CN1349743A - Green additive for promoting animal's growth and its production process - Google Patents

Abstract

The present invention discloses a green additive capable of promoting animal growth and its production method. The active protein in said additive is formed by gene expression of artificially synthetic growth hormone, and is summation of three-dimensional structure formed in root, stem, leaf and seed of raw material crop. Said invnetion inserts the PGH modifying gene into plasmid vector, transfers the recombinant plasmid into plant to make expression and sows the different transgenic seeds into soil to obtain crop as feed additive, then uses the feed additive containig the recombinant active protein to feed livestock to effectively solve the problems of drug resistance and drug residue produced by conventional growth-promoting additive. Said invention is simple in productino process, is convenient for operation, can be extensively used for promoting growth of various animals.

Description

A kind of green additive and production method thereof that promotes growth of animal

Technical field the present invention relates to a kind of green additive and production method thereof that promotes growth of animal, more particularly, relates to crop and production methods thereof such as a kind of corn that contains the somatotropin (PGH) of pig, paddy rice, wheat, soybean, ground oil seeds.

Background technology do to be expressed carrier with plant and is expressed the existing many reports of foreign protein in the prior art, does not appear in the newspapers as yet but the PGH gene expressed on plant corpus.In the present promoting animal growth additive technology, the growth-promoting additive that chemosynthesis is arranged as beta-2-agonists (being commonly called as " clenbuterol ") and somatotropin, but is a synthetic because of it, have obstinate heat endurance, it is residual to form cumulative bad in animal tissue after the use.Because this compounds has Orally active, illegal use meeting brings some harmful effects (as dizzy, symptoms such as vomitings) to the consumer, just is being subjected to " closing down " of country at present.Because this compounds has Orally active, illegal use meeting brings some harmful effects (as dizzy, symptoms such as vomitings) to the consumer, just is being subjected to " closing down " of country at present.In addition, also have some antibiotic type growth-promoting additives on the market, they reach somatotrophic purpose by the noxious bacteria that suppresses in the enteron aisle, because they belong to antibiotic, must face the problem of drug resistance and medicament residue.

Express somatotropin with plant efficient, both avoided somatotropin must inject the inconvenience that is caused; Can be used as a kind of environmental protection growth-promoting additive again, not only satisfied the demand in current market, have no side effect, noresidue, can reduce the waste of food conversion simultaneously again, significantly improve the availability of feed for fat.

Generally speaking, somatotropin (PGEF), have the absorption of enhancing to nutriment, as sugar, amino acid and electrolyte, improve the enteron aisle digestive function, thereby promote the growth of animal, reduce secretion of insulin, promote albumen and sugared generation, reduce fat deposition, promote lipolyse, thereby improve the lean meat ratio of livestock and poultry, improve the conversion ratio of feed.And somatotropin similar to the emulsification factor structure (with the milk protein gene autoploidy of placenta be 85%), also can play the effect identical with the emulsification factor--improve the generation of breast milk.

Summary of the invention the object of the present invention is to provide that a kind of production technology is simple, the recombinant protein biologically active in the crop, can promote the green additive and the production method thereof of growth of animal significantly.

In order to achieve the above object, the invention provides following technical scheme: produce a kind of additive that promotes growth of animal, comprise corn, paddy rice, wheat, crop such as soybean and ground oil seeds, these crops contain growth hormone protein and can promote the growth of animal significantly, in order to the modifier gene of expressing somatotropin are: ATCTAGAATGGCCTTCCCGGCCATGCCCCTGTCGAGCCTGTTCGCCAACGCCGTGC TGCGCGCCCAGCACCTGCACCAGCTGGCCGCCGACACGTACAAGGAGTTCGAGCGC GCCTACATCCCGGAGGGTCAGCGCTACTCGATCCAGAACGCCCAGGCCGCCTTCTG CTTCTCGGAGACGATCCCGGCGCCGACGGGTAAGGACGAGGCCCAGCAGAGGTCGG ACGTGGAGCTGCTGCGCTTCTCGCTGCTGCTGATTCAGTCGTGGCTGGGGCCCTTC ATCCGCTGAGTCGACA

Above-mentioned PGH modifier gene sequence can give expression to corresponding recombinant protein by plant-bioreactor, and forms tertiary structure.

In implementing process of the present invention, carry out the preparation of genetic recombination and recombinant protein, promptly (1) inserts plasmid vector with above-mentioned somatotropin modifier gene: adopt molecular biological method to come synthetic PGH gene, this gene contains promotor and terminator, gene is modified to become the codon that plant is had a liking for partially, front end is the signal peptide gene of plant, and the fragment two ends are restriction enzyme site (Xba I and sal I).Cut expression vector and purpose fragment with corresponding restriction endonuclease, T4 connects reorganization, makes up recombinant plasmid separately; (2) above-mentioned recombinant plasmid is changed in plant corn, paddy rice, wheat, soybean and the rape express, obtain the seed of genetically modified plants: with the recombinant plasmid transformed Agrobacterium tumefaciems, in the LB that contains kanamycin, cultivate, centrifugal collecting cell, resuspended in the MS culture fluid that contains sucrose and L6-BA, again cultured plant stem-leaf is immersed vacuum infiltration in the resuspended liquid that contains the Agrobacterium tumefaciems cell, the water flushing, deposit to maturation, with the agar gel screening transgenic seed of GM that contains MS, sucrose and MES and kanamycin; (3) get the seed kind and go into soil, obtain can be used as plant roots, stem, leaf, the fruits and seeds of feed addictive.

In implementing process of the present invention, at first carry out big quantitative analysis and reorganization by growth hormone gene to pig, ox, sheep (sheep and goat), people, choose fragment and recombinate with identical conserved region.In order to improve the expression in plant, we merge the purpose fragment mutually with the segment signal peptide gene of plant itself, prevent the degraded of mRNA simultaneously.This fragment gene of synthetic is connected reorganization with the expression vector of plant then, and the method by Agrobacterium-mediated Transformation and particle gun transform is integrated into genes of interest in the genome of plant.

Above-mentioned PGH gene order gives expression to corresponding recombinant protein by plant-bioreactor, and forms tertiary structure, and with the feed addictive that contains the activated protein of recombinating, the livestock and poultry of feeding can play tangible promotion growth effect.

In implementing process of the present invention, promote the production of " green additive " of growth of animal to comprise manually modified, the synthetic of genes of interest, genetic recombination, the recombinant plasmid transformed plant of homology analysis with genes of interest, genes of interest, actuate the thing growing method and comprise with the crop that contains recombinant protein and make the feed addictive and the domestic animal of feeding.At first carry out big quantitative analysis and reorganization by growth hormone gene to pig, ox, sheep (sheep and goat), people, simultaneously with reference to a strain variant of isolating somatotropin in the hypophysis, the easier back that is translated is modified because its mistake has lacked several amino acid, easier formation dimer and avoid the degraded of kidney.We be exactly with reference to this variant and synthetic the growth hormone gene of pig, the modification after utilizing plant to translate and the digestion that can resist some enzymes.In order to improve the expression in plant, we merge the purpose fragment mutually with the segment signal peptide gene of plant itself, prevent the degraded of mRNA simultaneously.Adopt molecular biological method synthetic PGH gene, this gene contains promotor and terminator, and gene becomes the codon that plant is had a liking for partially through modifying, and front end is the signal peptide gene of plant, and the fragment two ends are restriction enzyme site (Xba I and sal I).Cut expression vector and purpose fragment with corresponding restriction endonuclease, the T4 ligase connects reorganization, makes up corresponding recombinant plasmid; Change above-mentioned recombinant plasmid over to the plant corn, paddy rice, wheat, express in soybean and the rape, obtain the seed of genetically modified plants: with the recombinant plasmid transformed Agrobacterium tumefaciems, in the LB that contains kanamycin, cultivate, centrifugal collecting cell, resuspended in the MS culture fluid that contains sucrose and L6-BA, again cultured plant stem-leaf is immersed vacuum infiltration in the resuspended liquid that contains the Agrobacterium tumefaciems cell, the water flushing, deposit to maturation, with containing MS, the GM of sucrose and MES and the agar gel of kanamycin screening transgenic seed, and can detect conclusive evidence through ELISA method and Western blot method.

In the implementation process, the plant seed kind in cuvette, is placed in 4 ℃ of darkrooms and made its synchronous germination in 48 hours.After went to the 20C of growth room exposure 16 hours, use distilled water, water with mineral water occasionally.Recombinant plasmid transformed Agrobacterium tumefaciems cell-line (Agrobacteriumtumefaciens cell line) (C58C1 strain), (containing kanamycin 50mg/ml) cultivation centrifugal collecting cell in LB (Luri-Bertani) culture fluid, (6-BA that contains 5% sucrose and 10g/L is (resuspended among the amino fast cry of certain animals 6-benzilaminopurine of 6-benzyl in 200ml MS (murashige and Skoog) culture fluid (2.35g/l).Treat plant 6-7 during age in week, be inverted the cultivation cup plant immersion is contained in the resuspended liquid of Agrobacterium tumefaciems cell (Agrobacterium) vacuum 5 * 10 ⁶Mpa soaks into infiltration 15 minutes, is put in the growth room until maturation after the water flushing.In culture dish morpholine ethane sulfonicacid) and screen transgenic seed in the agar gel (8g/lPH5.7) of 50mg/ml kanamycin with containing GM (4.7g/lMS, l% sucrose and 0.5g/LMES (morpholino ethane sulfonic acid:.After two weeks, genetically modified plants are moved to the ripe transgenic seed that can obtain to promote growth of animal of cultivation in the soil.Perhaps wrap up golden bullet, adopt the method for gene bombardment to transform, confirm that through cultivation and Southern blot detection the back obtains the transgenic seed of promotion growth of animal with recombinant plasmid.

The foreign gene that contains somatotropin (PGH) in the root of genetically modified plants, stem, leaf, fruit and the seed detects conclusive evidence through PCR, and contained foreign protein can detect conclusive evidence through ELISA and Westernblot.

Compared with prior art, the present invention has following tangible advantage: the one, and production technology is simple, and the 2nd, the recombinant protein biologically active in the crop can promote the growth of animal significantly, after the domestic animal feed contained the feed of above-mentioned additive, its lean meat percentage, rate of body weight gain were apparently higher than the blank group.

Embodiment is following carries out more detailed description by specific embodiment to the present invention:

Embodiment

At first carry out big quantitative analysis and reorganization, choose function fragment and analyze with identical conserved region by growth hormone gene to pig, ox, sheep (sheep and goat), people.Determine genes of interest with reference to the variant that more can resist the digestion of enzyme owing to lacked several amino acid simultaneously.In order to improve the expression in plant, the purpose fragment is merged mutually with the segment signal peptide gene of plant itself, prevent the degraded of mRNA.Adopt molecular biological method synthetic PGH gene, this gene contains promotor and terminator, and gene becomes the codon that plant is had a liking for partially through modifying, and front end is the signal peptide gene of plant, and the fragment two ends are restriction enzyme site (Xba I and sal I).Cut expression vector and purpose fragment with corresponding restriction endonuclease, the T4 ligase connects reorganization, makes up corresponding recombinant plasmid; Change above-mentioned recombinant plasmid over to the plant corn, paddy rice, wheat, express in soybean and the rape, obtain the seed of genetically modified plants: with the recombinant plasmid transformed Agrobacterium tumefaciems, in the LB that contains kanamycin, cultivate, centrifugal collecting cell, resuspended in the MS culture fluid that contains sucrose and L6-BA, again cultured plant stem-leaf is immersed vacuum infiltration in the resuspended liquid that contains the Agrobacterium tumefaciems cell, the water flushing, deposit to maturation, with containing MS, the GM of sucrose and MES and the agar gel of kanamycin screening transgenic seed, and through ELISA method and Western blot method detection conclusive evidence.

The seed of plant is implanted in the cuvette, in 4 ℃ of darkrooms, placed and made its synchronous germination in 48 hours, be transferred to 20 ℃ of exposures in growth room 16 hours thereafter, use distilled water, water with mineral water once in a while.Treat plant 6-7 during age in week, be inverted the cultivation cup plant stem-leaf immersion is contained in the resuspended liquid of Agrobacterium tumefaciems cell vacuum 5 * 10 ⁶Mpa soaks into infiltration 15 minutes, puts into the growth room until maturation after the water flushing.In culture dish, with screening transfer-gen plant in the agar gelling (8g/lPH5.7) that contains GM (4.7g/lMS, 1% sucrose and 0.5g/lMES) and 50mg/ml concentration kanamycin.After two weeks, genetically modified plants are moved to the ripe transgenic seed that can obtain anti-avian influenza of cultivation in the soil.Perhaps wrap up golden bullet, adopt the method for gene bombardment to transform, confirm that through cultivation and Southern blot detection the back obtains the transgenic seed of promotion growth of animal with recombinant plasmid.

Contained foreign gene PGH in the root of each genetically modified plants, stem, leaf, the fruits and seeds can detect primer and detect existence through its PCR.

Contained foreign protein in the root of each genetically modified plants, stem, leaf, the fruits and seeds, detect its existence through ELISA and Western blot, positive control is the polypeptide PGA (10ug/ml) that is mixed with synthetic in the empty plasmid plant transformed extract, and negative control is an empty plasmid plant transformed extract.The result shows in the root, stem, leaf, fruits and seeds of genetically modified plants and contains foreign protein PGH, can significantly reaction take place with corresponding polypeptide serum in the albumen.In Western blot detects, can detect specific band with the serum of anti-PGH, molecular weight is 1-50KDa, draws the testing result identical with ELISA.

After the domestic animal feed contained the feed of above-mentioned additive, lean meat percentage, growth rate obviously improved, and have surpassed the level of the growth promotion type additive of selling on the market.

Claims (2)

1, a kind of green additive that promotes growth of animal, comprise corn, paddy rice, wheat, all kinds of crops of soybean and ground oil seeds, it is characterized in that: green additive ZHONG contains the somatotropin (PGH) of pig, in order to the modifier gene of expressing PGH is: ATCTAGAATGGCCTTCCCGGCCATGCCCCTGTCGAGCCTGTTCGCCAACGCCGTGC TGCGCGCCCAGCACCTGCACCAGCTGGCCGCCGACACGTACAAGGAGTTCGAGCGC GCCTACATCCCGGAGGGTCAGCGCTACTCGATCCAGAACGCCCAGGCCGCCTTCTG CTTCTCGGAGACGATCCCGGCGCCGACGGGTAAGGACGAGGCCCAGCAGAGGTCGG ACGTGGAGCTGCTGCGCTTCTCGCTGCTGCTGATTCAGTCGTGGCTGGGGCCCTTC ATCCGCTGAGTCGACA

2, the production method of the described feed addictive of claim 1 is characterized in that: carry out the preparation of genetic recombination and recombinant protein, its detailed process is:

(1) the PGH modifier gene is inserted plasmid vector: adopt molecular biological method synthetic PGH gene, this gene contains promotor and terminator, gene becomes the codon that plant is had a liking for partially through modifying, front end adds the signal peptide gene of plant, the fragment two ends are restriction enzyme site (Xba I and sal I), cut expression vector and purpose fragment with corresponding restriction endonuclease, and the T4 ligase connects reorganization, make up corresponding recombinant plasmid, then

(2) above-mentioned recombinant plasmid is changed in plant corn, paddy rice, wheat, soybean and the rape express, obtain the seed of genetically modified plants: with the recombinant plasmid transformed Agrobacterium tumefaciems, in the LB that contains kanamycin, cultivate, centrifugal collecting cell, resuspended in the MS culture fluid that contains sucrose and L6-BA, again cultured plant stem-leaf is immersed vacuum infiltration in the resuspended liquid that contains the Agrobacterium tumefaciems cell, the water flushing, deposit to maturation, agar gel with GM that contains MS, sucrose and MES and kanamycin screens the transgenic seed that contains PGH, again

(3) get the seed kind and go into soil, obtain can be used as plant roots, stem, leaf, the fruits and seeds of feed addictive.