CN1333370A - Crops capable of resisting virus diseases of poultry and production method thereof - Google Patents
Crops capable of resisting virus diseases of poultry and production method thereof Download PDFInfo
- Publication number
- CN1333370A CN1333370A CN01125352A CN01125352A CN1333370A CN 1333370 A CN1333370 A CN 1333370A CN 01125352 A CN01125352 A CN 01125352A CN 01125352 A CN01125352 A CN 01125352A CN 1333370 A CN1333370 A CN 1333370A
- Authority
- CN
- China
- Prior art keywords
- kinds
- plant
- virus
- disease
- crop
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The present invention discloses a crop capable of resisting one kind, two kinds of three kinds of fowl viruses of avian influenza, Newcastle disease and infective cloacal bursa disease and its production method. It is characterized by that the active antigen protein in the crop is obtained by virus RNA inverse transcription, and can encode complete DNA sequence of correspondent HA.F and VP2 protein, and is summation of three-dimensional structure formed in root, stem, leaf and seed of the crop. Said invented production method includes the following processes: insertion of HA, F and VP2 hologene into plasmid vector, expression of recombinant plasmid transferred into plant, pairwise hybridization of plants which respectively possess the action of resisting the above-mentioned three viruses or simultaneous hybridization of three plants, planting the different transgneic seeds into soil to obtain crops which can be used as raw material of feed and feeding fowl with feed containing recombinant active protein.
Description
Technical field
The present invention relates to the crop and the production method thereof of anti-gal virus disease, more particularly, relate to a kind of anti-poultry bird flu, newcastle disease and three kinds of virus diseases of infectious bursal disease wherein any one, corn, paddy rice, wheat, soybean, cole crop and the production method thereof of two kinds or three kinds.
Background technology
In the prior art, do to express carrier with plant and express the existing many reports of foreign protein, do not appear in the newspapers as yet but gal virus antigen expressed on plant materials.In the present prevention technique, the immune useful dead seedling of bird flu (AI), newcastle disease (ND) and infectious bursal disease (IBD), also useful weak malicious seedling.But existing immunological technique has many imperfection factors: the one, and the producer that produces vaccine has the danger of the poison that looses, and the 2nd, weak malicious seedling has " reversion " phenomenon, and the other diseases of having the more important thing is artificial propagation brings great difficulty for the elimination of virus disease.The 3rd, the program complexity of deactivation vaccine and weak malicious seedling immunity, cost is higher, and immunity is uncertain.Therefore, control and eliminate this disease up hill and dale, must a kind of safe, efficient, cheap substitute of exploitation.Studies show that: the structural protein VP2 of structural protein F, the IBDV of structural protein HA, the NDV of AIV carries the typical antigenic determinant of virus separately, can bring out the generation of IgA/IgG, but both equal protection tests or body animal opposing strong virus attack.
Technology contents
The object of the present invention is to provide a kind of anti-poultry bird flu, newcastle disease and three kinds of virus diseases of infectious bursal disease wherein any one, corn, paddy rice, wheat, soybean, cole crop and the production method thereof of two kinds or three kinds.
In order to achieve the above object, the invention provides following technical scheme: the crop of a kind of, two kinds or the three kinds diseases in 1, a kind of anti-poultry bird flu, newcastle disease and three kinds of virus diseases of infectious bursal disease, comprise corn, paddy rice, wheat, soybean and rape etc., it is characterized in that: they have intactly expressed avian influenza virus, the antigen of any one in Avian pneumo-encephalitis virus and the infectious bursa of Fabricius virus, two kinds or three kinds viruses also can make poultry produce effective immunizing power, in order to the immunogenic protein gene of expressing is:
HA：ttgaattcttgaattcatggaaagaacagtgcttcttcttgcaacagtcagtcttgttaaaagtgatcagatttgcattggttaccatgcaaacaactcgacagagcaggttgacacaataatggaaaagaatgttactgttacacatgcccaagacatactggaaaggacacacaacgggaagctctgcgatctaaatggagtgaagcctctcattttgagggattgtagtgtagctggatggctcctcggaaaccctatgtgtgacgaattcatcaatgtgccggaatggtcttacatagtggagaaggccagtccagccaatgacctctgttatccagggaatttcaacgactatgaagaactgaaacacctattgagcagaataaaccattttgagaaaattcagatcatccccaaaagttcttggtccaatcatgatgcctcatcaggggtgagctcagcatgtccataccttgggaggtcctcctttttcagaaatgtggtatggcttatcaaaaagaacagtgcatacccaacaataaagaggagctacaataataccaaccaagaagatcttttggtactgtggggggttcaccatcctaatgatgcggcagagcagacaaagctctatcaaaatccaaccacctacatttccgttggaacatcaacactgaaccagagattggttccagaaatagctactagacccaaagtaaacgggcaaagtggaagaatggagttcttctggacaattttaaagccgaatgatgccatcaatttcgagagtaatggaaatttcattgctccagaatatgcatacaaaattgtcaagaaaggggactcaacaattatgaaaagtgaattggaatatggtaactgcaacaccaagtgtcaaactccaatgggggcgataaactctagtatgccattccacaacatacaccccctcaccatcggggaatgccccaaatatgtgaaatcaaacagattagtccttgcgactggactcagaaatacccctcaaagagagagaagaagaaaaaagagaggactatttggagctatagcaggttttatagagggaggatggcagggaatggtagatggttggtatgggtaccaccatagcaatgagcaggggagttgctactctgcagacaaagaatccactcaaaaggcaatagatggagtcaccaataaggtcaactcgatcattaacaaaatgaacactcagtttgaggccgttggaagggaatttaataacttggaaaggaggatagagaatttaaacaagaagatggaagacggattcctagatgtctggacttacaatgctgaacttctggttctcatggaaaatgagagaactctcgactttcatgactcaaatgtcaagaacctttacgacaaggtccgactacagcttagggataatgcaaaggagctgggtaatggttgtttcgaattctatcacaaatgtgataatgaatgtatggaaagtgtaaaaaacggaacgtatgactacccgcagtattcagaagaagcaagactaaacagagaggaaataagtggagtaaaattggaatcaatgggaacttaccaaatactgtcaatttattcaacagtggcgagttccctagcactggcaatcatggtagctggtctatctttatggatgtgctccaatggatcgttacaatgcagaatttgcatttaaatttgtgagttcagattgtagttaaaaacaccctgacgtcgagacgtacc
F：ttgaattcatgggccccaaatcttctaccaatgtcccagcacctctgatgctgaccgtcaggattgcgctggcactgagctgtgtccgtctgacaaattctctcgatggaaggcctcttgcagctgcagggattgtagtaacgggagacaaagcagtcaacatatacacctcatctcagacagggtcaataatagtcaagttactcccaaatatgcctaaggataaagaggcgtgtgcaaaagccccgttggaggcatacaacaggacactgactgctttgctcaccccccttggtgattctatccgcaggatacaagagtctgcgactacgtccggaggaaggaggcagagacgctttataggtgccattatcggcagtgtagctcttggggttgccacagctgcccagataacagcagcctcagctctgatacaagccaaccagaatgctgccaacatcctccggcttaaagagagcattgctgcaactaatgaagctgtacatgaagtcactgacggattatcgcaactagcagtggcagttgggaagatgcagcagtttgttaatgaccagtttaataacacagctcaggaattggactgtataaaaattacacagcaggttggtgtagaactcaacctgtacctaactgaattgactacagtattcgggccacaaatcacttcccctgccttaactcagctgactatccaggcgctttacaatctagctggtggtaagatggattatttgttgactaagttaggtgttgggaacaaccaactcagctcattaatcggtagcggcttgatcaccggtaaccctattctgtacgattcacagactcaactcttaggtatacaggtaactttaccctcagtcggtaacctaaataatatgcgtgctacctacttggagaccttgtctgtaagcacaaccaagggatttgcctcagcacttgtcccaaaagtggtgacacaggtcgggtctgtgatagaggaacttgacacctcatactgtgtagagaccgatttggatttatattgtacaagaatagtgacattccctatgtctcctggtatttattcctgtctgagcggtaatacatcagcttgcatgtattcaaagactgaaggtgcacttactacgccatatatgactatcaagggctcagttattgccaattgcaagataacaacatgcagatgtgcagaccctccgggtatcatatcgcaaaattatggagaagctgtgtctctaatagataggcactcatgcaatgtcttatccttagacgggataactttgaggctcagtggagaatttgacgtaacttatcaaaagaatatctcaatattagattctcaggtaatagtgacaggcaatctcaatatctcaactgaacttgggaatgtcaacaactcgataagtaatgctttggataagttagaggaaagcaatagcaaacttgacaaagtcaatgtcaagctgaccggcacgtctgctctcattacctatatagttttaactatcatatctcttgtttgtggtatacttagcctggttctagcatgctatctgatgtataagcaaaaggcgcaacaaaagaccttattatggcttgggaataataccctaaatcagatgagggccactacaagaatctgaacacagagacgtccc
VP2：ttgaattcatgacaaacctgcaagatcaaacccaacagattgttccgttcatacggagccttctgatgccaacaaccggaccggcgtccattccggacgacaccctggagaagcacactctcaggtcagagacctcgacctacaatttgactgtgggggacacagggtcagggctaattgcctttttccctggattccctggctcaattgtgggtgctcactacacactgcagagcaatgggaactacaagttcgatcagatgctcctgactgcccagaacctaccggccagctacaactactgcaggctagtgagccggagtctcacagtaaggtcaagcacactccctggtggcgtttatgcactaaacggcaccataaacgccgtgaccttccaaggaagcctgagtgaactgacagatgttagctacaatggattgatgtctgcaacagccaacatcaacgacaaaattgggaacgtcctagtaggggaaggggtcaccgtcctcagcttacccacatcatatgatcttgggtatgtgagacttggtgaccccatacccgctatagggcttgacccaaaaatggtagcaacatgtgacagcagtgacaggcccagagtctacactataactgcagccgatgattaccaattctcatcacaataccaacaaggtggggtaacgatcacactgttctcagccaacattgatgccatcacaagcctcagcgttgggggagagcttgtgtttaaaacaagcgtccacagccttgtactgggcgccaccatctaccttataggctttgatgggactgcggtaatcactagagctgtagccgcaaacaatgggctgacgaccggcatcgacaatcttatgccattcaatcttgtgattccaaccaacgagataacccagccgatcacatccatcaaactggagatagtgacctccaggagtggtggtcaggcaggggatcagatgtcatggtcggcaagtgggagcctagcagtgacgatccatggtggcaactatccaggggccctccgtcccgtcacactagtagcctacgaaagagtggcaacaggatctgtcgttacgctcgccggggtgagcaacttcgagctgatcccaaatcctgaactagcaaagaacctggttacggaatacggccgatttgacccaggggccatgaactacacaaaattgatactgagtgatggggaccgtcttggcatcaagaccgtctggccaacaagggagtacacagactttcgtgagtacttcatggaggtggccgacctcaactctcccctgaagattgcaggagcatttggcttcaaagacataatccgggccataagggacgtccc
Above-mentioned three sequences give expression to separately recombinant protein by plant-bioreactor, and form tertiary structure.
The present invention's technical scheme preferably is: in the implementation process, carry out the preparation of gene recombination and recombinant protein, main immunogens gene (1) with above-mentioned three kinds of viruses inserts plasmid vector in process of production: adopt molecular biological method to carry and take out the nucleic acid RNA of virus, with containing promotor and terminator, the three pair primer amplified designed at different virus go out corresponding separately complete immunogen gene, the fragment two ends are restriction enzyme site (XbaI and salI), cut expression vector and purpose fragment with corresponding restriction endonuclease, the T4 ligase enzyme connects reorganization, makes up recombinant plasmid separately; (2) above-mentioned recombinant plasmid is changed in plant corn, paddy rice, wheat, soybean and the rape express, obtain the seed of transgenic plant: be with recombinant plasmid transformed agrobacterium tumefaciens C58C1 strain cell, in the LB that contains kantlex, cultivate, centrifugal collecting cell, resuspended in the MS nutrient solution that contains sucrose and L6-BA, again cultured plant stem-leaf is immersed vacuum infiltration in the resuspended liquid that contains the agrobacterium tumefaciens cell, the water flushing, deposit to maturation, with the agar gel screening transgenic seed of GM that contains MS, sucrose and MES and kantlex; Perhaps wrap up golden bullet, adopt the method for gene bombardment to transform, obtain the transgenic seed of monoclonal antibody bird flu, newcastle disease or infectious bursal disease respectively with recombinant plasmid.The transgenic seed that carries monoclonal antibody bird flu, newcastle disease or infectious bursal disease is respectively cultivated when waiting to pollinate plant, adopt traditional hybridizing method the plant of monoclonal antibody bird flu, newcastle disease or infectious bursal disease to be hybridized in twos or three's hybridization, obtain any two kinds or three kinds of diseases are had simultaneously the transgenic seed of resistant function in anti-avian influenza, newcastle disease or three kinds of virus diseases of infectious bursal disease simultaneously; (3) get the seed kind and go into soil, obtain can be used as roots of plants, stem, leaf, the fruits and seeds of feedstuff raw material.
In implementing process of the present invention, with three kinds of virus (avian influenza virus, Avian pneumo-encephalitis virus, infectious bursa of Fabricius virus) put instar chicken embryo on the 9th a breeding generation respectively after, from allantoic fluid, extract each viral RNA, protein gene is willing in the complete immunity that RT-PCR amplifies separately.
Above-mentioned three sequences give expression to separately recombinant protein by plant-bioreactor, and formation tertiary structure, make feed with the crop that contains the activated protein of recombinating, take food after two weeks, can play the effect of three kinds of diseases of prevention any one or any two kinds or three kinds diseases wherein wherein to poultry.
In implementing process of the present invention, the production of the crop of anti-poultry disease comprises with special primer and obtains each goal gene, gene recombination, recombinant plasmid transformed plant that immunization method comprises with containing the crop making feed of recombinant protein and the poultry of feeding.RNA extracting from inoculated into chick embryo or chicken body tissue of virus, with reverse transcription one polymerase chain reaction (PCR) amplification gene, restriction enzyme site (XbaI and SalI) and initial son and terminator in primer, have been imported, the main immunogens gene clone that each is viral is to expression vector, the plasmid of reorganization is changed in the plant and expresses, treat to obtain the transgenic seed of monoclonal antibody bird flu, newcastle disease or infectious bursal disease respectively after the transgenic plant seed maturation.Perhaps wrap up golden bullet, adopt the method for gene bombardment to transform, obtain the transgenic seed of monoclonal antibody bird flu, newcastle disease or infectious bursal disease respectively with recombinant plasmid.The transgenic seed that carries monoclonal antibody bird flu, newcastle disease or infectious bursal disease is respectively cultivated when waiting to pollinate plant, adopt traditional hybridizing method the plant of monoclonal antibody bird flu, newcastle disease or infectious bursal disease to be hybridized in twos or three's hybridization, obtain any two kinds or three kinds of diseases are had simultaneously the transgenic seed of resistant function in anti-avian influenza, newcastle disease or three kinds of virus diseases of infectious bursal disease simultaneously.After will resist the planting seed of various viruses, ripe back is as the poultry feed raw material.As genetically modified plant can be corn, paddy rice, soybean, wheat, rape etc.Transgenic plant are through after cultivating, contain three various viruses any one virus or any two kinds of viruses wherein or three kinds of foreign immunologic originality albumen that virus contains simultaneously wherein in its root, stem, leaf, the fruits and seeds, and can detect conclusive evidence through ELISA method and Western blot method.
In the implementation process, the plant seed kind in cuvette, is placed in 4 ℃ of darkrooms and made its synchronous germination in 48 hours.After go to 20 ℃ of growth rooms exposure 16 hours, use distilled water, water with mineral water occasionally.Recombinant plasmid transformed agrobacterium tumefaciens clone (Agrobacteriumtumefaciens cell line) (C58C1 strain), (containing kantlex 50mg/ml) cultivation centrifugal collecting cell in LB (Luri-Bertani) nutrient solution, (6-BA that contains 5% sucrose and 10g/L is (resuspended among the amino fast cry of certain animals 6-benzilaminopurine of 6-benzyl in 200ml MS (murashige and Skoog) nutrient solution (2.35g/l).Treat plant 6-7 during age in week, be inverted the cultivation cup plant immersion is contained in the resuspended liquid of agrobacterium tumefaciens cell (Agrobacterium) vacuum 5 * 10
6Mp
aSoak into infiltration 15 minutes, be put in the growth room until maturation after the water flushing.In culture dish morpholine ethane sulfonicacid) and screen transgenic seed in the agar gel (8g/lPH5.7) of 50mg/ml kantlex with containing GM (4.7g/lMS, 1% sucrose and 0.5g/LMES (morpholino ethane sulfonic acid:.After two weeks, transgenic plant are moved to the ripe transgenic seed that can distinguish monoclonal antibody bird flu, newcastle disease or infectious bursal disease of cultivation in the soil.Perhaps wrap up golden bullet, adopt the method for gene bombardment to transform, confirm that through cultivation and Southern blot detection the back obtains the transgenic seed of the bird flu of difference monoclonal antibody, newcastle disease or infectious bursal disease with recombinant plasmid.
The transgenic seed that carries monoclonal antibody bird flu, newcastle disease or infectious bursal disease is respectively cultivated when waiting to pollinate plant, adopt traditional hybridizing method the plant of monoclonal antibody bird flu, newcastle disease or infectious bursal disease to be hybridized in twos or three's hybridization, obtain any two kinds or three kinds of diseases are had simultaneously the transgenic seed of resistant function in anti-avian influenza, newcastle disease or three kinds of virus diseases of infectious bursal disease simultaneously.
Contain three viruses any one virus or any two kinds of viruses wherein or three kinds of corresponding foreign genes that virus contains simultaneously wherein in the root of transgenic plant, stem, leaf, fruit and the seed, detect conclusive evidence through PCR, contained foreign protein can detect conclusive evidence through ELISA and Western blot.
Compared with prior art, the present invention has following tangible advantage: the one, and production technology is simple, the 2nd, the recombinant protein in the crop has immunogenicity, can bring out poultry produces any one disease wherein of the bird flu of antibody opposing poultry, newcastle disease and infectious bursal disease virus or any two kinds of diseases wherein or three kinds of diseases is had resistant function simultaneously, the poultry feed contains the feed of above-mentioned crop after two weeks, with 10
4ID
50Corresponding virus is attacked poison, and the protection ratio of immune chicken is 100%, and control group is then all dead, thereby technique effect is good.
Embodiment
Below by specific embodiment the present invention is carried out more detailed description:
Embodiment 1
The anti-avian influenza crop
With chicken or chicken embryo breeding avian influenza virus, adopt the nucleic acid RNA of molecular biology method extracting virus, amplify the complete genome of HA with the specific primer that contains promotor and terminator, restriction enzyme site XbaI and SalI are contained in the fragment two ends, with corresponding endonuclease digestion expression vector and purpose fragment, the T4 ligase enzyme connects reorganization, construction recombination plasmid, with each recombinant plasmid transformed agrobacterium tumefaciens clone (C58C1 strain), cultivate in LB nutrient solution (containing kantlex 50mg/ml), centrifugal collecting cell, resuspended in 200mlMS nutrient solution (2.35g/l concentration) (containing 5% sucrose and 10g/l6-BA).
The seed of plant is implanted in the cuvette, in 4 ℃ of darkrooms, placed and made its synchronous germination in 48 hours, be transferred to 20 ℃ of exposures in growth room 16 hours thereafter, use distilled water, water with mineral water once in a while.Treat plant 6-7 during age in week, be inverted the cultivation cup plant stem-leaf immersion is contained in the resuspended liquid of agrobacterium tumefaciens cell vacuum tightness 5 * 10
6Mp
aSoak into infiltration 15 minutes, put into the growth room until maturation after the water flushing.In culture dish, with screening transfer-gen plant in the agar gelling (8g/lPH5.7) that contains GM (4.7g/lMS, 1% sucrose and 0.5g/lMES) and 50mg/ml concentration kantlex.After two weeks, transgenic plant are moved to the ripe transgenic seed that can obtain anti-avian influenza of cultivation in the soil.Perhaps wrap up golden bullet, adopt the method for gene bombardment to transform, confirm that through cultivation and Southern blot detection the back obtains the transgenic seed of anti-avian influenza with recombinant plasmid.
The foreign gene HA of contained bird flu in the root of each transgenic plant, stem, leaf, the fruits and seeds can detect primer and detect existence through its PCR.
Contained foreign protein HA in the root of each transgenic plant, stem, leaf, the fruits and seeds, detect its existence through ELISA and Western blot, positive control is the polypeptide (10ug/ml) that is mixed with some antigenic determinants that are arranged in HA albumen of synthetic in the empty plasmid plant transformed extract, and negative control is an empty plasmid plant transformed extract.The result shows in the root, stem, leaf, fruits and seeds of transgenic plant and contains foreign protein HA, can significantly reaction take place with corresponding antigen polypeptide serum in the albumen.In Western blot detects, can detect specific band with the serum of anti-HA, molecular weight is 30-150KD
a, draw the detected result identical with ELISA.
Detect the existence of the corresponding antibodies of anti-AIV in the serum behind the transgenic plant immunity chicken of each anti-avian influenza with ELISA and Western blot, the ELISA detected result shows: contain anti-avian influenza virus antibody in the little chicken serum, have the characteristic of specific anti-corresponding polypeptide and AIV; Western blot detected result shows: the pooled serum with the extract immunity chicken acquisitions of the transgenic plant of corresponding recombinant plasmid transfection equally has specific reaction zone with corresponding anti-polypeptide serum.The poultry feed contains the feed of above-mentioned crop after two weeks, with 10
4ID
50Corresponding avian influenza virus is attacked poison, and the protection ratio of immune chicken is 100%, and control group is then all dead.
Embodiment 2
Anti-newcastle disease crop
With chicken or chicken embryo breeding Avian pneumo-encephalitis virus, adopt the nucleic acid RNA of molecular biology method extracting virus, amplify the complete genome of F with the specific primer that contains promotor and terminator, restriction enzyme site XbaI and SalI are contained in the fragment two ends, with corresponding endonuclease digestion expression vector and purpose fragment, the T4 ligase enzyme connects reorganization, construction recombination plasmid, with recombinant plasmid transformed agrobacterium tumefaciens clone (C58C1 strain), cultivate in LB nutrient solution (containing kantlex 50mg/ml), centrifugal collecting cell, resuspended in 200mlMS nutrient solution (2.35g/l concentration) (containing 5% sucrose and 10g/l6-BA).
The seed of plant is implanted in the cuvette, in 4 ℃ of darkrooms, placed and made its synchronous germination in 48 hours, be transferred to 20 ℃ of exposures in growth room 16 hours thereafter, use distilled water, water with mineral water once in a while.Treat plant 6-7 during age in week, be inverted the cultivation cup plant stem-leaf immersion is contained in the resuspended liquid of agrobacterium tumefaciens cell vacuum tightness 5 * 10
6Mp
aSoak into infiltration 15 minutes, put into the growth room until maturation after the water flushing.In culture dish, with screening transfer-gen plant in the agar gelling (8g/lPH5.7) that contains GM (4.7g/lMS, 1% sucrose and 0.5g/lMES) and 50mg/ml concentration kantlex.After two weeks, transgenic plant are moved to the ripe transgenic seed that can obtain anti-newcastle disease of cultivation in the soil.Perhaps wrap up golden bullet, adopt the method for gene bombardment to transform, confirm that through cultivation and Southern blot detection the back obtains the transgenic seed of anti-newcastle disease with recombinant plasmid.
In the root of each transgenic plant, stem, leaf, the fruits and seeds foreign gene F, can detect primer through PCR and detect exist.
Contained foreign protein F in the root of each transgenic plant, stem, leaf, the fruits and seeds, detect its existence through ELISA and Western blot, positive control is the polypeptide (10ug/ml) that is mixed with some antigenic determinants that are arranged in F albumen of synthetic in the empty plasmid plant transformed extract, and negative control is an empty plasmid plant transformed extract.The result shows in the root, stem, leaf, fruits and seeds of transgenic plant and contains foreign protein, can significantly reaction take place with corresponding antigen polypeptide serum in the F albumen.In Western blot detects, can detect specific band with the serum of anti-F, molecular weight is 30-150KD
a, draw the detected result identical with ELISA.
Detect the existence of the corresponding antibodies of anti-NDV in the serum behind each transgenic plant immunity chicken with ELISA and Western blot, the ELISA detected result shows: contain the antibody of anti-new castle disease virus in the little chicken serum, have the characteristic of specific anti-corresponding polypeptide and NDV; Western blot detected result shows: the pooled serum that the extract immunity chicken of the transgenic plant of usefulness recombinant plasmid transfection obtains equally has specific reaction zone with corresponding anti-polypeptide serum.The poultry feed contains the feed of above-mentioned crop after two weeks, with 10
4ID
50Avian pneumo-encephalitis virus is attacked poison, and the protection ratio of immune chicken is 100%, and control group is then all dead.
Embodiment 3
The infectivity resistant bursal disease crop
With chicken or chicken embryo breeding infectious bursal disease virus, adopt the nucleic acid RNA of molecular biology method extracting virus, with contain promotor and terminator specific primer amplify the complete genome of VP2, restriction enzyme site XbaI and SalI are contained in the fragment two ends, with corresponding endonuclease digestion expression vector and purpose fragment, the T4 ligase enzyme connects reorganization, construction recombination plasmid, with recombinant plasmid transformed agrobacterium tumefaciens clone (C58C1 strain), cultivate in LB nutrient solution (containing kantlex 50mg/ml), centrifugal collecting cell, resuspended in 200mlMS nutrient solution (2.35g/l concentration) (containing 5% sucrose and 10g/l6-BA).
The seed of plant is implanted in the cuvette, in 4 ℃ of darkrooms, placed and made its synchronous germination in 48 hours, be transferred to 20 ℃ of exposures in growth room 16 hours thereafter, use distilled water, water with mineral water once in a while.Treat plant 6-7 during age in week, be inverted the cultivation cup plant stem-leaf immersion is contained in the resuspended liquid of agrobacterium tumefaciens cell vacuum tightness 5 * 10
6Mp
aSoak into infiltration 15 minutes, put into the growth room until maturation after the water flushing.In culture dish, with screening transfer-gen plant in the agar gelling (8g/lPH5.7) that contains GM (4.7g/lMS, 1% sucrose and 0.5g/lMES) and 50mg/ml concentration kantlex.After two weeks, transgenic plant are moved to the ripe transgenic seed that can obtain infectivity resistant bursal disease virus of cultivation in the soil.Perhaps wrap up golden bullet, adopt the method for gene bombardment to transform, confirm that through cultivation and Southern blot detection the back obtains the transgenic seed of infectivity resistant bursal disease with recombinant plasmid.
Contained corresponding foreign gene VP2 in the root of each transgenic plant, stem, leaf, the fruits and seeds, can through PCR detect primer and detect and exist.
Contained foreign protein VP2 in the root of each transgenic plant, stem, leaf, the fruits and seeds, detect its existence through ELISA and Western blot, positive control is the polypeptide (10ug/ml) that is mixed with some antigenic determinants that are arranged in VP2 of synthetic in the empty plasmid plant transformed extract, and negative control is an empty plasmid plant transformed extract.The result shows in the root, stem, leaf, fruits and seeds of transgenic plant and contains foreign protein, can significantly reaction take place with corresponding antigen polypeptide serum in the VP2 albumen.In Western blot detects, can detect specific band with the serum of anti-VP2, molecular weight is 30-150KD
a, draw the detected result identical with ELISA.
With the existence of the corresponding antibodies of anti-IBDV in the serum behind ELISA and the Western blot detection transgenic plant immunity chicken, the ELISA detected result shows: contain the antibody of anti-IBDV in the little chicken serum, have the characteristic of specific anti-corresponding polypeptide and IBDV; Western blot detected result shows: the pooled serum with the extract immunity chicken acquisitions of the transgenic plant of corresponding recombinant plasmid transfection equally has specific reaction zone with corresponding anti-polypeptide serum.The poultry feed contains the feed of above-mentioned crop after two weeks, with 10
4ID
50IBDV attacks poison, and the protection ratio of immune chicken is 100%, and control group is then all dead.
Embodiment 4
The crop of any two kinds or anti-simultaneously three kinds of virus diseases in anti-avian influenza, newcastle disease and three kinds of viruses of infectious bursal disease
The above-mentioned transgenic seed that carries monoclonal antibody bird flu, newcastle disease or infectious bursal disease is respectively cultivated when waiting to pollinate plant, adopt traditional hybridizing method the plant of monoclonal antibody bird flu, newcastle disease or infectious bursal disease to be hybridized in twos or three's hybridization, obtain any two kinds or three kinds of diseases are had simultaneously the transgenic seed of resistant function in anti-avian influenza, newcastle disease or three kinds of virus diseases of infectious bursal disease simultaneously.
Contained corresponding foreign gene in the root of each transgenic plant, stem, leaf, the fruits and seeds all can detect primer through corresponding PCR and detect existence.
Contained foreign protein HA, F and VP2 in the root of each transgenic plant, stem, leaf, the fruits and seeds, detect its existence through ELISA and Western blot, positive control is the polypeptide (10ug/ml) that is mixed with some antigenic determinants that are arranged in HA, F and VP2 of synthetic in the empty plasmid plant transformed extract, and negative control is an empty plasmid plant transformed extract.The result shows in the root, stem, leaf, fruits and seeds of transgenic plant and contains foreign protein, can significantly reaction take place with corresponding antigen polypeptide serum in HA, F and the VP2 albumen.In Western blot detects, can detect specific band with the serum of anti-HA, F and VP2, molecular weight is 30-150KD
a, draw the detected result identical with ELISA.
Existence with the corresponding antibodies of anti-AIV, NDV and IBDV in the serum behind ELISA and the Western blot detection transgenic plant immunity chicken, the ELISA detected result shows: contain the antibody of anti-AIV, NDV and IBDV in the little chicken serum, have the characteristic of specific anti-corresponding polypeptide and AIV, NDV and IBDV; Western blot detected result shows: the pooled serum with the extract immunity chicken acquisitions of the transgenic plant of corresponding recombinant plasmid transfection equally has specific reaction zone with corresponding anti-polypeptide serum.The poultry feed contains the feed of above-mentioned crop after two weeks, with 10
4ID
50Corresponding virus is attacked poison, and the protection ratio of immune chicken is 100%, and control group is then all dead.
Claims (2)
- The crop of a kind of, two kinds or the three kinds diseases in 1, a kind of anti-poultry bird flu, newcastle disease and three kinds of virus diseases of infectious bursal disease, comprise corn, paddy rice, wheat, soybean and rape etc., it is characterized in that: they have intactly expressed avian influenza virus, the antigen of any one in Avian pneumo-encephalitis virus and the infectious bursa of Fabricius virus, two kinds or three kinds viruses also can make poultry produce effective immunizing power, in order to the immunogenic protein gene of expressing is:( 1 ) HA：ttgaattcttgaattcatggaaagaacagtgcttcttcttgcaacagtcagtcttgttaaaagtgatcagatttgcattggttaccatgcaaacaactcgacagagcaggttgacacaataatggaaaagaatgttactgttacacatgcccaagacatactggaaaggacacacaacgggaagctctgcgatctaaatggagtgaagcctctcattttgagggattgtagtgtagctggatggctcctcggaaaccctatgtgtgacgaattcatcaatgtgccggaatggtcttacatagtggagaaggccagtccagccaatgacctctgttatccagggaatttcaacgactatgaagaactgaaacacctattgagcagaataaaccattttgagaaaattcagatcatccccaaaagttcttggtccaatcatgatgcctcatcaggggtgagctcagcatgtccataccttgggaggtcctcctttttcagaaatgtggtatggcttatcaaaaagaacagtgcatacccaacaataaagaggagctacaataataccaaccaagaagatcttttggtactgtggggggttcaccatcctaatgatgcggcagagcagacaaagctctatcaaaatccaaccacctacatttccgttggaacatcaacactgaaccagagattggttccagaaatagctactagacccaaagtaaacgggcaaagtggaagaatggagttcttctggacaattttaaagccgaatgatgccatcaatttcgagagtaatggaaatttcattgctccagaatatgcatacaaaattgtcaagaaaggggactcaacaattatgaaaagtgaattggaatatggtaactgcaacaccaagtgtcaaactccaatgggggcgataaactctagtatgccattccacaacatacaccccctcaccatcggggaatgccccaaatatgtgaaatcaaacagattagtccttgcgactggactcagaaatacccctcaaagagagagaagaagaaaaaagagaggactatttggagctatagcaggttttatagagggaggatggcagggaatggtagatggttggtatgggtaccaccatagcaatgagcaggggagttgctactctgcagacaaagaatccactcaaaaggcaatagatggagtcaccaataaggtcaactcgatcattaacaaaatgaacactcagtttgaggccgttggaagggaatttaataacttggaaaggaggatagagaatttaaacaagaagatggaagacggattcctagatgtctggacttacaatgctgaacttctggttctcatggaaaatgagagaactctcgactttcatgactcaaatgtcaagaacctttacgacaaggtccgactacagcttagggataatgcaaaggagctgggtaatggttgtttcgaattctatcacaaatgtgataatgaatgtatggaaagtgtaaaaaacggaacgtatgactacccgcagtattcagaagaagcaagactaaacagagaggaaataagtggagtaaaattggaatcaatgggaacttaccaaatactgtcaatttattcaacagtggcgagttccctagcactggcaatcatggtagctggtctatctttatggatgtgctccaatggatcgttacaatgcagaatttgcatttaaatttgtgagttcagattgtagttaaaaacaccctgacgtcgagacgtacc( 2 ) F：ttgaattcatgggccccaaatcttctaccaatgtcccagcacctctgatgctgaccgtcaggattgcgctggcactgagctgtgtccgtctgacaaattctctcgatggaaggcctcttgcagctgcagggattgtagtaacgggagacaaagcagtcaacatatacacctcatctcagacagggtcaataatagtcaagttactcccaaatatgcctaaggataaagaggcgtgtgcaaaagccccgttggaggcatacaacaggacactgactgctttgctcaccccccttggtgattctatccgcaggatacaagagtctgcgactacgtccggaggaaggaggcagagacgctttataggtgccattatcggcagtgtagctcttggggttgccacagctgcccagataacagcagcctcagctctgatacaagccaaccagaatgctgccaacatcctccggcttaaagagagcattgctgcaactaatgaagctgtacatgaagtcactgacggattatcgcaactagcagtggcagttgggaagatgcagcagtttgttaatgaccagtttaataacacagctcaggaattggactgtataaaaattacacagcaggttggtgtagaactcaacctgtacctaactgaattgactacagtattcgggccacaaatcacttcccctgccttaactcagctgactatccaggcgctttacaatctagctggtggtaagatggattatttgttgactaagttaggtgttgggaacaaccaactcagctcattaatcggtagcggcttgatcaccggtaaccctattctgtacgattcacagactcaactcttaggtatacaggtaactttaccctcagtcggtaacctaaataatatgcgtgctacctacttggagaccttgtctgtaagcacaaccaagggatttgcctcagcacttgtcccaaaagtggtgacacaggtcgggtctgtgatagaggaacttgacacctcatactgtgtagagaccgatttggatttatattgtacaagaatagtgacattccctatgtctcctggtatttattcctgtctgagcggtaatacatcagcttgcatgtattcaaagactgaaggtgcacttactacgccatatatgactatcaagggctcagttattgccaattgcaagataacaacatgcagatgtgcagaccctccgggtatcatatcgcaaaattatggagaagctgtgtctctaatagataggcactcatgcaatgtcttatccttagacgggataactttgaggctcagtggagaatttgacgtaacttatcaaaagaatatctcaatattagattctcaggtaatagtgacaggcaatctcaatatctcaactgaacttgggaatgtcaacaactcgataagtaatgctttggataagttagaggaaagcaatagcaaacttgacaaagtcaatgtcaagctgaccggcacgtctgctctcattacctatatagttttaactatcatatctcttgtttgtggtatacttagcctggttctagcatgctatctgatgtataagcaaaaggcgcaacaaaagaccttattatggcttgggaataataccctaaatcagatgagggccactacaagaatctgaacacagagacgtccc( 3 ) VP2：ttgaattcatgacaaacctgcaagatcaaacccaacagattgttccgttcatacggagccttctgatgccaacaaccggaccggcgtccattccggacgacaccctggagaagcacactctcaggtcagagacctcgacctacaatttgactgtgggggacacagggtcagggctaattgcctttttccctggattccctggctcaattgtgggtgctcactacacactgcagagcaatgggaactacaagttcgatcagatgctcctgactgcccagaacctaccggccagctacaactactgcaggctagtgagccggagtctcacagtaaggtcaagcacactccctggtggcgtttatgcactaaacggcaccataaacgccgtgaccttccaaggaagcctgagtgaactgacagatgttagctacaatggattgatgtctgcaacagccaacatcaacgacaaaattgggaacgtcctagtaggggaaggggtcaccgtcctcagcttacccacatcatatgatcttgggtatgtgagacttggtgaccccatacccgctatagggcttgacccaaaaatggtagcaacatgtgacagcagtgacaggcccagagtctacactataactgcagccgatgattaccaattctcatcacaataccaacaaggtggggtaacgatcacactgttctcagccaacattgatgccatcacaagcctcagcgttgggggagagcttgtgtttaaaacaagcgtccacagccttgtactgggcgccaccatctaccttataggctttgatgggactgcggtaatcactagagctgtagccgcaaacaatgggctgacgaccggcatcgacaatcttatgccattcaatcttgtgattccaaccaacgagataacccagccgatcacatccatcaaactggagatagtgacctccaggagtggtggtcaggcaggggatcagatgtcatggtcggcaagtgggagcctagcagtgacgatccatggtggcaactatccaggggccctccgtcccgtcacactagtagcctacgaaagagtggcaacaggatctgtcgttacgctcgccggggtgagcaacttcgagctgatcccaaatcctgaactagcaaagaacctggttacggaatacggccgatttgacccaggggccatgaactacacaaaattgatactgagtgatggggaccgtcttggcatcaagaccgtctggccaacaagggagtacacagactttcgtgagtacttcatggaggtggccgacctcaactctcccctgaagattgcaggagcatttggcttcaaagacataatccgggccataagggacgtccc
- 2, the production method of crop according to claim 1 is characterized in that: carry out the preparation of gene recombination and recombinant protein, in process of production with the main immunogens gene of above-mentioned three kinds of viruses(1) inserts plasmid vector: adopt molecular biological method to carry and take out the nucleic acid RNA of virus, with containing promotor and terminator, the three pair primer amplified designed at different virus go out corresponding separately complete immunogen gene, the fragment two ends are restriction enzyme site (Xba I and sal I), cut expression vector and purpose fragment with corresponding restriction endonuclease, the T4 ligase enzyme connects reorganization, makes up recombinant plasmid separately;(2) change above-mentioned recombinant plasmid over to the plant corn, paddy rice, wheat, express in soybean and the rape, obtain the seed of transgenic plant: be with recombinant plasmid transformed agrobacterium tumefaciens C58C1 strain cell, in the LB that contains kantlex, cultivate, centrifugal collecting cell, resuspended in the MS nutrient solution that contains sucrose and L6-BA, again cultured plant stem-leaf is immersed vacuum infiltration in the resuspended liquid that contains the agrobacterium tumefaciens cell, the water flushing, deposit to maturation, with containing MS, the GM of sucrose and MES and the agar gel of kantlex screening monoclonal antibody bird flu respectively, the transgenic seed of newcastle disease or infectious bursal disease, perhaps wrap up golden bullet with recombinant plasmid, adopt the method for gene bombardment to transform, the monoclonal antibody bird flu will be carried respectively, the transgenic seed of newcastle disease or infectious bursal disease is cultivated when waiting to pollinate plant, adopt traditional hybridizing method with the monoclonal antibody bird flu, the plant of newcastle disease or infectious bursal disease hybridizes or three's hybridization in twos, obtains anti-avian influenza simultaneously, in three kinds of virus diseases of newcastle disease or infectious bursal disease any two kinds or three kinds of diseases are had simultaneously the transgenic seed of resistant function;(3) get the seed kind and go into soil, obtain can be used as roots of plants, stem, leaf, the fruits and seeds of feedstuff raw material.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN01125352A CN1333370A (en) | 2001-08-16 | 2001-08-16 | Crops capable of resisting virus diseases of poultry and production method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN01125352A CN1333370A (en) | 2001-08-16 | 2001-08-16 | Crops capable of resisting virus diseases of poultry and production method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1333370A true CN1333370A (en) | 2002-01-30 |
Family
ID=4665970
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN01125352A Pending CN1333370A (en) | 2001-08-16 | 2001-08-16 | Crops capable of resisting virus diseases of poultry and production method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1333370A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100410378C (en) * | 2005-05-09 | 2008-08-13 | 中国农业科学院生物技术研究所 | Coding hemaagglutinin gene of poultry influenza virus, plant expressing carrier and application thereof |
| CN101883856B (en) * | 2007-07-13 | 2013-10-30 | 麦迪卡格公司 | Influenza virus-like particles (VLPs) comprising hemagglutinin produced within plant |
-
2001
- 2001-08-16 CN CN01125352A patent/CN1333370A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100410378C (en) * | 2005-05-09 | 2008-08-13 | 中国农业科学院生物技术研究所 | Coding hemaagglutinin gene of poultry influenza virus, plant expressing carrier and application thereof |
| CN101883856B (en) * | 2007-07-13 | 2013-10-30 | 麦迪卡格公司 | Influenza virus-like particles (VLPs) comprising hemagglutinin produced within plant |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100393870C (en) | Vectors and cells for preparing immunoprotective compositions derived from transgenic plants | |
| US5484719A (en) | Vaccines produced and administered through edible plants | |
| CN104877993B (en) | Two kinds of plant eIF4A genes and its application for the water-fast cercosporiosis of rice poisonous plant body of prepare transgenosis | |
| US7964403B2 (en) | Preparation of vaccine master cell lines using recombinant plant suspension cultures | |
| US20050166290A1 (en) | Expression cassettes and methods for delivery of animal vaccines | |
| CN109628464A (en) | A method of increasing soybean yields | |
| Ling et al. | An interspecific Nicotiana hybrid as a useful and cost-effective platform for production of animal vaccines | |
| CN117417904A (en) | Newcastle disease virus vector vaccine strain for expressing C-type aMPV F protein and G protein and application thereof | |
| CN105969741A (en) | Recombinant Newcastle disease heat-resisting vaccine strain co-expressing HA and chicken interleukin 6 proteins of H9 subtype avian influenza virus and preparation method thereof | |
| CN100491535C (en) | Chuancao-II Laomangmai wheat pest-resisting gene transferring technology | |
| CN1333370A (en) | Crops capable of resisting virus diseases of poultry and production method thereof | |
| CN106399267A (en) | Recombinant turkey herpesvirus virus strain rHOH expressing H7N9 subtype avian influenza virus haemagglutinin protein and construction method | |
| CN100410378C (en) | Coding hemaagglutinin gene of poultry influenza virus, plant expressing carrier and application thereof | |
| CN113604440B (en) | BHK-21 cell line with Ago2 gene knockout function | |
| CN104312982A (en) | Duck plague virus recombinant vaccine strain rDEVTK-EGFP for expressing enhanced green fluorescent protein genes and constructing method and application therefore | |
| CN107641155A (en) | A kind of method of the recombinant Human Serum Albumin Expression in plant | |
| CN102127566B (en) | Genetic transformation method for artemisia annua | |
| CN108060141B (en) | VP2 gene and NP gene recombinant adenovirus and application thereof | |
| WO2001097839A1 (en) | Recombinant vaccines against infectious bursal disease virus | |
| CN101092624A (en) | Method for constructing gene of raining dual resistances of potato on PVX virus and PVY virus | |
| Zhu et al. | The construction of a duckweed expression and delivery system for grass carp reovirus VP35 | |
| CN1319670A (en) | Foot-and-mouth disease virus gene engineered vaccine of domestic animal and preparation process thereof | |
| CN102676546B (en) | Polymerase gene (PGENE) and method for expressing polymerase gene (PGENE) functional protein in tomato system | |
| CN1422665A (en) | Method for producing marker vaccinum of resisting mammal virus | |
| CN114644702B (en) | Tango protein, related biological material and plant breeding method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |