CN1333363A - Phytase gene sequence and application in yeast thereof - Google Patents

Abstract

The present invention relates to a coded phytase gene sequence suitable for secretion and expression in yeast and its application. It is mainly characterized by removing nucleotide sequence of +45-+146 bit from phy A total length structure gene sequence, removing Aspergillus niger signal peptide coded sequence of +1-+44 and +147-+159, connecting a part of signal peptide code sequence suitable for secretion and expression at 51 end and connecting a restriction endonuclease site at 3' end. The different carriers can be connected into said gene sequence so as to form recombinant plasmid with different functions and after the recombinant plasmid using pPICZ alpha A as carrier is converted into Pasteur Pichia yeast, finally the invented Pasteur Pichia yeast engineering bacterium (CCTCC NO:M200005) can be obtained through the screening process. By using said invention the industrial process of phytase bio-expression can be successfully implemented.

Description

A kind of phytase gene sequence and the application in yeast thereof

The present invention relates to a kind of phytase gene sequence and application of the expression in yeast thereof of phyA total length structural gene sequence being transformed back formation.

Phosphorus is the essential important minerals of vital movement such as animal growth, constitutes bone and tooth with calcium in animal body, and also the form with phosphate radical participates in the organism metabolism activity, as oxidative phosphorylation, the synthetic carbohydrate metabolism etc. that reaches of DNA, RNA.

Phytic acid (also claiming inositol hexaphosphate) or phytate extensively are present in the plant materials, in the seed, are the principal modes of plant storage phosphorus especially, have the phosphorus of 50%-80% to have (seeing Table 1) with the phytate phosphorus form in vegetality feedstuff.Monogastric animal (pig, chicken, fish etc.) lacks the endogenous phytase, thereby very low to the utilization ratio of phytate phosphorus in the feed diet, must add inorganic phosphorus (as secondary calcium phosphate) and could satisfy the demand of its normal growth growth to phosphorus.Simultaneously, the phytate phosphorus in the feed excretes with ight soil, causes a large amount of wastes of phosphorus and to the severe contamination at soil and water source, this problem is higher in intensive farm density, and resource comparatively poor area in water and soil ground is particularly outstanding.

In addition, phytic acid can combine with calcium, magnesium, phosphorus, copper, zinc, manganese plasma and form stable complex compound, reduces these ionic digestibilitys, also can suppress digestive enzyme activity, influences digesting and assimilating of animal.Therefore, phytic acid also is considered to the antinutritional factor in the feed.

Table 1: total phosphorus reaches the wherein content of phytate phosphorus in the main feedstuff raw material

(" zootechnics " the 4th edition, Jilin science tech publishing house published in 1999.Abreviation is arranged.)

Feedstuff raw material title total phosphorous (%) phytate phosphorus/total phosphorus (%)

Corn 0.28 69.6

Barley 0.37 63.9

Wheat 0.35 71.4

Jowar 0.17 55.7

Soybean cake 0.59 41.0

Cotton seed cake 1.05 59.5

Rapeseed cake 0.84 62.8

Rice chaff 1.78 75.7

Wheat bran 1.02 72.7

Phytase (E.C.3.1.3.8) can the hydrolysis phytic acid or phytate discharge phosphate group, theoretic catalyzed reaction is as follows:

In feed, add the utilization ratio that phytase can improve phosphorus in the plant feed, reduce the drainage of phosphorus in the fecaluria, reduce the anti-oxidant action of phytate phosphorus, promote animal growth, reach and improve the livestock industry productivity effect, reduce less environmental contamination, these effectiveness (reference: Ware and Shieh that in worldwide, is confirmed, (1967) USPatent 3,297, and 548; Nelson, et al., (1971) J.Nutrition 101:1289-1294; Graf, E.ed., (1986) " PhyticAcid:Chemistry and Applications " Pilatus Press, Minneapolis, MN, Chapter 2, pp.23-42; Lei, XG., et al., (1993) J.Nutr.123 (6): 1117-1123; Lei, XG., et al., (1993) J.Anim.Sci.71 (12): 3359-3367; Lei, XG., et al., (1994) J.Anim.Sci.72 (1): 139-143; Cromwell, GL., et al., (1995) J.Anim.Sci.73 (2): 449-456; Adeola, O., et al., (1995) J.Anim.Sci.73 (11): 3384-3391; Cromwell, GL., et al., (1995) J.Anim.Sci.73 (7): 2000-2008; Han, YM., et al., (1997) J.Anim.Sci.75 (4): 1017-1025).

Phytase can directly or indirectly be used for people's nutrient drug or foodstuff additive, prepares purposes such as inositol at the industrial enzymolysis process that can also be used for.But also find at present to adopt the application of phytase that genetic engineering technique designs and synthesizes in above-mentioned field.

Discover that a large amount of natural microbials can both produce the justacrine phytase, comprise bacterium, yeast, filamentous fungus etc., but the amount of these natural microorganisms secretion of phytase is few, with its production bacterial classification as phytase, cost height, yield poorly, be difficult to realize suitability for industrialized production.

Genetic engineering technique is the effective way that realizes the phytase great expression, aspect the microbial phytase gene cloning and expression, have much and successfully report, the clone of fungi phytase gene wherein, expression study is many especially, the filamentous fungus that has cloned phytase gene comprises: Aspergillus niger, Asp.niger var.awamori, Asp.fumigatus, Emericella nidulans, Talaromyces thermophilus, (reference: Mullaney such as Asp.terreus and Myceliophthora thermophila, E.J., et al., (1991) Appl.Microbiol.Biotechnol.35,611-614; VanGorcom, R.F.M., et al., (1993) Gene 127:87-94; Piddington, C.S., et al., (1993) Gene133 (1), 55-62; Pasamontes, L., et al., (1997) Appl.Environ.Microbiol.63 (5): 1696-1700; Pasamontes, L., et al., (1997) Biochim.Biophys.Acta 1353 (3), 217-223; Mitchell, DB., et al., (1997) Microbiology 143 (Pt 1), 245-252; Kerovuo, J., et al., (2000) Lett.AppL Microbiol.30 (4): 325-329; Han, Y, et al., (1999) Appl.Environ.Microbiol.65 (5): 1915-1918.Berka, RM., etal., (1998) Appl.Environ.Microbiol.64 (11): 4423-4427).

These phytase genes of cloning from different microorganisms have all carried out expression study, and strategy commonly used is with cloned genes or transforms or be directly used in expression study slightly, and expressive host usually is former bacterial classification, and heterogenous expression research is also few.Because the difference of gene and expression system, expression amount is also variant.According to present relevant, the phytase gene of in the pichia pastoris phaff cell, expressing, have from microorganisms such as Aap.niger, Asp.fumigatus and Selenomonas ruminantium, enzyme activity is (reference: Yao Bin etc., (1998) Chinese patent application number: 97121731.9 between 10～65U/mL; Cheng, et al. (1999) US Patent:5,985,605; Hah Y, et al., (1999) Arch Biochem.Biophys.364 (1): 83-90), yet there are no the expression study of synthetic phytase gene in the pichia pastoris phaff cell.

PhyA total length structural gene sequence is from aspergillus niger NRRL3135 (reference: vanHartingsveldt among the present invention, W., et al., (1993) Gene 127 (1): 87-94), with the production bacterial classification of aspergillus niger NRRL3135 as phytase, yield poorly, the fermentation broth enzyme vigor is 0.2U/mL only, is not suitable for suitability for industrialized production.The development of modern biotechnology has made the acquisition of gene, external transformation very convenient, fast, by external design, the modification to black mold NRRL3135 phytase gene sequence, makes it be more suitable for expressing in pichia pastoris phaff; Structure, conversion and the expression screening of, recombinant expression vector synthetic by gene can obtain to efficiently express the pichia yeast genetic engineering bacteria of phytase, for large-scale industrialization fermentative production phytase provides the basis.

First purpose of the present invention provides a kind of phytase sequence that can use at yeast.

Second purpose of the present invention provides the recombinant plasmid corresponding to the said gene sequence.

The 3rd purpose of the present invention provides a kind of yeast gene engineering bacteria that adopts said gene sequence, recombinant plasmid and form.

The 4th purpose of the present invention provides a kind of screening method of pichia pastoris phaff genetic engineering bacterium of energy effective expression phytase.

The 5th purpose of the present invention provides the pichia pastoris phaff genetic engineering bacterium (CCTCC NO:M200005 is preserved in Wuhan University China typical culture collection center) of the high level expression phytase of taking the aforesaid method acquisition.

The 6th purpose of the present invention provides above-mentioned engineering bacteria through fermentation culture, the gene engineering phytase of methanol induction expression-secretion.

First purpose of the present invention is achieved in that removes+45～+ 146 nucleotide sequence in phyA (phytase gene of A.niger NRRL3135) total length structural gene sequence, remove+1～+ 44, + 147～+ 159 aspergillus niger signal coding sequence, connect one section signal coding sequence that is suitable for secreting, expressing in yeast at 5 ends, connect a restriction endonuclease sites at 3 ends.1506 Nucleotide (see figure 1)s of natural A .niger NRRL3135 bacterial strain phyA structure gene total length, 102 nucleotide sequences wherein+45～+ 146 are typical fungi intron sequences, the feature conserved sequence of fungi intron are arranged: Donor sequence GTATGC, Lariat sequence GCTGAC and Acceptor sequence C AG on it.467 amino acid (see figure 2)s of phyA genes encoding, 19 amino acid of N end are signal peptide, the cleavage site of signal peptide is after the 19th Gly, its avtive spot sequence (Active-site sequence): CRVTFAQVLSRHGARYPTDSKGK, wherein RHGARYPT is a most conservative sequence (reference: van Hartingsveldt in the microbe-derived phytase activity site, W., et al., (1993) Gene127 (1): 87-94; UllahAH, et al., (1993) Biochem Biophys Res Commun 192 (2): 754-759; Ullah AH, etal., (1995) Ann N Y Acad Sci750:51-57; ).If+45～+ 146 nucleotide sequence is not removed, yeast possibly can't carry out the excision of intron sequences when transcribing this gene, this sequence can be translated as aminoacid sequence, to cause its expressed phytase protein sequence different like this, the phytase afunction with the mature peptide sequence of natural phytase.If do not excise+1～+ 44, + 147～+ 159 signal coding sequence, yeast when expressing this gene, can not discern this sequence encoding aspergillus characteristic signal peptide and on cleavage site, the peptide section that this sequence can be translated remains in the end product, cause its expressed phytase protein sequence different, cause the forfeiture of phytase function with the mature peptide sequence of natural phytase.In phyA total length structural gene sequence, remove+1～+ 44 ,+45～+ 146 ,+147～+ 159 sequences can't influence the aminoacid sequence of phyA mature peptide.Simultaneously, for this phytase albumen of secreting, expressing in yeast, must add the signal coding sequence that the preceding paragraph is suitable for secreting, expressing in yeast at 5 of phytase mature polypeptide coding sequence ' end.For convenience this sequence clone is gone into suitable expression vector, also should introduce restriction enzyme at 5 of this sequence ' end, 3 ' end and cut site (for example: KpnI, XhoI).

Such scheme of the present invention can be done further perfect:1. add the signal peptide part that is adapted at secreting, expressing in the pichia spp, encoding sequence is:GAATTCTCGAGAAAAGAGAGGCTGAAGCT.2. introduce the single endonuclease digestion site at 5 of this sequence ' end, 3 ' end, for example:KpnI, XhoI.3. codon that will frequency of utilization is low in pichia spp replaces with the high codon of frequency of utilization.As signal coding sequence, the signal peptide part encoding sequence in pichia pastoris phaff with:GAATTCTCGAG AAAAGAGAGGCTGAAGCT for well.Since have in the phyA gene mature polypeptide coding sequence many in pichia pastoris phaff the lower codon of frequency of utilization, if do not do the change of codon, pichia pastoris phaff possibly can't the correct translation phytase gene, therefore should the codon that frequency of utilization is lower in the pichia spp in the phytase mature polypeptide coding sequence be replaced with the higher codon of frequency of utilization, a kind of replacement codon scheme of the present invention is seen Fig. 5 as far as possible. are by increase and decrease, replace; ,：GAATTCTCGAGAAAAGAGAGGCTGAAGCTCTGGCAGTCCCAGCCTCTAGAAATCAATCCTCTTGTGATACTGTCGATCAGGGTTATCAATGTTTCTCCGAGACTTCTCATCTTTGGGGTCAATACGCACCATTCTTCTCTCTGGCAAACGAATCTGTCATCTCCCCTGAGGTGCCAGCCGGATGTAGAGTCACTTTCGCTCAGGTCCTTTCCAGACATGGAGCTAGATATCCAACCGACTCCAAGGGTAAGAAATACTCCGCTCTTATTGAGGAGATCCAGCAGAACGCTACCACCTTTGACGGAAAATATGCCTTCCTGAAGACATACAACTACTCTTTGCGTGCAGATGACCTGACTCCATTCGGAGAACAGGAGCTTGTCAACTCCGGTATCAAGTTCTACCAGAGATACGAATCTTTGACAAGAAACATCGTTCCATTCATCAGATCCTCTGGTTCCTCTAGAGTTATCGCCTCCGCTAAGAAATTCATCGAGGGTTTCCAGAGCACTAAGCTGAAGGATCCTAGAGCCCAGCCAGGTCAATCTTCTCCAAAGATCGACGTTGTCATTTCCGAGGCCTCTTCATCCAACAACACTCTTGACCCAGGTACTTGTACTGTCTTCGAAGACTCTGAATTGGCCGATACTGTCGAAGCCAATTTCACTGCCACTTTCGTCCCATCCATTAGACAAAGACTGGAGAACGACCTGTCCGGTGTTACTCTTACTGACACTGAAGTTACTTACCTTATGGACATGTGTTCCTTCGACACTATCTCCACTTCTACCGTCGACACCAAGCTGTCCCCATTCTGTGACCTGTTCACCCATGACGAATGGATCAACTACCACTACTTGCAGTCCTTGAAAAAGTATTACGGTCATGGTGCAGGTAACCCATTGGGTCCAACCCAGGGTGTCGGTTACGCTAACGAGTTGATCGCCAGACTGACCCACTCTCCTGTCCACGATGACACCTCTTCCAACCACACTTTGGACTCTTCTCCAGCTACCTTTCCATTGAACTCTACTTTGTACGCTGACTTTTCTCATGACAACGGTATCATCTCCATTTTGTTTGCTTTAGGTCTGTACAACGGTACTAAGCCATTGTCTACCACTACCGTTGAGAATATCACCCAGACAGATGGATTCTCTTCTGCTTGGACTGTTCCATTTGCTTCTAGATTGTACGTCGAGATGATGCAGTGTCAGGCTGAGCAGGAGCCACTGGTCAGAGTCTTGGTTAATGATAGAGTTGTCCCACTGCATGGTTGTCCTGTTGATGCTTTGGGTAGATGTACCAGAGATTCTTTTGTTAGAGGTTTGTCTTTTGCTAGATCTGGTGGTGATTGGGCTGAGTGTTTTGCTTAAGGTACC。

The above-mentioned sequence of the present invention constitutes recombinant plasmid with pPICZ α A as carrier can transform pichia pastoris phaff effectively, obtains the pichia pastoris phaff genetic engineering bacterium of Expressing Recombinant Phytase.

The designed phytase gene sequence of foregoing invention is compared with the original mature polypeptide coding sequence of having reported of A.niger NRRL3135 phytase, and the difference of 152 Nucleotide is arranged, and homology is 88.7% (see figure 5).With the A.niger963 phytase gene phyA2 that has reported (Yao Bin, Fan Yunliu, Wang Jianhua etc., 1998, Chinese science (C seizes) 28 (3): 237-243) compare, aspect Nucleotide, the difference of 123 Nucleotide is arranged, homology is 91.8%; Aspect amino acid, 39 amino acid differences are arranged, homology is 91.6%; On glycosylation site, on the designed phytase gene proteins encoded of the present invention 10 potential glycosylation sites are arranged, and phyA2 there are 9, wherein 8 positions are identical.Conserved sequence is RHGARYPT in the designed phytase gene phytase activity site of the present invention.

The designed phytase gene of the present invention can obtain by PCR synthetic method: at first according to 19 pairs of primers of phytase gene sequences Design, the tumor-necrosis factor glycoproteins of average 20nt is arranged between the every pair of primer.Synthetic 19 pairs of primers, again with difference to primer by dna polymerase reaction (chain extension reaction and PCR react), enzyme is cut and ligation etc. finally synthesizes total length phytase gene (seeing Fig. 6～11).

Work such as synthetic, the synthetic total length phytase gene of PCR method of primer can be finished by special biotech company or mechanism among the present invention.Similar thinking can be used to transform phytase gene or other genes too, and it is expressed in other expression system, as by the insect expression system of baculovirus, mould expression system, plant expression system etc.

Second purpose of the present invention is achieved in that by the restriction enzyme site at 5 ' end and 3 ' end the function sequence connected into carrier.Owing to added restriction endonuclease sites when gene design, the synthetic phytase gene can connect into carrier with the function sequence by the restriction enzyme site at 5 ' end and 3 ' end.

Above-mentioned phytase gene can be formed following recombinant plasmid: connect into Yeast expression carrier by the phytase gene sequence of will encoding at the restriction enzyme site of 5 ' end and 3 ' end.Can express by the controllable high-efficiency in yeast in order to make the phytase synthetic gene, select pichia pastoris phaff expression vector (the pPICZ α A for example of the promotor AOXI that has alcohol oxidase gene (AOX) for use, American I nvitrogen company), utilize the KpnI restriction endonuclease sites of XhoI restriction endonuclease sites and the 3 ' end of phytase synthetic gene sequence 5 ' end, this phytase synthetic gene is cloned into carrier pPICZ α A (seeing Figure 12,14).Owing to before the phytase mature polypeptide coding sequence, added part signal peptide-coding sequence, part signal peptide-coding sequence among this sequence and the carrier pPICZ α A merges, thereby constitute complete signal peptide-coding sequence, and form correct reading frame, for the correct secreting, expressing of phytase gene in yeast laid a good foundation.The pichia pastoris phaff expression vector is preferable selection with pPICZ α A.

Above-mentioned phytase gene can be formed following recombinant plasmid: by the restriction enzyme site at 5 ' end and 3 ' end the function sequence is connected into bacteria carrier pBlueScript, form the recombinant vectors (seeing Figure 12,13) that contains the phytase synthetic gene.This recombinant vectors can transformed into escherichia coli, because recombinant plasmid contains Amp ⁺Resistant gene is by screening Amp ⁺Positive colony can obtain to contain the intestinal bacteria of recombinant plasmid; Although recombinant plasmid can not the Expressing Recombinant Phytase gene in intestinal bacteria, can obtain a large amount of recombinant plasmids by colibacillary fast breeding, utilize restriction endonuclease that phytase gene is separated when needed, as expression study or other purposes.

The 3rd purpose of the present invention is achieved in that goes into pichia pastoris phaff (Pichiapastoris) with recombinant plasmid transformed.Patent (US Patent:5436156,1995 of preferred pichia pastoris phaff expression system of the present invention and Van Gorcom etc.; US Patent:5863533,1999) the host bacterium Asp.niger that is adopted compares, and a lot of advantages are arranged.The first, the growth and breeding period ratio pichia spp of mould is long a lot; Second, the the nourishing and growing of mould is what the elongation growth by the mycelium tip realized, this growth characteristics especially are fit to solid culture, and and be not suitable for the liquid state fermentation that modern zymotechnique is used always, generally speaking the solid fermentation work efficiency is low, cycle is long, the cost height, and the liquid state fermentation that the cost that obtains the bulk fermentation product is compared will increase a lot.By contrast, pichia spp is by the fragmentation body that has additional nutrients, the very suitable liquid state fermentation of this reproductive characteristic; The 3rd, the mould nourishing body needs to provide enough complicated carbon nitrogen organic nutrients during growing, this also can increase fermentation costs, grow main utilize cheap simple nutrient such as methyl alcohol, glucose and the ammoniacal liquor etc. of pichia spp nourishing body obtain cheap many of nutrient that the nourishing body pichia spp of isodose consumes than mould.Zymic high-cell density, low-cost fermentation process are set up (Siegel RS., Biotechnol.Bioeng, 34:403-404,1989), and employed carbon source, nitrogenous source, salt, trace element and vitamin H etc. are all very cheap in the fermention medium; The 4th, the distinctive musty of mould can reduce the palatability of livestock, and a kind of sauce fragrance that the pichia spp fermentation produces has good food calling effect; The 5th, pichia spp contains the organic compound of multiple a large amount of promotion growth, as oligose, Nucleotide, each seed amino acid, small peptide etc., these advantages all be mould less than or do not have; The 6th, in eukaryotic expression system, yeast comprises that pichia spp studies the most detailedly beyond doubt, and yeast is more easier than mould, convenient and effectively during the conducting molecule biologic operation.Yeast successfully efficiently expresses out the exogenous genes products of many biologically actives as a kind of good eukaryotic expression system.Seven, pichia spp itself has good security, the widespread use of Ceng Zuowei single cell protein, do not contain Toxic matter and pyrogen in the yeast culture base, so the phytase of expression of recombinant yeast just can directly add in the feed with the form of yeast culture without separation and purification, can reduce the production cost of phytase; Eight, the phytase of Biao Daing can be secreted under the guiding of signal peptide in the substratum, and this directly comes out phytase and need not broken yeast thalline, also may for the yeast culture that comprises phytase is directly provided as fodder additives; More than these advantages all be to utilize Asp.niger as phytase expressed receptor (Van Gorcom R.F.M.et al., US Patent:5436156,1995; US Patent:5863533.1999) not available, it is for utilizing the recombination yeast large-scale industrialization, hanging down into wooden fermentative production phytase and decided the basis.

The recombinant expression plasmid pPICZ α A that contains the phytase synthetic gene that the present invention adopts can transformed yeast, become the function yeast of energy secreting, expressing external source phytase: owing to the partial sequence that pichia pastoris phaff AOX gene is arranged on the recombinant expression plasmid pPICZ α A that contains synthetic gene, after recombinant expression plasmid enters yeast cell, by homologous recombination in the body, pPICZ α A can directional integration to the pichia pastoris phaff genomic dna.Under the condition that exogenous induction material methyl alcohol exists, the AOXI promotor starts the expression of phytase synthetic gene, and signal peptide can instruct expression product to enter the zymic Secretory Pathway, correct cutting, and the exogenous protein expression product-phytase of biologically active is finally secreted to born of the same parents.

Before containing the recombinant expression plasmid pPICZ α A conversion pichia pastoris phaff of phytase synthetic gene, need cyclic recombinant expression plasmid pPICZ α A endonuclease digestion is made it linearizing.Different expression plasmids, different restriction enzyme sites can be selected different restriction endonucleases.The present invention digests recombinant expression plasmid pPICZ α A with restriction endonuclease SacI, and whether the electrophoresis detection enzyme is cut complete, and purifying reclaims complete linearizing recombinant expression plasmid pPICZ α A, and-20 ℃ of preservations are standby.

Electrization or chemical transformation are often adopted in the conversion of pichia pastoris phaff, prepare recipient bacterium (P.pastoris wild type strain X-33), with 50～80 μ l recipient bacteriums and 5～90 μ g linearizing recombinant expression plasmid DNA mixings, electricity swashs (voltage: 1500V: electric capacity: 25 μ F; Resistance: 200 Ω) handle, screen recon then.

Contain the recombinant plasmid pBlueScript of phytase synthetic gene or toolenzyme that pPICZ α A need use and carrier, expression system etc. in the foregoing invention, all have special biotech company that (as: U.S. Promega company, Japanese TaKaRa company, American I nvitrogen company etc.) is provided.Construction process, detailed step also have special specification sheets introduction.

The 4th purpose of the present invention is achieved in that the screening method of transgenic engineered bacteria among the present invention is at phenotypic screen (Zeo ⁺Mut ^-) the basis on, carry out the functional screening that phytase is expressed by enzyme activity determination.It is characterized in that: with series concentration inorganic phosphorus and the absorbancy (OD under vanadium molybdenum developer thereof ₄₁₅) set up typical curve, calculate the enzyme activity (U/mL) of fermented liquid under same reaction system, same reaction conditions according to typical curve, screen.Originally have Zeocin resistant gene and AOXI promoter sequence on the expression vector pPICZ α A, when the recombinant expression plasmid that contains phytase gene transform enter pichia pastoris phaff and to recombinate to the karyomit(e) after, this transgenic engineered bacteria promptly obtains the resistance to Zeocin, because reorganization occurs in the AOX gene locus, make the AOX gene inactivation, can not utilize methyl alcohol.By phenotypic screen (Zeo ⁺Mut ^-) just can preliminary screening go out positive recombinant.In order to confirm that the synthetic phytase gene is integrated and expression, further measure the phytase vigor that positive recombinant is induced fermented liquid.The enzyme activity of phytase is by being determined under certain reaction conditions in the fermented liquid, and the inorganic phosphorus amount that is discharged in the reaction system is represented.The definition of a phytase activity unit of force is: at 37 ℃, under the condition of pH5.5, per minute discharges the needed enzyme amount of 1 μ mol inorganic phosphorus from the 8.4g/L sodium phytate solution.

The enzyme activity determination method of phytase is as follows:

(1) with series standard concentration inorganic phosphorus solution and the absorbancy (OD under vanadium molybdenum developer thereof ₄₁₅) set up typical curve, form and typical curve calculating enzyme activity (U/mL) according to reaction system.Phytic acid and phytate discharge inorganic phosphorus under the effect of phytase, by acid vanadium-molybdate reagent and inorganic phosphorus generation color reaction, generate yellow compound ((NH ₄) ₃PO ₄NH ₄Vo ₃16MoO ₃), under the 415nm wavelength, carry out colorimetric.With the standard inorganic phosphorus is object of reference, phytase vigor in the indirect calculation sample.Required reagent: 0.25mol/L acetate-sodium acetate buffer (pH5.5); 65% (W/W) HNO ₃35% (W/W) H ₂O; 4mol/L acetate; 25% (W/W) ammoniacal liquor; 0.84% (W/W) sodium phytate solution (pH5.5); 10% (W/W) ammonium molybdate solution; 0.235% (W/W) Ammonium Vanadate Solution; The composition of C/T stop buffer: ammonium molybdate solution: Ammonium Vanadate Solution: 65%HNO ₃: H ₂O=50: 50: 33: 67, matching while using; KH with 30ug/ml ₂PO ₄Solution is as the mother liquor of serial dilution.

Prepare following color reaction system:

Test tube numbers 123456

30ug/ml KH ₂PO ₄Solution (ml) 012345

H ₂O(ml) 6 5 4 3 2 1

C/T stop buffer (ml) 444444

OD ₄₁₅Value ^※-0.001 0.146 0.298 0.447 0.600 0.73

The phosphorus content (μ mol) 0.9606 1.9372 2.9057 3.8743 4.8428 5.8114 that converts

^※Linear regression analysis, relation conefficient are 0.9993863.

(2) Zeo ⁺Mut ^-The enzyme activity determination of recon fermented liquid.Get the supernatant liquor that 0.5ml induces fermentation, optionally dilute 10～3000 times, get the 2mL diluent, join 4mL and be preheated in 37 ℃ the sodium phytate solution, reaction 15min adds C/T liquid termination reaction and the colour developing of 4mL again.Control group is except that C/T liquid adds when reaction rises the beginning, and all the other are identical with experimental group.Make blank with control group, measure each Zeo ⁺Mut ^-Recon OD ₄₁₅Value is obtained the phosphorus content (μ mol) of reaction system according to regression equation, calculates enzyme activity according to following formula again:

Enzyme activity (U/mL)=(the ÷ T ÷ V of A * D)

[A:P content (umol); D: extension rate; T: the reaction times (unit: minute); V: the diluent that adds in the system (unit: ml)]

The 5th purpose of the present invention provides the pichia pastoris phaff genetic engineering bacterium (CCTCC NO:M200005 is preserved in Wuhan University China typical culture collection center) of the high level expression phytase of taking the aforesaid method acquisition.It is characterized in that: below 210 hours, the phytase vigor of engineering bacterium fermentation liquid can reach 0～250U/mL (surpass 210 hours, enzyme activity improves little, sees Figure 18) through methanol induction; Methanol concentration is that 0.25～0.75% (effect is better in 0.25～0.75% scope, concentration unit is volume ratio W/W), the inducing culture condition is to shake bottle rotating speed a 230～250rpm/min (the strong oxygen consumption of the growth of pichia pastoris phaff, the maximum speed of common shaking table is generally 250rpm/min, be lower than 230rpm/min and may influence growth), 28～30 ℃ of culture temperature (pichia pastoris phaff is lower than 28 ℃ of poor growths, is higher than 30 ℃ of then death).Through methanol induction 72 hours, fermented liquid phytase vigor can reach 150～165U/mL; Induced 210 hours, fermented liquid phytase vigor reaches 250U/mL.The present invention adopts above-mentioned phenotypic screen method to obtain 85 strain Zeo altogether ⁺Mut ^-Recon, through enzyme activity determination, recon all has enzyme activity, the results are shown in Table 2.

The phytase activity power measurement result (enzyme activity: the U/ml fermented liquid) of table 2:85 strain recon

Numbering enzyme activity numbering enzyme activity numbering enzyme activity numbering enzyme activity

SPAN-1 32 SPAN-2 42 SPAN-3 46 SPAN-4 64

SPAN-5 46 SPAN-6 59 SPAN-8 39 SPAN-9 54

SPAN-10 72 SPAN-III 165 SPAN-12 41 SPAN-13 80

SPAN-14 101 SPAN-15 79 SPAN-16 93 SPAN-17 65

SPAN-18 34 SPAN-19 83 SPAN-20 91 SPAN-21 81

SPAN-22 94 SPAN-23 69 SPAN-24 31 SPAN-25 87

SPAN-26 66 SPAN-27 69 SPAN-28 57 SPAN-29 86

SPAN-30 61 SPAN-31 74 SPAN-32 54 SPAN-33 82

SPAN-34 31 SPAN-35 56 SPAN-36 45 SPAN-38 34

SPAN-39 83 SPAN-40 32 SPAN-41 17 SPAN-42 43

SPAN-43 68 SPAN-44 26 SPAN-45 44 SPAN-46 37

SPAN-47 56 SPAN-48 64 SPAN-49 65 SPAN-50 55

SPAN-51 66 SPAN-52 76 SPAN-53 64 SPAN-54 68

SPAN-55 65 SPAN-56 41 SPAN-57 39 SPAN-58 69

SPAN-60 54 SPAN-71 76 SPAN-72 50 SPAN-73 41

B-1 17 B-3 74 B-4 62 B-5 91

B-6 79 B-7 63 B-8 37 B-9 20

B-10 53 B-11 69 B-12 67 B-13 49

B-14 62 B-15 79 B-16 52 B-17 43

B-18 6 B-19 56 B-20 65 B-21 44

B-22 65 B-25 23 B-26 52 B-27 58

B-28 20

The 6th purpose of the present invention provides CCTCC NO:M200005 engineering bacteria through fermentation culture, the gene engineering phytase of methanol induction expression-secretion.The said gene engineering bacteria is through liquid fermentation and culture, methanol induction, and the synthetic gene expression of coding phytase also is secreted into phytase in the fermented liquid.Recombinant phytase engineering strain provided by the invention can produce phytase albumen with the simple substratum of composition on shaking table through fermenting, inducing.Concrete grammar is: (1) actication of culture: the pichia pastoris phaff genetic engineering bacterium (CCTCC NO:M200005) that the inclined-plane is preserved is inoculated in the YPD flat board, and 30 ℃ leave standstill cultivation 36～48 hours.(2) enlarged culturing: activated spawn is inoculated in the YPD liquid nutrient medium of 5mL, and 28～30 ℃, 230～250 rpm/min water-baths concussion was cultivated 16～18 hours; 5mL bacterium liquid is inoculated in the YPD liquid nutrient medium of 45～95mL, and 28～30 ℃, 230～250rpm/min water-bath concussion was cultivated 24 hours.Take out bacterium liquid, staticly settle 20min (or the centrifugal 10min of 3000rpm/min) under the room temperature, remove supernatant liquor, add equal-volume MMY substratum resuspension thalline.(3) inducing culture: resuspension bacterium liquid adds methyl alcohol by 0.25～0.75% (V/V), and 28～30 ℃, 230～250rpm/min water-bath concussion inducing culture was gone into methyl alcohol by 0.25～0.75% (V/V) in later per 12 hours.72 hours results bacterium liquid, the centrifugal 15min of 3000rpm/min, supernatant liquor is used for enzyme activity determination.Pichia pastoris phaff genetic engineering bacterium (CCTCC NO:M200005) in the YPD substratum, 30 ℃, under 230～250rpm/min circulation shaking culture condition, cultivate after 18～20 hours, cell concentration can reach 1～9 * 10 ⁹Cfu/Ml (seeing Figure 17), after changing the MMY nutrient solution, carry out inducing culture, engineering bacteria (CCTCC NO:M200005) is shaking under bottle inducing culture condition, enzyme activity reached the 165U/Ml fermented liquid in 72 hours: inducing culture 210 hours, enzyme activity are still at rise (seeing Figure 18).

Measure the phytase activity in the fermented liquid under different pH condition, the result shows, the optimal pH 5.5 of phytase in the fermented liquid also has enzyme peak (seeing Figure 19) alive when pH2.5.In pH2～6 scopes, phytase all can be kept higher enzymic activity.

Measure the enzymic activity of the phytase of fermented liquid under condition of different temperatures, the result shows that the optimum temperuture of phytase is 55 ℃ (seeing Figure 20).The optimal pH of phytase is compared not significant difference with optimum temperuture in the fermented liquid with the phytase that former strains A .nigerNRRL3135 is produced.

The above results shows that the phytase gene through manually designing and synthesizing is integrated in the pichia pastoris phaff genomic dna, efficiently express out and the close zymoprotein of natural phytase character.

Overall procedure of the present invention is as 21.

In sum, the phytase total length structure gene phyA that (1) the present invention is directed to A.nigerNRRL3135 carries out the artificial reconstructed of gene, and having removed influences this gene correct intron sequences, signal peptide sequence of expressing in yeast; The signal peptide sequence and the restriction endonuclease sites of yeast secreted expression have been increased; Improved phytase gene sequence can correctly be transcribed in yeast, accurate translation phytase justacrine is to fermented liquid.

(2) on the basis of the above, designed at the selected expressive host pichia pastoris phaff of the present invention and can make phytase gene secrete part signal peptide sequence to born of the same parents.Can form correct reading frame with expression vector when making up recombinant expression plasmid, phytase gene can be secreted to born of the same parents; Simultaneously, according to the preference degree of pichia pastoris phaff to genetic code, the phytase structure gene of A.nigerNRRL3135 has been carried out partial password replaces, be used in codon that the pichia pastoris phaff medium-high frequency uses and replaced low frequency codon in the former sequence, improved gene order can correctly be expressed in pichia pastoris phaff.

Through above-mentioned transformation, produced one can be correct in pichia pastoris phaff, efficiently express the phytase gene sequence of justacrine to born of the same parents.

(3) synthesize this phytase gene sequence by PCR, adopt expression vector pPICZ α A, further construct and contain this phytase synthetic gene and the recombinant expression plasmid that can in pichia pastoris phaff, integrate, express.

(4) recombinant expression plasmid is transformed pichia pastoris phaff, obtain the pichia pastoris phaff genetic engineering bacterium of a series of Expressing Recombinant Phytase.

(5), obtain the engineering strain CCTCCNO:M200005 of a plant height efficient expression phytase synthetic gene by screening to above-mentioned engineering strain.

(6) related properties to the product enzyme characteristic under the engineering strain CCTCC NO:M200005 conditions of flask fermentation and institute's phytase generating studies show that, the engineering strain CCTCC NO:M200005 enzymatic productivity that the present invention obtains is better than present similar research, the similar natural phytase of phytase character of expressing can be widely used in fodder additives, food and medicine field.

The phytase total length structural gene sequence of description of drawings: Fig. 1, A.niger NRRL3135 (the small letter English alphabet is represented intron sequences,

The sequence of underscore is represented intron donor, Iariat and acceptor sequence successively in the intron sequences).The aminoacid sequence of Fig. 2, A.niger NRRL3135 phytase (vertical arrows expression signal peptide cleavage site; At amino

The expression potential glycosylation site of acid N underscore; Aminoacid sequence adds frame table and shows phytase activity site preface

Row).Fig. 3, a kind of phytase gene sequence of the present invention.The gene order of Fig. 4, Fig. 2 of the present invention and amino acid sequence corresponding.[the original mature peptide gene of Query:phyA is compiled in the comparison of the original mature peptide gene order of Fig. 5, phyA and Fig. 2 gene order

The sign indicating number sequence, Sbjct: Fig. 2 gene coded sequence (codon of transformation all marks)].The synthetic synoptic diagram of Fig. 6, Fig. 2 gene order (" ← " forward primer: " → " reverse primer).The base sequence of Fig. 7,19 pairs of primers (F represents forward primer, and R represents reverse primer).The base sequence of Fig. 8, segment A1～C1.The base sequence of Fig. 9, segment A2～C2.The base sequence of Figure 10, segment A3～C3.Figure 11 A, the full-automatic sequencer map of synthetic phytase gene (YL03-67T3 segment, the beginning of 5 ' end).Figure 11 B, the full-automatic sequencer map of synthetic phytase gene (YL03-67F segment, the beginning of 3 ' end).Figure 11 B, the full-automatic sequencer map of synthetic phytase gene (YL03-67 YL03SP segment, the beginning of 5 ' end).Figure 12, construction of recombinant vector synoptic diagram.The recombinant plasmid pBlueScript electrophorogram that contains synthetic phytase gene among Figure 13, Figure 12.The recombinant expression plasmid pPICZ α A electrophorogram (I: molecular weight marker that contains synthetic phytase gene among Figure 14, Figure 12; II:pPICZaA empty plasmid XhoI, KpnI double digestion electrophoresis result; III:pPICZaA recombinant plasmid XhoI, KpnI double digestion electrophoresis result; (the synthetic phytase gene fragment that shows size about 1.4kb); IV: molecular weight marker).The PCR of phytase gene detects [I: molecular weight marker among Figure 15, the pichia pastoris phaff genetic engineering bacterium CCTCC NO:M200005; II: the P.pastoris yeast lysate PCR electrophoresis result (the recombinant expression plasmid pPICZ α A that demonstration contains synthetic phytase gene successfully is transformed into yeast) that contains pPICZ α A recombinant plasmid; III: the PCR electrophoresis result that contains the recombination yeast P.pastoris yeast lysate of pPICZaA empty carrier].[the 1. 48 hours nutrient solution supernatants of engineering bacteria CCTCC NO:M200005 abduction delivering of the SDS-PAGE detection of expression of phytase among Figure 16, the pichia pastoris phaff genetic engineering bacterium CCTCC NO:M200005; 2. 72 hours nutrient solution supernatants of engineering bacteria CCTCC NO:M200005 abduction delivering; 3. engineering bacteria CCTCC NO:M200005 abduction delivering is after 48 hours, through the nutrient solution supernatant of EndoH processing; 4. engineering bacteria CCTCC NO:M200005 abduction delivering is after 72 hours, through the nutrient solution supernatant of EndoH processing; 5. molecular weight marker (magnificent company); 6. molecular weight marker (magnificent company); 7. the 72 hours nutrient solution supernatants of recombination yeast P.pastoris abduction delivering that contain the pPICZaA empty carrier; 8. the recombination yeast P.pastoris abduction delivering that contains the pPICZaA empty carrier is after 72 hours, through the nutrient solution supernatant of EndoH processing].(X-coordinate is represented incubation time to the growing microorganism curve of Figure 17, pichia pastoris phaff genetic engineering bacterium CCTCC NO:M200005; Ordinate zou is represented the logarithmic value of cfu/mL).(X-coordinate is represented the inducing culture time to the product enzyme curve of inducing of Figure 18, pichia pastoris phaff genetic engineering bacterium CCTCC NO:M200005; Ordinate zou is represented enzyme activity U/mL).The optimal pH curve of Figure 19, fermented liquid phytase (X-coordinate is represented pH: ordinate zou is represented enzyme activity U/mL).(X-coordinate is represented temperature ℃ to the optimum temperuture curve of Figure 20, fermented liquid phytase; Ordinate zou is represented enzyme activity U/mL).

Embodiment 1: a kind of artificial manufacturing of gene order of the phytase of encoding

1506 Nucleotide of natural A .niger NRRL3135 bacterial strain phyA structure gene total length (vanHartingsveldt, W., et al., (1993) Gene 127 (1): 87-94; See Fig. 1), wherein, + 1～+ 44 ,+147～+ 159 totally 57 encoding sequences that nucleotide sequence is the aspergillus niger signal peptide, + 45～+ 146 totally 102 nucleotide sequences are typical fungi intron sequences, contain the feature conserved sequence of fungi intron: Donor sequence GTATGC, Lariat sequence GCTGAC and Acceptor sequence C AG.467 amino acid (see figure 2)s of phyA genes encoding, 19 amino acid of N end are signal peptide, the cleavage site of signal peptide is after the 19th Gly.The phytase that derives from fungi is a kind of glycosylated protein, on the phyA amino acid sequence coded, has found 10 potential N-glycosylation sites (Asn-X-Ser/Thr, X are arbitrary amino acid).The theoretical molecular of inferring according to amino acid is about 52kD.Also has its avtive spot sequence (Active-site sequence): CRVTFAQVLSRHGARYPTDSKGK on the phytase aminoacid sequence of different sources biology, wherein RHGARYPT is a most conservative sequence (reference: Ullah AH in the microbe-derived phytase activity site, et al., (1993) Biochem Biophys Res Commun192 (2): 754-759; Ullah AH, et al., (1995) Ann N Y Acad Sci 750:51-57; ).

Wood invention is a template with the phytase gene phyA sequence of A.niger NRRL3135 bacterial strain, carries out following modification: 1. at first remove in the former sequence+1～+ 44 ,+147～+ 159 totally 57 nucleotide sequences the aspergillus niger signal coding sequence and+45～+ 146 fungi intron sequences of totally 102 Nucleotide.2. removing the phyA gene segment of above-mentioned sequence, add the partial sequence of pichia pastoris phaff secreting signal peptide at 5 ' end: GAATTCTCGAGAAAAGAGAGGCTGAAGCT, this sequence contains two restriction endonuclease sites of EcoRI, XhoI.3. the codon of the phytase structural gene sequence of A.nigerNRRL3135 bacterial strain is replaced, will be displaced the low frequency codon, see Fig. 3 at the codon that the pichia pastoris phaff medium-high frequency is used.4. add two restriction endonuclease sites of XbaI, KpnI at 3 of gene order ' end.After all modification is finished, design a new gene order, see Fig. 4.

The designed new gene order of the present invention is compared with the original mature polypeptide coding sequence of having reported of A.niger NRRL3135 phytase, and the difference of 152 Nucleotide is arranged, and homology is 88.7% (see figure 5); With the A.niger963 phytase gene phyA2 (Yao Bin that has reported, Fan Yunliu, Wang Jianhua etc., 1998, Chinese science (C seizes) 28 (3): 237-243) compare, the difference that 123 Nucleotide are arranged, homology are 91.8%: newly-designed gene order amino acid sequence coded and phyA2 amino acids coding have 39 different, homology is 91.6%; 10 potential glycosylation sites are arranged on the albumen of newly-designed genes encoding, and phyA2 has 9, wherein 8 positions are identical, and conserved sequence is RHGARYPT in the newly-designed gene phytase activity site.

The newly-designed gene of the present invention can pass through the PCR synthetic.Step is as follows:

Design and synthesize out 19 pairs of primer (see figure 7)s according to newly-designed gene order, comprise 9 of forward primers, 10 of negative sense primers, they are respectively: F1～F9 and R1～R10.Every the on average long 80nt of primer, wherein F1/F2, F2/F3, F3/R1, R1/R2, R2/R3, R3/F4, F4/F5, F5/F6, F6/R4, R4/R5, R5/R6, R6/F7, F7/F8, F8/F9, F9/R7, R7/R8, R8/R9 and R9/R10; The tumor-necrosis factor glycoproteins that average 20nt is arranged between the every pair of primer; 5 of F1 primer ' end is added with the XhoI site, and R1 primer 5 ' end is added with the KpnI site.

During the synthetic newly-designed gene of PCR, be target with synthetic 3 small segments earlier, constantly add new primer then, prolong small pieces, at last three big segments are synthesized a long-chain (see figure 6) by PCR.Step is as follows:

At first prolong reaction by 3 couples of primers F 3/R1, F6/R4 and F9/R7, reaction system comprises primers F 3 or F6, F9 (0.10D/ μ l) 5 μ l, primer R1 or R4, R7 (0.10D/ μ l) 5 μ l, 10xTaKaRa LA Buffer 10 μ l, dNTP 16 μ l, H ₂O 63 μ l; In 94 ℃ of effect 15min, under 55 ℃, add TaKaRa LA Taq enzyme 1 μ l then, insulation 5min, in 72 ℃ of prolongation 5min, last alcohol precipitation is dissolved among the 200 μ l TE, obtains Segment A 1, B1 and C1 (see figure 8) respectively again.

Second step then was to be template with A1, B1 and C1, respectively with F2/R2, F5/R5 and F8/R8 primer to carrying out the PCR reaction, amplification obtains the fragment of length.Reaction system is primers F 2 or F5, F8 (0.010D/ μ l) 1 μ l, primer R2 or R5, R8 (0.010D/ μ l) 1 μ l, A ₁Or B ₁, C ₁1 μ l, dNTP 10 μ l, 10XTaKaRa LA Buffer 10 μ l, 10 * Taq enzyme, 1 μ l, H ₂O 76 μ l.In 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 30s, totally 30 circulations, the PCR product of acquisition is dissolved among the 200 μ l TE, obtains dna fragmentation A2, B2 and C2 (see figure 9) respectively.

The 3rd step then was with A ₂, B ₂And C ₂Be template, react carrying out PCR with F1/R3, F4/R6 and F7/R9 primer respectively that longer fragment increases.Reaction system and condition sill are with second step.Obtain dna fragmentation A3, B3 and C3 (see figure 10) respectively.

The 4th step was in a reaction system, added template A simultaneously ₃, B ₃And C ₃, to carrying out pcr amplification, obtain the full length DNA fragment with the F1/R10 primer.Reaction system comprises: F1 (0.010D/ μ l) 1 μ l, R10 (0.010D/ μ l) 1 μ l, A ₃1 μ l, B ₃1 μ l, C ₃1 μ l, dNTP 10 μ l, 10 * TaKaRa LA Buffer, 10 μ l, 10 * Taq enzyme, 1 μ l, H ₂O 75 μ l.In 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 30s, totally 30 circulations, the PCR product of acquisition is dissolved among the 200 μ lTE, obtains the full length DNA fragment.

This segment is by the full-automatic sequenator order-checking of DNA, and result and implementation sequence are identical, see Figure 11 A, B, C.

The transformation of gene can utilize that technology such as chemosynthesis realizes after known round pcr, site-directed mutagenesis technique, the gene design.The present invention is except gene design and design of primers, and primer is synthetic, newly design the synthetic and order-checking of the PCR of gene etc. all can finish by professional biotech company (as people Lian Bao biotech company).Embodiment 2: the structure that contains the recombinant plasmid pBlueScript of synthetic phytase gene

The synthetic phytase gene that obtains in embodiment 1 must be cloned on the appropriate carriers plasmid, utilizes so that preserve.The present invention selects escherichia coli vector plasmid pBlueScript, constructs the recombinant plasmid pBlueScript that contains synthetic phytase gene.Concrete steps are as follows: 1. bacterial strain and carrier: coli strain DH5 α, JM109, plasmid pBlueScript etc. are available from U.S. Promega company.2. enzyme and test kit: restriction enzyme, all kinds of modifying enzyme are Japanese TaKaRa company product.3. biochemical reagents: IPTG, X-Gal etc. is U.S. Sigma company product.4. substratum: LB substratum.5. gene XhoI and KpnI double digestion after will synthesizing well, spend the night with same the connection in 15 ℃ through the carrier pBlueScript of XhoI and KpnI double digestion, transformed into escherichia coli DH5 α, select positive recombinant behind the coated plate, obtain containing the recombinant plasmid pBlueScript (seeing Figure 12,13) of synthetic phytase gene.6. glycerine is preserved positive recombinant, needs time spent amplification positive recombinant, extracts recombinant plasmid, can obtain synthetic in a large number phytase gene with XhoI and KpnI double digestion recombinant plasmid.Embodiment 3: the structure that contains the recombinant expression plasmid pPICZ α A of synthetic phytase gene

Phytase is a kind of glycosylated protein, and therefore, the synthetic phytase gene need could correctly give expression to glycosylated functional protein in the embodiment of the invention 1 in eukaryotic expression system.Because pichia pastoris phaff is present comparatively successful expression system, for this reason, need construct the recombinant expression plasmid pPICZ α A that contains synthetic phytase gene, so as in pichia pastoris phaff Expressing Recombinant Phytase.Concrete steps are as follows: 1, bacterial strain and carrier: yeast strain Pichia pastoris X-33, plasmid pPICZ α A are available from American I nvitrogen company.2, enzyme and test kit: restriction enzyme, all kinds of modifying enzyme are Japanese TaKaRa company product.3, biochemical reagents: other is homemade analytical pure.4, will cut with the KpnI+XhoI enzyme by the recombinant plasmid pBlueScript that embodiment 2 obtains, electrophoresis reclaims the synthetic phytase gene dna fragmentation of about 1.4kb.Use KpnI+XhoI double digestion empty carrier plasmid pPICZ α A simultaneously, electrophoresis reclaims the big fragment of 3.6kb.Again the 1.4kb small segment is linked to each other with the big fragment of 3.6kb, obtain being used for the recombinant expression vector pPICZoA that contains the phytase synthetic gene (seeing Figure 12,14) that P.pastoris transforms.The goal gene that has the merocrine secretion signal sequence is inserted into the signal peptide sequence downstream of above-mentioned expression vector, form correct reading frame with signal peptide, constructing can be by P.pastoris AOX portion gene sequence on the carrier and the homologous recombination between the chromogene group, the recombinant expression vector of stable integration to the yeast chromosomal.Embodiment 4: the conversion of pichia pastoris phaff and the screening of genetic engineering bacterium

The recombinant expression vector pPICZ α A that contains the phytase synthetic gene that obtains in embodiment 3 further transforms P.pastoris, by phenotypic screen and enzyme activity determination, filters out the genetic engineering bacterium that efficiently expresses phytase.Concrete steps are as follows: (reference: " molecular cloning experiment guide second edition ", Science Press, Beijing, 1998) 1, bacterial strain and carrier: yeast strain Pichia pastoris X-33 is available from American I nvitrogen company, and the recombinant expression vector pPICZ α A that contains the phytase synthetic gene is from embodiment 3.2, enzyme and test kit: restriction enzyme, all kinds of modifying enzyme are Japanese TaKaRa company product.3, biochemical reagents: Zeocin is a U.S. Sigma company product, and other is homemade.4, substratum: the yeast perfect medium is YPD (1% yeast extract (W/W), 2% peptone (W/W), 2% glucose (W/W)); The yeast conversion substratum is RDB (18.6% sorbyl alcohol (W/W), 2% glucose (W/W), 1.34%Yeast (W/W)); It is MM (1.34%YNB (W/W), 0.00004%Biotin (W/W), 0.5% methyl alcohol (V/V)), 1.5% agar (W/W) sugar that yeast is selected substratum) and MD (1.34%YNB (W/W), 0.00004%Biotin (W/W), 2% glucose (W/W), 1.5% agarose (W/W)); Yeast inducing culture BMGY[1% yeast extract (W/W), 2% peptone (W/W), 1.34%YNB (W/W), 0.00004%Biotin (W/W), 1% glycerine (V/V)] and BMMY (replace glycerine divided by 0.5% methyl alcohol, all the other one-tenth phase-splittings are identical with BMGY).5, the recombination yeast fermention medium is YPD; Inducing culture MMY (the not BMMY of phosphoric acid damping fluid).6, recombinant expression vector pPICZG α A DNA at first cuts (through PEG method purifying) with restriction endonuclease SacI enzyme, makes it linearizing, and whether the electrophoresis detection enzyme is cut complete; Linearizing pPICZ α A phenol extracting, ethanol sedimentation, 70% ethanol washes twice, lyophilize, the sterilized water dissolving ,-20 ℃ of preservations are standby.7,5ml X-33 bacterium liquid is inoculated in 30 ℃ of overnight incubation of 50ml YPD liquid nutrient medium.The bacterium liquid 0.1～0.5ml that gets incubated overnight is inoculated in the fresh YPD liquid nutrient medium of 500ml, and 30 ℃ of incubated overnight are to OD again ₆₀₀=1.3～1.5.At+4 ℃, centrifugal 5 minutes of 1500 * g is with 0 ℃ of resuspended thalline of sterilized water of 500ml.Centrifugal the same, be resuspended in 0 ℃ of sterilized water of 250ml again.Centrifugal the same, be resuspended in 0 ℃ of 1M Sorbitol Solution USP of 20ml.Centrifugal the same, be resuspended in 0 ℃ of 1M Sorbitol Solution USP of 1ml again, place on ice (use on the same day).8, the cell 80 μ l of above-mentioned 7 preparations and the linearizing DNA5～90 μ g of above-mentioned 6 preparations are injected 0 ℃ of electric shock pond, mixing was put 5 minutes on ice.At voltage: 1500V; Electric capacity: 25 μ F; Resistance: burst process under the pulse parameter condition of 200 Ω.The Sorbitol Solution USP (0 ℃) that the rapid 1ml of adding concentration is 1Mol arrives in the electric shock pond, mixing.With liquid transposition 1.5ml EP pipe in the pond, cultivated 1-2 hour for 30 ℃ again.Get 150 μ l coating and contain Zeocin ^TMThe YPD solid medium of 100 μ g/ml was cultivated 2-3 days for 30 ℃.9, go up picking Zeo with aseptic toothpick from transforming flat board ⁺Recon at first is inoculated on the MM solid medium, inoculates simultaneously on the MD solid medium, cultivates 2 days for 30 ℃.Searching is Zeo at clone's normal but that some growth is arranged or do not grow fully of growing on the MD flat board on the MM flat board ⁺Mut ^-The positive recombinant of phenotype.10, with above-mentioned 9 Zeo that prepare ⁺Mut ^-The enzyme activity determination of phytase is further made in about 110 strains of the positive recombinant of phenotype.Method is as follows: the preparation of (1) typical curve: phytic acid and phytate discharge inorganic phosphorus under the effect of phytase, by acid molybdenum-vanadium reagents and inorganic phosphorus generation color reaction, generate yellow compound, measure its photoabsorption at 415nm.With

Content of inorganic phosphorus is to its absorbancy (OD under vanadium molybdenum developer ₄₁₅) set up typical curve, according to reaction system

Form and OD ₄₁₆Value is calculated enzyme activity (U/mL).Required reagent: 0.25mol/L acetate-sodium acetate buffer

(pH5.5); 65% (W/W) HNO ₃35% (W/W) HNO ₃4mol/L acetate; 25% (W/W) ammoniacal liquor; 0.84% (W/W)

Sodium phytate solution (pH5.5); 10% (W/W) ammonium molybdate solution; 0.235% (W/W) Ammonium Vanadate Solution; C/T stops

The composition of liquid: ammonium molybdate solution: Ammonium Vanadate Solution: 65%HNO ₃: H ₂O=50: 50: 33: 67, existing with existing

Join; 30ug/ml KH ₂PO ₄Solution is as the mother liquor of serial dilution.

Prepare following color reaction system:

Test tube numbers 123456

30ug/ml KH ₂PO ₄Solution (ml) 012345

H ₂O(ml) 6 5 4 3 2 1

C/T stop buffer (ml) 444444

OD ₄₁₅Value ^※-0.001 0.146 0.298 0.447 0.600 0.73

The phosphorus content (μ mol) 0.9606 1.9372 2.9057 3.8743 4.8428 5.8114 that converts

^※Linear regression analysis, relation conefficient are 0.9993863.(2) Zeo ⁺Mut ^-The enzyme activity determination of recon fermented liquid.Get the 0.5ml supernatant liquor, optionally dilute 10～3000 times, get the 2mL diluent, join 4mL and be preheated in 37 ℃ the sodium phytate solution, reaction 15min adds C/T liquid termination reaction and the colour developing of 4mL again.Control group is except that C/T liquid adds when reaction begins, and all the other are identical with experimental group.Make blank with control group, measure each Zeo ' Mut recon OD ₄₁₅Value is obtained the phosphorus content (μ mol) of reaction system according to regression equation, calculates enzyme activity according to following formula again:

Enzyme activity (U/mL)=(the ÷ T ÷ V of A * D)

A:P content (umol)

D: extension rate

T: the reaction times (unit: minute)

V: the diluent (unit: ml) that adds in the system

Through screening, 110 strain recons all have enzyme activity, and partial results sees Table 2.

The methyl alcohol of recon utilizes defective type (Mut ^-) phenotype explanation foreign gene accurately has been incorporated into AOX1 gene locus in the pichia pastoris phaff genome, thereby destroyed the function of this gene, can confirm this point by Molecular Detection.

The cell walls that method by enzymolysis is destroyed recon destroys cytolemma with SDS, discharges chromosomal DNA, just can obtain purer genomic dna through further purification process again.Get micro-recon genomic dna then and carry out the PCR evaluation.The result shows have synthetic phytase gene to integrate (seeing Figure 15) in the genomic dna of recon SPAN-III.

The abduction delivering of phytase gene in recon can also confirm by the protein electrophorese analysis to fermented liquid.The inducing culture liquid of getting 5uL and do not have thalline carries out SDS-PAGE (acrylamide: methylene diacrylamide is 29: 1).Used resolving gel concentration is 8% (W/W), and concentrated gum concentration is 5% (W/W).Electrophoresis finishes the back gel with Coomassie brilliant blue R250 dyeing 30 minutes, follows the glacial acetic acid decolouring with 10% (W/W).The result shows that phytase gene obtains abduction delivering in recon SPAN-III, and the phytase molecule amount size of expression is about 85～100kD (seeing Figure 16).

Recon SPAN-III on April 11st, 2000 by the typical culture collection center preservation of Wuhan University China, its deposit number is CCTCC NO:M200005.Embodiment 5: the abduction delivering of pichia pastoris phaff genetic engineering bacterium CCTCC NO:M200005 and the characteristic research of expression product phytase

The abduction delivering of pichia pastoris phaff genetic engineering bacterium CCTCC NO:M200005:

Pichia pastoris phaff genetic engineering bacterium CCTCC NO:M200005 cultivates under the shake-flask culture condition, YPD substratum, inoculum size 10%, 30 ℃, 240rpm/min got the 1mL fermented liquid every 2 hours, measure viable count, cultivate after 20～24 hours, cell concentration can reach 1～9 * 10 ⁹Cfu/mL (seeing Figure 17).

Cultivate after 24 hours, change equal-volume MMY substratum, begin to add methanol induction, methyl alcohol addition 0.5% (V/V) added once in per 12 hours.Got the 2mL nutrient solution every 12 hours and be used to measure phytase activity, the results are shown in Figure 18, within 210 hours whole inducing culture phases, the expression of phytase increases with the prolongation of induction time.

The optimal pH of phytase:

Select three kinds of buffer solution systems, that is: glycine-HCL (pH1.0～2.0), acetic acid-sodium-acetate (pH2.2～6.0), Tris-HCL (pH6.5～8.0), be determined at the phytase activity power of engineering bacteria CCTCC NO:M200005 fermented liquid under the different pH condition, measurement result shows, the optimum pH of phytase is 5.5,2.5 an enzyme activity peak (seeing Figure 19) is arranged also.

The optimum temperuture of phytase:

Select under 25 ℃, 37 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, 75 ℃, the 80 ℃ condition of different temperatures, measure the enzyme activity of phytase in the engineering bacteria CCTCC NO:M200005 fermented liquid, the result shows that the optimum temperuture of phytase is 55 ℃ (seeing Figure 20).

The molecular weight of phytase:

The SDS-PAGE electrophoresis result shows that phytase molecule amount size is about 85～100kD in the engineering bacteria CCTCC NO:M200005 fermented liquid, and the difference of molecular weight size may be due to the degree of glycosylation difference.Handle back (reference: Tai with EndoH (Endo-B-N-acetylglycosaminidase H) desugar base, T., et al., 1975, J.Biol.Chem., 250,8569), the phytase molecule amount is (to see Figure 16) about 50kD in the engineering bacteria CCTCC NO:M200005 fermented liquid, proves that phytase gene has not only obtained expression, effectively secretion, and expression product can also carry out albumen and turn over and select back modification-glycosylation, and glycosylation modified also to be that phytase possesses the normal enzyme activity necessary.

Claims (12)

1, a kind of coding phytase gene sequence, it is characterized in that: in phyA (from the phytase gene of A.niger NRRL3135) total length structural gene sequence, remove+45～+ 146 nucleotide sequence, remove+1～+ 44, + 147～+ 159 aspergillus niger signal coding sequence, connect one section signal coding sequence that is suitable for secreting, expressing in yeast at 5 ' end, connect a restriction endonuclease sites at 3 ' end.

2, sequence according to claim 1 is characterized in that: the signal peptide part encoding sequence that is suitable for secreting, expressing in the pichia spp is: GAATTCTCGAGAAAAGAGAGGCTGAAGCT.

3, sequence according to claim 1 is characterized in that: codon that will frequency of utilization is low in pichia spp replaces with the high codon of frequency of utilization.

4, according to claim 1,2 or 3 described sequences, it is characterized in that: coding phytase gene sequence is:

GAATTCTCGAGAAAAGAGAGGCTGAAGCTCTGGCAGTCCCAGCCTCTAGAAATCAATCCTCTTGTGATACTGTCGATCAG

GGTTATCAATGTTTCTCCGAGACTTCTCATCTTTGGGGTCAATACGCACCATTCTTCTCTCTGGCAAACGAATCTGTCAT

CTCCCCTGAGGTGCCAGCCGGATGTAGAGTCACTTTCGCTCAGGTCCTTTCCAGACATGGAGCTAGATATCCAACCGACT

CCAAGGGTAAGAAATACTCCGCTCTTATTGAGGAGATCCAGCAGAACGCTACCACCTTTGACGGAAAATATGCCTTCCTG

AAGACATACAACTACTCTTTGGGTGCAGATGACCTGACTCCATTCGGAGAACAGGAGCTTGTCAACTCCGGTATCAAGTT

CTACCAGAGATACGAATCTTTGACAAGAAACATCGTTCCATTCATCAGATCCTCTGGTTCCTCTAGAGTTATCGCCTCCG

GTAAGAAATTCATCGAGGGTTTCCAGAGCACTAAGCTGAAGGATCCTAGAGCCCAGCCAGGTCAATCTTCTCCAAAGATC

GACGTTGTCATTTCCGAGGCCTCTTCATCCAACAACACTCTTGACCCAGGTACTTGTACTGTCTTCGAAGACTCTGAATT

GGCCGATACTCTCGAAGCCAATTTCACTGCCACTTTCGTCCCATCCATTAGACAAAGACTGGAGAACGACCTGTCCGGTG

TTACTCTTACTGACACTGAAGTTACTTACCTTATGGACATGTGTTCCTTCGACACTATCTCCACTTCTACCGTCGACACC

AAGCTGTCCCCATTCTGTGACCTGTTCACCCATGACGAATGGATCAACTACGACTACTTGCAGTCCTTGAAAAAGTATTA

CGGTCATGGTGCAGGTAACCCATTGGGTCCAACCCAGGGTGTCGGTTACGCTAACGAGTTGATCGCCAGACTGACCCACT

CTCCTGTCCACGATGACACCTCTTCCAACCACACTTTGGACTCTTCTCCAGCTACCTTTCCATTGAACTCTACTTTGTAC

GCTGACTTTTCTCATGACAACGGTATCATCTCCATTTTGTTTGCTTTAGGTCTGTACAACGGTACTAAGCCATTGTCTAC

CACTACCGTTGAGAATATCACCCAGACAGATGGATTCTCTTCTGCTTGGACTGTTCCATTTGCTTCTAGATTGTACGTCG

AGATGATGCAGTGTCAGGCTGAGCAGGAGCCACTGGTCAGAGTCTTGGTTAATGATAGAGTTGTCCCACTGCATGGTTGT

CCTGTTGATGCTTTGGGTAGATGTACCAGAGATTCTTTTGTTAGAGGTTTGTCTTTTGCTAGATCTGGTGGTGATTGGGC

TGAGTGTTTTGCTTAAGGTACC

5, the recombinant plasmid of a kind of claim 1,2 or 3 described sequences is characterized in that: connect into carrier by the phytase gene sequence of will encoding at the restriction enzyme site of 5 ' end and 3 ' end.

6, recombinant plasmid according to claim 5 is characterized in that: carrier is pBlueScript.

7, recombinant plasmid according to claim 5 is characterized in that: carrier is pPICZ α A.

8, a kind of phytase yeast gene engineering bacteria that adopts the described recombinant plasmid of claim 5 and form is characterized in that: recombinant plasmid transformed is gone into pichia pastoris phaff (Pichia pastoris).

9, a kind of phytase pichia pastoris phaff genetic engineering bacterium that contains claim 4 described sequences, it is characterized in that: carrier is pPICZ α A.

10, a kind of screening method of claim 9 described genetic engineering bacteriums, it comprises: at phenotypic screen (Zeo ⁺Mut ^-) the basis on, carry out the functional screening that phytase is expressed by enzyme activity determination; It is characterized in that: with series concentration inorganic phosphorus and the absorbancy (OD under vanadium molybdenum developer thereof ₄₁₅) set up typical curve,

Calculate the enzyme activity (U/mL) of fermented liquid under same reaction system, same reaction conditions according to typical curve, screen.

11, a kind of pichia pastoris phaff genetic engineering bacterium (CCTCC NO:M200005) that adopts claim 10 described methods to filter out, it is characterized in that: below 210 hours, the phytase vigor of engineering bacterium fermentation liquid can reach 0～250U/mL through methanol induction; Methanol concentration is 0.25～0.75%, and the inducing culture condition is to shake bottle rotating speed a 230～250rpm/min, 28～30 ℃ of culture temperature.

12, a kind of gene engineering phytase that from claim 11 described pichia pastoris phaff genetic engineering bacteriums (CCTCCNO:M200005), obtains, it is characterized in that: engineering bacteria is through fermentation culture, methanol induction, and coding phytase gene sequence is expressed and phytase is secreted in the fermented liquid.

Images