mixture (total RNA of 1 μ l, 20 mM Tris-HCl (pH8.4), 50mM KCl, the 5mM MgCl of 20 μ l
2, 10mM DTT respectively is the dATP of 0.5mM, dCTP, dGTP and dTTP, and the random hexa-atomic body of 50 nanograms) in carry out.With a corpse or other object for laboratory examination and chemical testing cultivate in 65 ℃ 5 minutes, with being placed on 1 minute on ice.The ThermoScript II that adds 50 units is also cultivated this mixture 50 minutes in 42 ℃.This reaction is by stopping 70 ℃ of cultivations 15 minutes.The cDNA product of gained is stored in-20 ℃.
DNA cloning via PCR acts on 25 μ l reaction mixtures [cDNA of 12 μ l, 20mM Tris-HCl (pH8.0), 0.1mM EDTA, 1mM DTT, 1.0%triton X-100,50% glycerine, 1.5mM MgCl
2, the dATP of each 150 μ M, dCTP, dGTP and dTTP, the Taq archaeal dna polymerase of concrete primer of each of each 10pmol and 2.5 U] in carry out.Employed primer is to for comprising the primer of following sequence in amplified reaction:
f1(SEQ?ID?NO：1)/r1(SEQ?ID?NO：6)，
f2(SEQ?ID?NO：2)/r1(SEQ?ID?NO：6)，
f3(SEQ?ID?NO：3)/r1(SEQ?ID?NO：6)；
f5(SEQ?ID?NO：4)/r1(SEQ?ID?NO：6)，
f1(SEQ?ID?NO：1)/r2(SEQ?ID?NO：7)，
f2(SEQ?ID?NO：2)/r2(SEQ?ID?NO：7)，
F3 (SEQ ID NO:3)/r2 (SEQ ID NO:7) reaches
f5(SEQ?ID?NO：4)/r2(SEQ?ID?NO：7)。
Primer r1 and r2 use for the subsequent detection step at 5 ' end mark with vitamin H.Each amplified reaction carries out 40 temperature cycle (in 94 ℃ of sex change 4 minutes, carry out primer to annealing 1 minute in 55 ℃, and prolong 1 minute in 72 ℃).
1.4.DNA the separation of product
A small amount of (each 10 μ l) carried out electrophoresis 30 minutes in 1.5% sepharose in 0.5 * tbe buffer liquid in (0.045M Tris-borate, 0.001M EDTA) under 100 volts with the PCR product.Behind the electrophoresis, gel is dyed with ethidium bromide and in the observation down of UV light source.All Virus Samples use amplified reaction observation under the UV light source of primer of the present invention all to show positive findings.Use primer that f5/r1 is shown in table 1 at the pcr amplification data that 59 Virus Samples carry out.Table 1
| Serotype | Sample number | The sample number that shows positive PCR result |
| ??EV?71 | ????17 | ????17 |
| ??CA?7 | ????2 | ????2 |
| ??CA?9 | ????1 | ????1 |
| ??CA?10 | ????1 | ????1 |
| ??CA?11 | ????1 | ????1 |
| ??CA?16 | ????14 | ????14 |
| ??CA?24 | ????1 | ????1 |
| ??CB?1 | ????1 | ????1 |
| ??CB?2 | ????1 | ????1 |
| ??CB?3 | ????1 | ????1 |
| ??CB?4 | ????1 | ????1 |
| ??CB?5 | ????5 | ????5 |
| ??CB?6 | ????1 | ????1 |
| ??Echo1 | ????1 | ????1 |
| ??Echo2 | ????1 | ????1 |
| ??Echo3 | ????1 | ????1 |
| ??Echo4 | ????1 | ????1 |
| ??Echo5 | ????1 | ????1 |
| ??Echo6 | ????1 | ????1 |
| ??Echo7 | ????3 | ????3 |
| ??Echo9 | ????1 | ????1 |
| ??Echo11 | ????1 | ????1 |
| ??Echo14 | ????1 | ????1 |
| Amount to | ????59 | ????59 |
With the combination of different primers, utilize the electrophoretic analysis of PCR amplification enterovirus 71 type nucleic acid to be illustrated in Fig. 2.The primer of capable each use of a to h is to being: a:f1/r1, b:f2/r1, c:f3/r1, d:f5/r1, e:f1/r2, f:f2/r2, g:f3/r1, h:f5/r2.M is the big tick marks of nucleic acid, and 1 to 5 is respectively: 1: 600bp, 2: 500bp, 3: 400bp, 4: 300bp, 5: 200bp.
The above results proof primer of the present invention can be widely used in the nucleic acid that detects enterovirus and whether exist, and the existence of diagnosing enterovirus by this whether.
1.5. hybridization analysis
Three enterovirus specific probes (p1, p2 and p3) are used for the dna fragmentation of detection through amplification, and it comprises sequence SEQ ID NO:9, SEQ ID NO:10 and SEQ IDNO:11 respectively.
Probe is heated with sex change (95 ℃, 5 minutes) and fast in quenching on ice 2 minutes, and now is solid outstanding on nylon membrane (from BoehringerManngeim) with these probes (each 10 μ M).Three probes (each 1 μ l) are applied and are exposed to ultraviolet radiation (254nm, 0.15J/cm
2) under.
The PCR product (each 8 μ l) of biotin labeling was carried out sex change in 5 minutes and in quenching on ice 2 minutes 95 ℃ of heating; and adding hybridization solution [5x standard Citrate trianion (SSC); 0.1% (w/v) N-lauroyl tetradecanoic acid; 0.1% (w/v) sodium lauryl sulphate (SDS); 1x sealing damping fluid is (from Boehringer Manngeim, 20ml/100cm
2)] in.The hybridization solution that contains the PCR product is cultivated jointly with nylon membrane and through the probe of mark subsequently.After 1 hour, use cleaning buffer solution (2 * SSC and 0.1%SDS) to clean five times in room temperature these films in 50 ℃ of cultivations, add streptavidin alkaline phosphatase (2 μ l/20ml 1 * sealing damping fluid) subsequently.Film placed room temperature following 30 minutes and (0.1M maleic acid, 0.15M NaCl pH7.5) clean five times with the maleic acid damping fluid under room temperature.With film in detecting damping fluid (0.1M Tris-HCl; 0.1M NaCl; 50mM MgCl
2, pH9.5) in balance 5 minutes and with the color-matrix solution (45 μ l NBT solution mix 35 μ l X-phosphoric acid solutions) of prepared fresh, and be added to 10 milliliters with the detection damping fluid) cultivated in the dark 10 minutes.At last film is dried with termination reaction and under room temperature with 1 * TE buffer solution for cleaning.The hybridization signal is detected and record.The results are shown in table 2.Table 2
| Serotype | Be subjected to the number of sample basis | The number that is subjected to the sample basis that shows the hybridization signal that can not detect | ||
| ????P1 | ????P2 | ????P3 | ||
| ??CA?16 | ????6 | ????6 | ????6 | ????6 |
| ??CA?21 | ????1 | ????1 | ????1 | ????1 |
| ??CA?24 | ????1 | ????1 | ????1 | ????1 |
| ??CB?1 | ????1 | ????1 | ????1 | ????1 |
| ??CB?2 | ????2 | ????2 | ????2 | ????2 |
| ??CB?3 | ????1 | ????1 | ????1 | ????1 |
| ??CB?4 | ????1 | ????1 | ????1 | ????1 |
| ??CB?5 | ????1 | ????1 | ????1 | ????1 |
| ??CB?6 | ????1 | ????1 | ????1 | ????1 |
| ??Echo?3 | ????3 | ????3 | ????3 | ????3 |
| ??Echo?5 | ????1 | ????1 | ????1 | ????1 |
| ??Echo?6 | ????1 | ????1 | ????1 | ????1 |
| ??Echo?9 | ????2 | ????2 | ????2 | ????2 |
| ??Echo?11 | ????3 | ????3 | ????3 | ????3 |
| ??Echo?14 | ????1 | ????1 | ????1 | ????1 |
| ??Echo?21 | ????3 | ????3 | ????3 | ????3 |
| ??Echo?24 | ????1 | ????1 | ????1 | ????1 |
| ??Echo?30 | ????2 | ????2 | ????2 | ????2 |
| ??Echo?31 | ????2 | ????2 | ????2 | ????2 |
| ??EV?71 | ????7 | ????7 | ????7 | ????7 |
| ??Polio?1 | ????2 | ????2 | ????2 | ????2 |
| ??Polio?2 | ????2 | ????2 | ????2 | ????2 |
| ??Polio?3 | ????2 | ????2 | ????2 | ????2 |
(p3) hybridization the results are shown in Fig. 3 to the nucleic acid of enterovirus 71 types and coxsackie virus A 16-type for p1, p2 with enterovirus cenotype probe after PCR amplification.The primer of polymerase chain reaction use is paired into f5/r1, the branch position that is fixed on the nylon membrane probe is as follows: topmost row and bottom are classified the hybridization control group as, the probe that uses is pig miscarriage and breathing syndrome virus (Dorcine reproductive and respiratory syndrome virus, PRRSV) one of ORF 7 section nucleotide sequence, owing to contain the nucleotide sequence of probe complementation therewith in the hybridization solution, so when hybridization was finished smoothly, these two row had signal and produce.The left side first row's the 2nd to 4 point: probe p1, middle row's the 2nd to 4 point: probe p2, the right first row's the 2nd to 4 point: probe p3.1 and 2: enterovirus 71 types and coxsackie virus A 16-type all have signal in hybridization control point and enterovirus cenotype probe location.3:, only signal is arranged in hybridization contrast probe for not containing the control group of nucleic acid.
Embodiment 2: detect and differentiate enterovirus 71 types (EV71) and coxsackie virus A 16-type (CoxA16)
2.1.PCR amplification test
RNA extracts and reverse transcription step carries out under the same terms described in the example 1.Employed in this test PCR primer is right for the primer that comprises sequence f7 (SEQ ID NO:5)/r4 (SEQ IDNO:8).
Adjusted described in PCR reaction mixture and temperature cycle condition such as the example 1.
2.2. hybridization test
Be used to detect the probe of EV71 for containing the probe of sequence SEQ ID NO:12 (71-2) and SEQ IDNO:13 (71-3).Be used to detect the probe of Cox A16 for containing the probe of sequence SEQ IDNO:14 (16-1) and SEQ ID NO:15 (16-2).Hybridization test condition described in example 1 is carried out.
The result shows that the use primer can specific detection and discriminating EV71 and non--EV71 enterovirus to the inventive method of f7/r4 and probe 71-2 and 71-3.The result shows that the use primer can specific detection and discriminating Cox A16 and non--Cox A16 enterovirus to the inventive method of f7/r4 and probe 16-1 and 16-2.
Embodiment 3: detect and differentiate EV71, Cox A16, the test kit of non--EV71 enterovirus and non--CoxA16 enterovirus
Use the present invention's test kit simultaneously EV71 and Cox A16 to be detected.This test kit provides material and step procedure to make the implementer can carry out the multiplex PCR test.Viral RNA extracts and reverse transcription step carries out under the same terms described in the embodiment 1.(per unit contains the cDNA of 12 μ l to multiplex PCR, 50mM Tris-HCl (pH8.3), 70mM KCl, 2.5mM MgCl in 25 μ l reaction mixtures
2, respectively be the dATP of 200 μ M, dCTP, dGTP and dTTP, the primer f5/r1 of 10pmol, the primer f7/r4 of 20pmol and the Taq archaeal dna polymerase of 3U) in carry out.Each amplified reaction carries out 40 temperature cycle (in 94 ℃ of sex change 4 minutes, carry out primer to annealing 1 minute in 55 ℃, and prolong 1 minute in 72 ℃).After the amplification of this multiplex PCR, the common cultivation of the PCR product of gained and the film of outstanding probe admittedly (p1, p2 and p3 are at enterovirus, and 71-2 and 71-3 are single-minded at EV71, and 16-1 and 16-2 are single-minded at Cox A16).The all conditions of hybridization test is all identical with person described in the example 1.The result shows that this test kit (system that comprises multiplex PCR and multiple crossing reaction detection is provided) can detect and differentiate EV71, Cox A16, non--EV71 enterovirus and non--Cox A16 enterovirus.Use the hybridization testing data of different probe of the present invention to be shown in table 3.Table 3
| The serotype of enterovirus | Be subjected to the number of sample basis | The number that is subjected to the sample basis of the hybridization signal that demonstration can detect | ||||||
| Probe of the present invention | ||||||||
| ???p1 | ???p2 | ???p3 | ??71-2 | ??71-3 | ??16-1 | ??16-2 | ||
| ?CA?16 | ????6 | ????6 | ????6 | ????6 | ????0 | ????0 | ????6 | ????6 |
| ?CA?21 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?CA?24 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?CB?1 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?CB?2 | ????2 | ????2 | ????2 | ????2 | ????0 | ????0 | ????0 | ????0 |
| ?CB?3 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?CB?4 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?CB?5 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?CB?6 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?Echo?3 | ????3 | ????3 | ????3 | ????3 | ????0 | ????0 | ????0 | ????0 |
| ?Echo?5 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?Echo?6 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?Echo?9 | ????2 | ????2 | ????2 | ????2 | ????0 | ????0 | ????0 | ????0 |
| ?Echo?11 | ????3 | ????3 | ????3 | ????3 | ????0 | ????0 | ????0 | ????0 |
| ?Echo?14 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?Echo?21 | ????3 | ????3 | ????3 | ????3 | ????0 | ????0 | ????0 | ????0 |
| ?Echo?24 | ????1 | ????1 | ????1 | ????1 | ????0 | ????0 | ????0 | ????0 |
| ?Echo?30 | ????2 | ????2 | ????2 | ????2 | ????0 | ????0 | ????0 | ????0 |
| ?Echo?31 | ????2 | ????2 | ????2 | ????2 | ????0 | ????0 | ????0 | ????0 |
| ?EV?71 | ????7 | ????7 | ????7 | ????7 | ????7 | ????7 | ????0 | ????0 |
| ?Polio?1 | ????2 | ????2 | ????2 | ????2 | ????0 | ????0 | ????0 | ????0 |
| ?Polio?2 | ????2 | ????2 | ????2 | ????2 | ????0 | ????0 | ????0 | ????0 |
| ?Polio?3 | ????2 | ????2 | ????2 | ????2 | ????0 | ????0 | ????0 | ????0 |
The difference that can do according to the present invention is revised and is changed and all obviously can not depart from scope of the present invention and spirit for haveing the knack of this operator.Though the present invention has narrated specific preference embodiment, it must be appreciated that the present invention should be limited on these particular undeservedly.In fact, implementing aspect the present invention's the pattern of stating, for haveing the knack of this operator, showing and the difference correction easily known also is included within the following claim.
Claims (26)
1. one to be used for detecting the Oligonucleolide primers whether enterovirus exist at a corpse or other object for laboratory examination and chemical testing right, and wherein this comprises following arbitrary sequence to first primer in the primer:
SEQ?ID?NO：1：TTGTRCGCCTGTTTTA，
SEQ?ID?NO：2：CAAGCACTTCTGTHHCCCCGG，
SEQ?ID?NO：3：TACTTCGAGAARCCYAGTA，
SEQ ID NO:4:AAGAGYCTATTGAGCTA, or
SEQ ID NO:5:GGITGGTRSTGGAARTTICC, or the degeneracy sequence of SEQ ID No:5; And
This comprises following arbitrary sequence to second primer in the primer:
SEQ?ID?NO：6：CACYGGATGGCCAATCCAA，
SEQ ID NO:7:ATTGTCACCATAAGCAGCCA, or
SEQ ID NO:8:ARRTTIATCCAYTGRTGIGG, or the degeneracy sequence of SEQ ID No:8,
Its condition is, when first primer comprises sequence SEQ ID NO:5 or its degeneracy sequence, then second primer comprises sequence SEQ ID NO:8 or its degeneracy sequence.
2. right according to the primer of claim 1, it comprises and is selected from the sequence that comprises following group: SEQ ID NO:1/SEQ ID NO:6; SEQ ID NO:2/SEQ ID NO:6; SEQ IDNO:3/SEQ ID NO:6; SEQ ID NO:4/SEQ ID NO:6; SEQ ID NO:1/SEQ IDNO:7; SEQ ID NO:2/SEQ ID NO:7; SEQ ID NO:3/SEQ ID NO:7; SEQ IDNO:4/SEQ ID NO:7; And SEQ ID NO:5/SEQ ID NO:8.
3. right according to the primer of claim 1, it is SEQ ID NO:5/SEQ ID NO:8.
4. right according to the primer of claim 3, it is used to detect enterovirus 71 types (EV71) or coxsackie virus A 16 (Cox A16).
5. one synthesizes the property nucleotide sequence, and it comprises arbitrary sequence that is selected from following group:
SEQ?ID?NO：9：TCCTCCGGCCCCTGAATGCGGCTAATC，
SEQ?ID?NO：10：TGTCGTAACGSGCAASTCYGYRGCGGAACCGAC，
SEQ?ID?NO：11：TACTTTGGGTGTCCGTGTTTCHTTTTAT，
SEQ?ID?NO：12：CTTATAAGCAGACTCAACCCGGTGCTGATG，
SEQ?ID?NO：13：TGGCATTCCAATATCACAATTAACAGTG，
SEQ ID NO:14:CTCGGCACTATCGCAGGAGGGACCGGGAAT reaches
SEQ ID NO:15:CCTACGCCACTACACAGCCTGGTCAGGTTG, and arbitrary degeneracy sequence among the SEQ ID NO:12-15,
It can carry out specific hybrid with the sense strand of enterovirus nucleic acid or the nucleic acid that is relevant to this sense strand.
6. one kind is detected the method whether enterovirus nucleic acid exists in a corpse or other object for laboratory examination and chemical testing, and it comprises the following step:
(a) in an amplification method with this corpse or other object for laboratory examination and chemical testing with according to the Oligonucleolide primers of claim 1 to contacting; And
(b) via the existence that detects amplified production whether and the existence of decision enterovirus whether.
7. according to the method for claim 6, wherein at step (a), this corpse or other object for laboratory examination and chemical testing contacts with second pair of Oligonucleolide primers according to claim 1 in an amplification method simultaneously, and this second pair of primer is different from first pair of primer.
8. according to the method for claim 7, wherein first primer in second pair of primer is different from first primer in first pair of primer.
9. according to the method for claim 7, wherein second primer in second pair of primer is different from second primer in first pair of primer.
10. according to the method for claim 7, wherein two primers in the second pair of primer are different from two primers in first pair of primer.
11. according to the method for claim 7, wherein at step (a), this corpse or other object for laboratory examination and chemical testing contacts with the 3rd pair of Oligonucleolide primers according to claim 1 in an amplification method simultaneously, and the 3rd pair of primer is different from first pair and second pair of primer.
12. method according to claim 6, itself and then the product that comprises step (a) contact with second pair of Oligonucleolide primers according to claim 1 in an amplification method simultaneously, wherein the second pair of primer can be used for the sequence of amplification, is equal to use sequence that first pair of primer can obtain or can obtain within the sequence scope at this in amplification method.
13. according to the method for claim 6, wherein the amplified production that is detected is further carried out the specific hybrid reaction with at least one synthetic property nucleotide sequence according to claim 5,
Its condition is that when second primer that comprises sequence SEQ ID NO:8 or its degeneracy sequence was not used in amplification, then this nucleotide sequence should not comprise any sequence SEQ ID NO:12-15 or its degeneracy sequence; When first primer that comprises sequence SEQ ID NO:5 or its degeneracy sequence was not used in amplification, then this nucleotide sequence should not comprise any sequence SEQ IDNO:9-11 or its degeneracy sequence.
14. according to the method for claim 13, wherein hybridization lies under the height stringent condition and carries out.
15. a method that detects and differentiate enterovirus 71 types in the corpse or other object for laboratory examination and chemical testing, it comprises:
(a) in an amplification method with this corpse or other object for laboratory examination and chemical testing with according to the Oligonucleolide primers of claim 1 to contacting, condition is that second primer system comprises sequence SEQ ID NO:8 or its degeneracy sequence;
(b) via the existence that detects amplified production whether and the existence of decision enterovirus 71 types whether; And
(c) the synthetic property nucleotide sequence that detected amplified production and at least one is comprised sequence SEQ ID NO:12 or SEQ ID NO:13 carries out the specific hybrid reaction.
16. according to the method for claim 15, wherein, in step (c), amplified production system carries out the specific hybrid reaction with the synthetic property nucleotide sequence that comprises sequence SEQ ID NO:12 and SEQ ID NO:13 respectively.
17. a method that detects and differentiate coxsackie virus A 16-type in the corpse or other object for laboratory examination and chemical testing, it comprises:
(a) in an amplification method with this corpse or other object for laboratory examination and chemical testing with according to the Oligonucleolide primers of claim 1 to contacting, condition is that second primer system comprises sequence SEQ ID NO:8 or its degeneracy sequence;
(b) via the existence that detects amplified production whether and the existence of decision coxsackie virus A 16-type whether; And
(c) the synthetic property nucleotide sequence that detected amplified production and at least one is comprised sequence SEQ ID NO:14 or SEQ ID NO:15 carries out the specific hybrid reaction.
18. according to the method for claim 17, wherein, in step (c), amplified production system carries out the specific hybrid reaction with the synthetic property nucleotide sequence that comprises sequence SEQ ID NO:14 and SEQ ID NO:15 respectively.
19. a method that detects and differentiate enterovirus 71 types in the corpse or other object for laboratory examination and chemical testing and/or coxsackie virus A 16-type, it comprises:
(a) in an amplification method with this corpse or other object for laboratory examination and chemical testing with according to the Oligonucleolide primers of claim 1 to contacting, condition is that second primer system comprises sequence SEQ ID NO:8 or its degeneracy sequence;
(b) via the existence that detects amplified production whether and the existence of decision enterovirus 71 types and/or coxsackie virus A 16-type whether; And
(c) detected amplified production and at least one are comprised the synthetic property nucleotide sequence of sequence SEQ ID NO:12 or SEQ ID NO:13 and synthetic property nucleotide sequence that at least one comprises sequence SEQ IDNO:14 or SEQ ID NO:15 and carry out the specific hybrid reaction.
20. according to the method for claim 19, wherein, in step (c), amplified production is and comprises sequence SEQ ID NO:12 respectively, SEQ ID NO:13, and the synthetic property nucleotide sequence of SEQ ID NO:14 and SEQID NO:15 carries out the specific hybrid reaction.
21. test kit that in a corpse or other object for laboratory examination and chemical testing, detects enterovirus, it comprises at least one pair of Oligonucleolide primers according to claim 1, its condition is that when first primer comprised sequence SEQ IDNO:5 or its degeneracy sequence, then second primer comprised sequence SEQ ID NO:8 or its degeneracy sequence.
22. according to the test kit of claim 21, it comprises more than a pair of Oligonucleolide primers according to claim 1.
23. according to the test kit of claim 21, it comprises at least one synthetic property nucleotide sequence according to claim 5,
Its condition is that when second primer that comprises sequence SEQ ID NO:8 or its degeneracy sequence was not used in amplification, then this nucleotide sequence should not comprise any sequence SEQ ID NO:12-15 or its degeneracy sequence; When first primer that comprises sequence SEQ ID NO:5 or its degeneracy sequence was not used in amplification, then this nucleotide sequence should not comprise any sequence SEQ IDNO:9-11 or its degeneracy sequence.
24. a test kit that detects and differentiate enterovirus 71 types in the corpse or other object for laboratory examination and chemical testing, it comprises:
At least one pair of is according to the Oligonucleolide primers of claim 1, and condition is that second primer system comprises sequence SEQ ID NO:8 or its degeneracy sequence; And
At least one comprises the synthetic property nucleotide sequence of sequence SEQ ID NO:12 or SEQ ID NO:13.
25. a test kit that detects and differentiate coxsackie virus A 16-type in the corpse or other object for laboratory examination and chemical testing, it comprises:
At least one pair of is according to the Oligonucleolide primers of claim 1, and condition is that second primer system comprises sequence SEQ ID NO:8 or its degeneracy sequence; And
At least one comprises the synthetic property nucleotide sequence of sequence SEQ ID NO:14 or SEQ ID NO:15.
26. a method that detects and differentiate enterovirus 71 types in the corpse or other object for laboratory examination and chemical testing and/or coxsackie virus A 16-type, it comprises:
At least one pair of is according to the Oligonucleolide primers of claim 1, and condition is that second primer system comprises sequence SEQ ID NO:8 or its degeneracy sequence;
At least one comprises the synthetic property nucleotide sequence of sequence SEQ ID NO:12 or SEQ ID NO:13 and the synthetic property nucleotide sequence that at least one comprises sequence SEQ ID NO:14 or SEQ ID NO:15.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB011006226A CN1151271C (en) | 2001-01-15 | 2001-01-15 | Process, primer and probe for detecting and discriminating enterovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB011006226A CN1151271C (en) | 2001-01-15 | 2001-01-15 | Process, primer and probe for detecting and discriminating enterovirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1366066A true CN1366066A (en) | 2002-08-28 |
| CN1151271C CN1151271C (en) | 2004-05-26 |
Family
ID=4651733
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB011006226A Expired - Fee Related CN1151271C (en) | 2001-01-15 | 2001-01-15 | Process, primer and probe for detecting and discriminating enterovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1151271C (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101713003A (en) * | 2010-02-02 | 2010-05-26 | 北京爱普益生物科技有限公司 | Kit for detecting coxsackie virus A16-type nucleic acid and detection method thereof |
| CN102230026A (en) * | 2011-06-10 | 2011-11-02 | 天津朝海科技有限公司 | Human enterovirus 71 detection kit |
| CN101812538B (en) * | 2009-11-13 | 2012-01-04 | 镇江市疾病预防控制中心 | Enterovirus 71-detecting fluorescent quantitative RT-PCR kit |
| CN102312017A (en) * | 2010-07-07 | 2012-01-11 | 上海出入境检验检疫局动植物与食品检验检疫技术中心 | Real-time reverse transcription-polymerase chain reaction (RT-PCR) detection method and kit for Coxsackie virus |
| CN101812535B (en) * | 2009-02-24 | 2012-08-22 | 江苏默乐生物科技有限公司 | Specific primer and probe for detecting enterovirus EV71 |
| CN102776187A (en) * | 2012-06-08 | 2012-11-14 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Structure and application of anti-EV71 (enterovirus 71) oligonucleotides |
| CN102816869A (en) * | 2012-08-31 | 2012-12-12 | 何雅青 | Primer, probe and kit for coxsackievirus A4 nucleic acid detection |
| CN101598733B (en) * | 2009-04-16 | 2013-01-23 | 北京科兴生物制品有限公司 | EV71 virus neutralization epitope detection kit or reagent and preparation method thereof |
| WO2023077484A1 (en) * | 2021-11-06 | 2023-05-11 | 江汉大学 | Mnp marker combination of five human enteroviruses, primer pair combination, kit and uses thereof |
-
2001
- 2001-01-15 CN CNB011006226A patent/CN1151271C/en not_active Expired - Fee Related
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101812535B (en) * | 2009-02-24 | 2012-08-22 | 江苏默乐生物科技有限公司 | Specific primer and probe for detecting enterovirus EV71 |
| CN101598733B (en) * | 2009-04-16 | 2013-01-23 | 北京科兴生物制品有限公司 | EV71 virus neutralization epitope detection kit or reagent and preparation method thereof |
| CN101812538B (en) * | 2009-11-13 | 2012-01-04 | 镇江市疾病预防控制中心 | Enterovirus 71-detecting fluorescent quantitative RT-PCR kit |
| CN101713003A (en) * | 2010-02-02 | 2010-05-26 | 北京爱普益生物科技有限公司 | Kit for detecting coxsackie virus A16-type nucleic acid and detection method thereof |
| CN101713003B (en) * | 2010-02-02 | 2012-10-17 | 北京爱普益生物科技有限公司 | Kit for detecting coxsackie virus A16-type nucleic acid and detection method thereof |
| CN102312017A (en) * | 2010-07-07 | 2012-01-11 | 上海出入境检验检疫局动植物与食品检验检疫技术中心 | Real-time reverse transcription-polymerase chain reaction (RT-PCR) detection method and kit for Coxsackie virus |
| CN102230026A (en) * | 2011-06-10 | 2011-11-02 | 天津朝海科技有限公司 | Human enterovirus 71 detection kit |
| CN102776187A (en) * | 2012-06-08 | 2012-11-14 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Structure and application of anti-EV71 (enterovirus 71) oligonucleotides |
| CN102816869A (en) * | 2012-08-31 | 2012-12-12 | 何雅青 | Primer, probe and kit for coxsackievirus A4 nucleic acid detection |
| WO2023077484A1 (en) * | 2021-11-06 | 2023-05-11 | 江汉大学 | Mnp marker combination of five human enteroviruses, primer pair combination, kit and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1151271C (en) | 2004-05-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0465603B1 (en) | Methods of detecting picornaviruses in biological fluids and tissues | |
| Kalinina et al. | Shift in predominating subtype of HCV from 1b to 3a in St. Petersburg mediated by increase in injecting drug use | |
| Koutna et al. | Identification of spring viraemia of carp virus (SVCV) by combined RT-PCR and nested PCR | |
| Petitjean et al. | Detection of enteroviruses in endomyocardial biopsy by molecular approach | |
| CN1350593A (en) | Genotyping kit for diagnosis of human papillomavirus infection | |
| CN1151271C (en) | Process, primer and probe for detecting and discriminating enterovirus | |
| Lovmar et al. | Microarrays for genotyping human group a rotavirus by multiplex capture and type-specific primer extension | |
| CN105734170A (en) | Diagnosis of viral infections by detection of genomic and infectious viral dna by molecular combing | |
| Sanchez-Fauquier et al. | First detection of group C rotavirus in children with acute diarrhea in Spain | |
| CN1164767C (en) | Fluorescent quantitative PCR kit for rapid and quantitative detecting hog choleravirus and hog cholera lapinized vaccine and its use | |
| Saharan et al. | Rapid detection of viruses using loop-mediated isothermal amplification (LAMP): A review | |
| Laassri et al. | Genomic analysis of vaccine-derived poliovirus strains in stool specimens by combination of full-length PCR and oligonucleotide microarray hybridization | |
| CN106498093A (en) | A kind of method that wide spectrum detects carcinogenic pathogenic microorganism | |
| CN1814785A (en) | Method for detecting Brucellosis and primer thereof | |
| CN115011734A (en) | Kit for detecting various respiratory viruses | |
| CN1814799A (en) | Herpes-like virus gene chip and its use | |
| CN111500774B (en) | Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit | |
| CN1940089A (en) | Method for fast inspecting HBV, HCV, HIV, TP and RV simultaneouslly | |
| DE60123781T2 (en) | METHOD FOR DETECTING MINORITY GENOMES IN VIRAL QUASI SPECIES USING DNA MICROCHIPS | |
| US6818397B1 (en) | Methods for detecting and differentiating enteroviruses and the primers and probes therefor | |
| CN114703179A (en) | RT-RAA-LFD primer pair, probe, test strip, kit for detecting PDCoV and application thereof | |
| US20030180323A1 (en) | Diagnosis, prevention and treatment of calicivirus infection in humans | |
| CN1105185C (en) | Process for preparing protein antigen for genetic expression of gene A related to pylorospirobacillus cytotoxin | |
| CN2858654Y (en) | Herpes-like virus gene chip | |
| CN1679931A (en) | Canine distemper virus separated in korea and recombined vaccine therefrom |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20040526 Termination date: 20150115 |
|
| EXPY | Termination of patent right or utility model |