CN1333077C - Cascade expression of active fragment of cholecystokinin and application thereof - Google Patents
Cascade expression of active fragment of cholecystokinin and application thereof Download PDFInfo
- Publication number
- CN1333077C CN1333077C CNB2005100115839A CN200510011583A CN1333077C CN 1333077 C CN1333077 C CN 1333077C CN B2005100115839 A CNB2005100115839 A CN B2005100115839A CN 200510011583 A CN200510011583 A CN 200510011583A CN 1333077 C CN1333077 C CN 1333077C
- Authority
- CN
- China
- Prior art keywords
- cck
- cholecystokinin
- gene
- 4cck
- prseta
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The present invention provides a method for obtaining multi-concatemer of active fragments of cholecystokinin, which comprises the construction of a recombinant plasmid for expressing a cholecystokinin gene, the expression of the cholecystokinin gene in colibacillus and the purification of cholecystokinin gene engineering products. The recombinant plasmid for expressing the cholecystokinin gene has a chicken cholecystokinin 33 gene or a nucleotide sequence of the multi-concatemer thereof, and the cholecystokinin gene engineering products have chicken cholecystokinin 33 peptide or an amino acid residue sequence of the multi-concatemer thereof. The present invention further relates to active immunity technology of the recombinant cholecystokinin polypeptide on animals and an application thereof.
Description
Technical field
The invention belongs to the genetically engineered field.Be specifically related to express construction of recombinant plasmid, the expression of cholecystokinin gene in intestinal bacteria and the purifying of cholecystokinin gene engineering product of cholecystokinin gene.The invention further relates to of active immunity technology and the application thereof of reorganization cholecystokinin polypeptide to animals such as pig, rabbit, ox, chickens.
Background technology
(Cholecystokinin CCK) is a kind of efficiency factor of regulating animal feed intake to cholecystokinin.Cholecystokinin claims cholecystokinin or Pancreozymin again, is the peptide hormone by the I emiocytosis of mucous membrane of small intestine.The CCK precursor is 130 amino acid, progressively is decomposed into micromolecular CCK, and the CCK that finds has CCK-83, CCK-58, CCK-39, CCK-33, CCK-12, CCK-8 and CCK-4 at present.Its different sites is mainly at carboxyl terminal, but length extends in aminoterminal.Be mainly macromole CCK after the meal in the blood plasma, comprise CCK-58, CCK-39, CCK-33 and CCK-12.These macromole CCK all becomes the amino-acid residue of 8 peptides, i.e. CCK-8 behind trypsin hydrolyzing.CCK-8 has whole activity of CCK molecule, with the gastrin structural similitude of 8 peptides, all has identical N-terminal sequence Gly-Trp-Met-Asp-Phe-NH2, and it is necessary that this sequence is that CCK and gastrin are brought into play its biological activity.CCK is present in brain and the gi tract, is higher a kind of braingut petide (brain-gutpeptide) class material of brain intensive amount.Then difference is very big for the content of CCK at each position.At gi tract, CCK can promote the contraction of gall-bladder, stomach and pyloric sphincter; Promote far-end duodenum and jejunum wriggling; Promote the secretion of bile, hydrochloric acid in gastric juice, pancreatic juice; Strengthen the activity of pancreatin; Promote the release of Regular Insulin, hyperglycemic-glycogenolytic factor, thyrocalcitonin; Regulate the release of pancreatic polypeptide in enteron aisle and pancreatic juice; Suppress functions such as stomach emptying.Cck receptor has two kinds: CCK-A acceptor and CCK-B acceptor, and wherein the CCK-A acceptor is very high at peripheral organ's content, and CCK-B acceptor content in central nervous system is very high.The CCK-A acceptor has two binding sites: high-affinity site and low-affinity site.Thereby the CCK that studies show that in recent years searches for food animal to stop in conjunction with making animal produce full sense with the low-affinity site of CCK-A.
CCK can reduce the food consumption of multiple animal.The CCK-A acceptor gene knocks out rat and shows as obesity, easily hungry, the increase of searching for food (Schwartz etc., 1999).No matter discover, in multiple animal, be exogenous CCK, or the endogenous CCK that body self generates can both make body produce full feel (Della etc., 1979,1981; Gibbs etc., 1973; Mc Laughlin etc., 1980).Exogenous injection CCK also can reduce the food consumption of animal.Maincenter is introduced the effect that CCK has identical reduction food consumption with periphery, and CCK directly produces full sense as neurotransmitter in brain.Low dose of CCK just can suppress animal effectively and search for food, in multiple Mammals such as dog, mouse, rabbit, monkey and human experimentation research, find, stomach emptying activity (Doong etc., 1998) after no matter the CCK of physiological dose or pharmacology dosage can both suppress to take food, and then suppress animal and search for food.Plasma C CK concentration and gastric emptying rate are inverse relation.
Research to the CCK immunity has been carried out the long period, studies show that in early days, utilizes the immunoregulation technology can effectively regulate and control the secretion of hormone in vivo, thereby regulates production performance (Della etc., 1981 of animal; Lawrence etc., 1986; Pekas, 1991,1993; Schanbacher etc., 1994).At present, existing on pig and some ruminating animals is the research report that antigen carries out active immunity and passive immunization with CCK, and the result shows has certain regulating and controlling effect to breeding performonce fo animals.Jens etc. (1978) are with the independent immune rabbit of CCK-33, and behind booster immunization 3 times, the antiserum(antisera) of the very high anti-CCK-33 that obtained to tire illustrates that CCK has certain antigenicity, can be used for inoculating animal and make it to produce antibody.And domestic, Chen Junhui (1992) connects formation holoantigen immune rabbit with CCK-8 macromole and bovine serum albumin (BSA), has also obtained the anti-CCK-8 antiserum(antisera) of high titre behind the booster immunization.Though the CCK immunoregulation has certain effect on pig, sheep; but in order to use this technology aborning; must search out a kind of CCK immunogen; its immune consumption is few; immunologic process is convenient feasible; antibody is relatively stable, be easy to preserve and use, and can mass production antibody, meets the method for protection of animal rules again.
Do food consumption and the weightening finish that antigen active immunity animal can be improved animal with CCK.After Pekas and Trout (1990) use CCK immunity growing swine, its food consumption and weightening finish have improved 8.2% and 10.6% respectively, carcass weight improves 8.7%, body is long to increase by 2.4%, to the ratio of lean meat/fat and the not influence of ratio of protein/fat, but the trunk lean meat and the fat of CCK immune swine heavily increase.This shows that after the CCK immunity, the speed of growth increase of pig is because the trunk weightening finish increases, but trunk is formed not influence.Mclaughlin etc. (1985) find that treatment group has increased by 9% (P<0.04) than the food consumption of control group after with CCK active immunity mouse, and weightening finish has improved 17% (P<0.02).These results of study show that using CCK active immunity animal has certain promoter action for searching for food of animal, but conclusion also only limits to some Mammalss, are still waiting further experiment for the effect of other animal aspect and confirm.
More than research is all with chemosynthesis, or the CCK of separation and purification from animal tissues or its active part and macromolecular substance (as BSA etc.) coupling, immune animal then.But also do not adopt the report of escherichia coli expression CCK or its active fragments (as CCK-33 peptide, CCK-8 peptide).
Summary of the invention
The object of the present invention is to provide a method that obtains cholecystokinin active fragments excessive concatemer.
The key of the method for acquisition cholecystokinin active fragments excessive concatemer provided by the invention is the recombinant plasmid of the excessive concatemer of construction expression cholecystokinin 33 peptides.This plasmid is to adopt gene engineering method to obtain, and concrete construction process is as follows:
(1) according to the base sequence and the intestinal bacteria high frequency codon of chicken cck gene, the synthetic cck-33 gene of design, gene order is: GGTTCTACTGGCCGCTTCTCTGTCCTTGGCAACCGTGTACAGAGCATTGATCCGAC G CACCGTATTAATGACCGTGACTACATGGGCTGGATGGATTTT.
(2) the cck-33 gene is inserted the pRSETA plasmid, obtains recombinant plasmid pRSETA-1CCK,
Concrete operations are as follows:
According to the cck-33 gene design Auele Specific Primer P1 of synthetic (5 '-CATGGATCCGGTTCTACTGGCCGCT-3 ')/P2 (5 '-CATGAGCTCCCAAAATCCATC CAGCC-3 '), adopt PCR method, cck-33 gene with synthetic is a template, amplification cck-33 gene fragment.。The PCR reaction system (200 μ L) of amplification cck-33 gene fragment is composed as follows: 20 μ L, 10 * buffer, 16 μ L dNTPs, 2 μ L Taq enzymes, 1.5 μ L primer P1,1.5 μ L primer P2, the cck-33 gene template of 0.5 μ L synthetic adds water to cumulative volume at last and reaches 200 μ L.PCR temperature cycle program is as follows: circulation 1:94 ℃ 3min; 2~31:94 ℃ of the 40sec that circulate, 56 ℃ of 40sec, 72 ℃ of 60sec; Circulation 32:72 ℃ 10min.Amplified production is 4 ℃ of preservations.With 2% sepharose (contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product, observe the size about 120bp specific band.
At 37 ℃ of PCR product and plasmid pRSETA that digest the cck-33 gene respectively, then under the effect of T4 ligase enzyme, connect the PCR product and the plasmid pRSETA of the cck-33 gene that has digested with Sac I and BamH I.With connecting product transformed into escherichia coli DH5 α.Through the Ampr resistance screening, obtain to have inserted the transformant of cck-33 gene.With Auele Specific Primer P1/P2 the transformant that contains the cck-33 gene is carried out the PCR screening then.The PCR reaction system (20 μ L) that detects the cck-33 gene fragment is composed as follows: 2 μ L, 10 * buffer, and 1.6 μ L dNTPs, 0.2 μ L Taq enzyme, 0.5 μ L primer P1,0.5 μ L primer P2,1 μ L bacterium liquid to be checked adds water to cumulative volume at last and reaches 20 μ L.PCR temperature cycle program is as follows: circulation 1:94 ℃ 3min; 2~31:94 ℃ of the 40sec that circulate, 56 ℃ of 40sec, 72 ℃ of 60sec; Circulation 32:72 ℃ 10min.Amplified production is 4 ℃ of preservations.With 2% sepharose (contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product, observe the size about 120bp specific band.
To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, and the extracting plasmid again through digestion with restriction enzyme and sequencing, obtains recombinant plasmid called after pRSETA-1CCK.
(3) according to BamH I and the Bgl II characteristic of isocaudarner each other, make up cck-33 gene 2 concatermers (being called for short 2cck), concrete operations are as follows:
Recombinant plasmid pRSETA-1CCK is digested at 37 ℃ with two groups of enzymes: first group digests with BamHI and Hind III, reclaims less fragment; Second group digests with Bgl II, Hind III and CIAP, reclaims bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through the Ampr resistance screening, obtain to carry the recon of 2cck.With Auele Specific Primer P1/P2 the recon that contains 2cck is carried out the PCR screening then.The PCR reaction system (20 μ L) that detects 2cck is composed as follows: 2 μ L, 10 * buffer, and 1.6 μ L dNTPs, 0.2 μ L Taq enzyme, 0.5 μ L primer P1,0.5 μ L primer P2,1 μ L bacterium liquid to be checked adds water to cumulative volume at last and reaches 20 μ L.PCR temperature cycle program is as follows: circulation 1:94 ℃ 3min; 2~31:94 ℃ of the 40sec that circulate, 56 ℃ of 40sec, 72 ℃ of 60sec; Circulation 32:72 ℃ 10min.Amplified production is 4 ℃ of preservations.(contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product is observed the specific band of about 230bp with 2% sepharose.
To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-2CCK of acquisition.
(4) 4 concatermers (being called for short 4cck) of structure cck-33 gene on the basis of pRSETA-2CCK, concrete operations are as follows:
Recombinant plasmid pRSETA-2CCK is digested at 37 ℃ with two groups of enzymes: first group digests with BamHI and Hind III, reclaims less fragment; Second group digests with Bgl II, Hind III and CIAP, reclaims bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through the Ampr resistance screening, obtain to carry the recon of 4cck.Use Auele Specific Primer P3 (5 '-GATAAGGATCGATGGGGATCC-3 ')/P4 (5 '-ATGGTACCAGCTGCAGATCT-3 ') that the recon that contains 4cck is carried out the PCR screening then.To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-4CCK of acquisition.
Adopt identical method, obtain to carry the recombinant plasmid of CCK-33 gene 6 concatermers (being called for short 6cck), 8 concatermers (being called for short 8cck) respectively, correspondingly called after pRSETA-6CCK, pRSETA-8CCK.
After obtaining to express the recombinant plasmid of CCK-33 peptide excessive concatemer, use the recombinant plasmid transformed intestinal bacteria, to express the genetic engineering bacterium of CCK-33 peptide excessive concatemer, then under the inducing of IPTG, express CCK-33 peptide excessive concatemer, and expression product is identified and purifying.With the example that is expressed as of CCK-33 peptide 4 concatermers (being called for short 4CCK), method is as follows:
(1) recombinant plasmid pRSETA-4CCK Transformed E .coLi BL-21 (DE3) recipient bacterium of identifying through order-checking, the single reorganization bacterium colony of picking, be inoculated in the 3mL LA liquid nutrient medium, after 5h is cultivated in 37 ℃ of joltings, carrying out PCR with Auele Specific Primer P3/P4 identifies, positive bacteria is for expressing the genetic engineering bacterium of cck-33 gene 4 concatermers, called after E-4CCK.
(2) it is streak culture 16~20 hours in 37 ℃ on the LA flat board to get E-4CCK.The single bacterium colony of picking in 37 ℃ of cultivations 12~16 hours, places 4 ℃ of refrigerators to preserve bacterium liquid in the LA liquid nutrient medium.In 1% ratio inoculation LA liquid nutrient medium, 37 ℃, when the 200r/m jolting was cultured to 0D600 value and reaches 0.5 left and right sides, adding final concentration was the IPTG of 1mmol/L, got bacterium liquid in 0,1,2,3,4 hour respectively behind adding IPTG, identified with SDS-PAGE.With the CCK positive serum fusion rotein of expressing being carried out Western Blot analyzes.
The SDS-PAGE method is as follows: bacterial suspension in the centrifugal 1min of 10000r/m, is got precipitation.Add a certain amount of distilled water, resuspended bacterium.Sample retention is standby at 4 ℃ of refrigerators." protein handbook method prepares SDS-polyacrylamide gel (SDS-PAGE) with reference to volume such as Wang Jiazheng (2000).Spacer gel concentration is 5%, and resolving gel concentration is 12~15%, decides according to the molecular weight of the purpose product that is detected.Sample to be checked is boiled 5min, get 10 μ L and add in the gel point sample hole, under electric field action, carry out electrophoresis.Electrophoretic buffer is the Tris-glycine.Voltage is 80v/cm, and voltage is elevated to 160v/cm when treating tetrabromophenol sulfonphthalein arrival spacer gel bottom.When treating tetrabromophenol sulfonphthalein, stop electrophoresis, take off gel, place the dyeing of 1% Xylene Brilliant Cyanine G solution to spend the night, decolour with destainer near the gel bottom.
Western Blot analytical procedure is as follows: the SDS-PAGE electrophoresis does not dye to gel after finishing.Cut nitrocellulose filter and two filter paper big or small together, at soaking at room temperature 15min in transfering buffering liquid, by the order of sponge-filter paper-gel-nitrocellulose filter-filter paper-sponge transfer printing is installed and presss from both sides with the gel after the electrophoresis with gel phase.To in the folder side joint positive pole of film be arranged, and under the voltage of 15V, shift 1.5h.Film after the transfer spends the night with the sealing of 5% skim-milk, discards confining liquid, washes film three times with TBS.Discard TBS, add the anti-CCK-8 peptide of rabbit positive serum (SIGMA company), gentle jolting 3h with 1000 times of dilutions of 1% skim-milk.Discard an antiserum(antisera), wash film three times, about at every turn 10min with TBS.Discard TBS, add two anti-(the goat anti-rabbit igg antibody of horseradish peroxidase-labeled, magnificent companies) with 50 times of dilutions of 1% skim-milk, gentle jolting is 1h at least.Discard two and resist, wash film three times with TBS, about at every turn 30min.Discard TBS, add the colour developing of DAB solution, the jog nitrocellulose filter treats that colour developing reaches to a certain degree, washes the reaction of film color development stopping with distilled water.
(3) behind the E-4CCK microorganism collection with the IPTG abduction delivering, in carry out on 0 ℃ of ice bath ultrasonication, centrifugal after, precipitation is dissolved with the urea of 8mol/L.Under the sex change condition, carry out purifying with 50%Ni-NTA purifying resin.Concrete operations are as follows:
In IPTG abduction delivering 4h sampling, 4 ℃ of centrifugal 2min of 10000r/m collect thalline and are kept at-20 ℃ with 1000mL genetic engineering bacterium E-4CCK; The preservation bacterium bacterial sediment of expressing is put the 15min that thaws on ice, add 20mL Buffer B suspension bacterium, suspension gentleness on condition of ice bath underlying shaking table is shaken 30min, abundant sex change cracking inclusion body, carry out ultrasonication then in ice bath, ultrasonic time is 6 seconds, and be 8 seconds pitch time, power is 400W, broken number of times 40 times.4 ℃ of centrifugal 20min of 10000r/m get supernatant liquor and carry out purifying.
With the Buffer B of the 20mL that packs in the purification column, with 50%Ni-NTA purifying resin mixing, take out 4mL dress post, treat that resin precipitated is good after, the switch of purification column cuts out, usefulness Buffer B balance purification column needs 12h approximately.Clean purification column with Buffer B.When treating that Buffer B is about to flow to end (but can not drain off) cracking supernatant 2mL is slowly joined in the purification column, cross the post wash-out with 4mL BufferC, 4mL Buffer D, 4mL Buffer E successively then, and collect sample respectively.Above sample is carried out SDS-PAGE to be analyzed.Purifying buffer B uffer B, Buffer C, Buffer D, the necessary fresh preparation of Buffer E, it is composed as follows:
Buffer B:100mmol/L NaH2PO4,10mmol/L Tris HCL, 8mol/L urea, pH8.0;
Buffer C:100mmol/L NaH2P04,10mmol/L Tris-HCL, 8mol/L urea, pH6.3;
Buffer D:100mmol/LNaH2PO4,10mmol/L Tris-HCL, 8mol/L urea, pH5.9;
Buffer E:100mmol/L NaH2PO4,10mmol/L Tris-HCL, 8mol/L urea, pH4.5.
Albumen through the 50%Ni-NTA resin purification is dialysed with dialysis tubing again.With cotton cord that one side-line of dialysis tubing is tight, an amount of protein purification solution is contained in the dialysis tubing, again the opposite side of dialysis tubing is fastened with cotton cord; The dialysis tubing that purifying protein is housed is placed among the dialyzate I of large volume, on magnetic stirring apparatus, stirs 4~5h under 4 ℃.Change dialyzate II, III, IV, V, VI, VII, VIII successively, repeat the aforesaid operations process.Last dialysis tubing is placed in the physiological saline of large volume, stirs 4~5h under 4 ℃ on magnetic stirring apparatus.Dialysis tubing is embedded in and carries out albumen in the silica gel and concentrate, and the albumen after concentrating is taken out be placed on 4 ℃ of refrigerators and preserve.Dialyzate composed as follows:
Dialyzate I:6mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH4.5;
Dialyzate II:6mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH5.5;
Dialyzate III:4mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH5.5;
Dialyzate IV:4mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH6.5;
Dialyzate V:2mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH6.5;
Dialyzate VI:2mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH7.5;
Dialyzate VII:10mmo l/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH7.5;
Dialyzate VIII:10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH8.5.
Being characterized as of the recombinant plasmid of expression CCK-33 peptide excessive concatemer provided by the invention:
(1) recombinant plasmid pRSETA-1CCK provided by the invention, pRSETA-2CCK, pRSETA-4CCK, pRSETA-6CCK, the pRSETA-8CCK nucleotide sequence that all has sequence 1 in the sequence table, or the concatermer sequence of sequence 1.Sequence 1 is called the cck-33 gene again, is made up of 99 base pairs, is that base sequence and the intestinal bacteria high frequency codon according to chicken cck gene designs.The concatermer sequence of sequence 1, be with several bases with two cck-33 genes in end to end mode, several cck-33 genes are coupled together the sequence that forms.For the excessive concatemer of sequence 1 and sequence 1, adopt PCR method can amplify specific band, also can adopt the method for determined dna sequence to determine.
(2) expression product of recombinant plasmid provided by the invention has the aminoacid sequence of sequence 2 in the sequence table, or the concatermer sequence of sequence 2.Sequence 2 is called the CCK-33 peptide again, by sequence 1 coding.The concatermer sequence of sequence 2, be with several amino acid with two CCK-33 peptides in end to end mode, several CCK-33 peptides are coupled together the sequence that forms.Adopt the specific antibody of anti-CCK-33 peptide, the specific antibody of perhaps anti-CCK-8 peptide, perhaps the specific antibody of the CCK of anti-other form can detect this polypeptide product.
(3) recombinant plasmid provided by the invention also comprises having the plasmid that cck is equal to sequence.Cck is equal to sequence, it is nucleotide sequence with the cck-33 gene, or the amino acid residue sequence of CCK-33 peptide is compared the difference that one or several Nucleotide or amino-acid residue are arranged, comprise the change, disappearance, interpolation of base or amino-acid residue or insert, or homology more than 75% is arranged with continuous 24 sections more than the base in the cck-33 gene order.
Recombinant C CK-33 peptide excessive concatemer provided by the invention has important use and is worth.One of use be with described recombinant C CK-33 peptide excessive concatemer as antigen, adopt recombinant C CK-33 peptide excessive concatemer direct immunization or, can promote that animal searches for food, the raising production performance itself and adjuvant animals such as immune swine, ox, rabbit, chicken simultaneously.
Second application of recombinant C CK-33 peptide excessive concatemer provided by the invention, be to adopt recombinant C CK-33 peptide excessive concatemer direct immunization or it is cooperated with adjuvant to make the vaccine immunity laying hen, by collecting the egg of immune chicken, can obtain the specific antibody of anti-CCK in a large number.
The Another application of recombinant C CK-33 peptide excessive concatemer provided by the invention, be with described recombinant C CK-33 peptide excessive concatemer as antigen, be applied to include but not limited to ELISA (enzyme linked immunosorbent assay), detect the CCK specific antibody in the animal serum.
The present invention has tangible advantage and effect.(1) the present invention adopts engineered method to express CCK-33 peptide excessive concatemer according to intestinal bacteria preference codon design gene order, the expression amount height, and cost is low.(2) the CCK-33 peptide excessive concatemer of the present invention's acquisition has good immunogenicity.CCK mainly exists with the form of amidated CCK-8 of hydroxyl terminal and CCK-33 in animal body.Because the molecular weight of CCK-33 and CCK-8 is too little, can not be directly as antigen-immunized animal, generally need be with them and macromolecular substance (as BSA) coupling.And the present invention connects the CCK-33 peptide, and the CCK-33 peptide excessive concatemer molecular weight of acquisition is big, and antigen site increases, and immunogenicity is good, does not therefore need just to can be used as antigen-immunized animal with the macromolecular substance coupling.Obtain CCK albumen with chemical synthesis process and compare, this method has tangible advantage.
Below in conjunction with embodiment and accompanying drawing structure, the signature analysis of expression product, application approach of expressing CCK-33 peptide excessive concatemer plasmid provided by the invention specified.
Description of drawings
Fig. 1 is that cck-33 gene and excessive concatemer thereof make up synoptic diagram.PRSET A is the cloned plasmids carrier, pRSETA-1CCK is the recombinant plasmid that has inserted the cck-33 gene, pRSETA-2CCK is for having inserted the recombinant plasmid of cck-33 gene 2 concatermers (2cck), pRSETA-4CCK is for having inserted the recombinant plasmid of cck-33 gene 4 concatermers (4cck), pRSETA-6CCK is for having inserted the recombinant plasmid of cck-33 gene 6 concatermers (6cck), and pRSETA-8CCK is for having inserted the recombinant plasmid of cck-33 gene 8 concatermers (8cck).BamH I, Hind III, Bgl II, Sac I are the restriction endonuclease sites on the plasmid.
Fig. 2 is the PCR qualification result figure of cck-33 gene and excessive concatemer thereof. Swimming lane 1 or 2 is PCR products of cck-33 gene and excessive concatemer thereof, and swimming lane M is a dna molecular amount mark.A is a cck-33 gene PCR product, and B is cck-33 gene 4 concatermers (4cck) PCR product, and C is cck-33 gene 8 concatermers (8cck) PCR product.
Fig. 3 is for carrying out the electrophoresis evaluation figure of double digestion respectively to recombinant plasmid pRSETA-1CCK, pRSETA-2CCK, pRSETA-4CCK, pRSETA-6CCK and pRSETA-8CCK with restriction enzyme BamH I and Hind III.M is dna molecular amount standard DL2000; 1 swimming lane is a pRSETA-1CCK plasmid enzyme restriction product, and external source segment size is about 120bp; 2 swimming lanes are pRSETA-2CCK plasmid enzyme restriction product, and external source segment size is about 230bp; 3 swimming lanes are pRSETA-4CCK plasmid enzyme restriction product, and external source segment size is about 450bp; 4 swimming lanes are pRSETA-6CCK plasmid enzyme restriction product, and external source segment size is about 700bp; 5 swimming lanes are pRSETA-8CCK plasmid enzyme restriction product, and external source segment size is about 1100bp.
Fig. 4 is that the SDS-PAGE (12%) of escherichia coli expression CCK-33 peptide 4 concatermers (4CCK) expression product detects figure.M is a protein molecular weight standard; 1~5 swimming lane is the bacterial lysate that contains CCK-33 peptide 4 concatermers (4CCK) expression product under the IPTG of 1mmol/L induces, and the abduction delivering time is respectively 0h, 1h, 2h, 3h and 4h.The arrow indication is CCK-33 peptide 4 concatermers (4CCK) expression products.
Fig. 5 is that the SDS-PAGE (12%) of CCK-33 peptide 6 concatermers (6CCK) expression product of escherichia coli expression detects figure.M is a protein molecular weight standard; 1~4 swimming lane is the bacterial lysate that contains CCK-33 peptide 6 concatermers (6CCK) expression product under the IPTG of 1mmol/L induces, and the abduction delivering time is respectively 0h, 1h, 2h and 3h.The arrow indication is CCK-33 peptide 6 concatermers (6CCK) expression products, and molecular weight is about 27kD.
Fig. 6 is that the immunoblotting (western blot) of CCK-33 peptide 4 concatermer expression products detects figure.M is a protein molecular weight standard; 1 is CCK-33 peptide 4 concatermers (4CCK) expression products.
Fig. 7 is that the SDS-PAGE of different steps component in CCK-33 peptide 4 concatermers (4CCK) the expression product affinitive layer purification process detects figure.M is a protein molecular weight standard; 1~2 is elutriant E elution fraction; 3 is elutriant D elution fraction; 4 is elutriant C elution fraction; 5~6 is elutriant B elution fraction; 7 are the not purified bacterial lysate that contains the 4CCK expression product; 8 for not containing the bacterial lysate of 4CCK expression product.
Fig. 8 is that the SDS-PAGE after the dialysis of CCK-33 peptide 4 concatermers (4CCK) fusion rotein detects figure.M is the molecular weight of albumen standard; The 1-2 swimming lane is the 4CCK fusion rotein after dialysing, and molecular weight is about 21kD.
Implementation method
1, expresses the construction of recombinant plasmid of cholecystokinin 33 peptides
At first according to the base sequence and the intestinal bacteria high frequency codon of chicken cck gene, the synthetic cck-33 gene of design, gene order is: GGTTCTACTGGCCGCTTCTCTGTCCTTGGCAACCGTGTACAGAGCATTGATCCGAC GCACCGTATTAATGACCGTGACTACATGGGCTGGATGGATTTT.Then, the cck-33 gene is inserted the pRSETA plasmid, obtain recombinant plasmid pRSETA-1CCK, concrete operations are as follows:
According to the cck-33 gene design Auele Specific Primer P1 of synthetic (5 '-CATGGATCCGGTTCTACTGGCCGCT-3 ')/P2 (5 '-CATGAGCTCCCAAAATCCATCCAGCC-3 '), adopt PCR method, cck-33 gene with synthetic is a template, amplification cck-33 gene fragment.The PCR reaction system (200 μ L) of amplification cck-33 gene fragment is composed as follows: 20 μ L10 * buffer, 16 μ L dNTPs, 2 μ L Taq enzymes, 1.5 μ L primer P1,1.5 μ L primer P2, the cck-33 gene template of 0.5 μ L synthetic adds water to cumulative volume at last and reaches 200 μ L.PCR temperature cycle program is as follows: circulation 1:94 ℃ 3min; 2~31:94 ℃ of the 40sec that circulate, 56 ℃ of 40sec, 72 ℃ of 60sec; Circulation 32:72 ℃ 10min.Amplified production is 4 ℃ of preservations.(contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product is observed specific band with 2% sepharose.
At 37 ℃ of PCR product and plasmid pRSETA that digest the cck-33 gene respectively, then under the effect of T4 ligase enzyme, connect the PCR product and the plasmid pRSETA of the cck-33 gene of digestion with Sac I and BamH I.With connecting product transformed into escherichia coli DH5 α.Through the Ampr resistance screening, obtain to have inserted the transformant of cck-33 gene.With Auele Specific Primer P1/P2 the transformant that contains the cck-33 gene is carried out the PCR screening then.The PCR reaction system (20 μ L) that detects the cck-33 gene fragment is composed as follows: 2 μ L, 10 * buffer, and 1.6 μ L dNTPs, 0.2 μ L Taq enzyme, 0.5 μ L primer P1,0.5 μ L primer P2,1 μ L bacterium liquid to be checked adds water to cumulative volume at last and reaches 20 μ L.PCR temperature cycle program is as follows: circulation 1:94 ℃ 3min; 2~31:94 ℃ of the 40sec that circulate, 56 ℃ of 40sec, 72 ℃ of 60sec; Circulation 32:72 ℃ 10min.Amplified production is 4 ℃ of preservations.(contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection PCR product is observed specific band (Fig. 2) with 2% sepharose.To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, and the extracting plasmid again through digestion with restriction enzyme and sequencing, obtains recombinant plasmid called after pRSETA-1CCK.
2, express the construction of recombinant plasmid of cholecystokinin 33 peptides, 2 concatermers (2CCK)
On the basis of expressing CCK-33 peptide recombinant plasmid pRSETA-1CCK, according to BamH I and the Bgl II characteristic of isocaudarner each other, make up 2 concatermers (2cck) of cck-33 gene, concrete operations are as follows:
Recombinant plasmid pRSETA-1CCK is digested at 37 ℃ with two groups of enzymes: first group digests with BamHI and Hind III, reclaims less fragment; Second group digests with Bgl II, Hind III and CIAP, reclaims bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through the Ampr resistance screening, obtain to carry the recon of 2cck.With Auele Specific Primer P1/P2 the recon that contains CCK-33 gene 2 concatermers is carried out the PCR screening then.PCR method is with reference to " implementation method 1 ".To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-2CCK of acquisition.
3, express the construction of recombinant plasmid of cholecystokinin 33 peptides, 4 concatermers (4CCK)
After obtaining to express cholecystokinin 33 peptides, 2 concatermers (2CCK) recombinant plasmid pRSETA-2CCK, on the basis of pRSETA-2CCK, according to BamH I and the Bgl II characteristic of isocaudarner each other, the recombinant plasmid of construction expression CCK33 peptide 4 concatermers (4CCK), concrete operations are as follows:
Recombinant plasmid pRSETA-2CCK is digested at 37 ℃ with two groups of enzymes: first group digests with BamHI and Hind III, reclaims less fragment; Second group is carried out enzymic digestion with Bgl II, Hind III and CIAP, reclaims bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through the Ampr resistance screening, obtain to carry the recon of CCK-33 gene 4 concatermers (4cck).Use Auele Specific Primer P3 (5 '-GATAAGGATCGATGGGGATCC-3 ')/P4 (5 '-ATGGTACCAGCTGCAGATCT-3 ') that the recon that contains 4cck is carried out the PCR screening then.PCR method is with reference to " implementation method 1 ".Electrophoresis detection PCR product is observed specific band (Fig. 2).To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-4CCK of acquisition.
4, express the construction of recombinant plasmid of cholecystokinin 33 peptides, 6 concatermers (6CCK)
After obtaining to express cholecystokinin 33 peptides, 2 concatermers (2CCK) recombinant plasmid pRSETA-2CCK and expressing cholecystokinin 33 peptides, 4 concatermers (4CCK) recombinant plasmid pRSETA-4CCK, according to BamH I and the Bgl II characteristic of isocaudarner each other, the recombinant plasmid of construction expression CC-K33 peptide 6 concatermers (6CCK), concrete operations are as follows:
Recombinant plasmid pRSETA-2CCK is digested at 37 ℃ with BamH I and HindIII, reclaim less fragment; Recombinant plasmid pRSETA-4CCK is digested with Bgl II, Hind III and CIAP, reclaim bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through the Ampr resistance screening, obtain to carry the recon of 6cck.With Auele Specific Primer P3/P4 the recon that contains 6cck is carried out the PCR screening then.PCR method is with reference to " implementation method 1 ".To PCR screening male bacterium, picking list colony inoculation is in 3mL LA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-6CCK of acquisition.
5, express the construction of recombinant plasmid of cholecystokinin 33 peptides, 8 concatermers (8CCK)
After obtaining to express cholecystokinin 33 peptides, 2 concatermers (2CCK) recombinant plasmid pRSETA-2CCK and expressing cholecystokinin 33 peptides, 6 concatermers (6CCK) recombinant plasmid pRSETA-6CCK, according to BamH I and the Bgl II characteristic of isocaudarner each other, the recombinant plasmid of construction expression CCK-33 peptide 8 concatermers (8CCK), concrete operations are as follows:
Recombinant plasmid pRSETA-2CCK is digested at 37 ℃ with BamH I and Hind III: reclaim less fragment; Recombinant plasmid pRSETA-6CCK is digested with Bgl II, Hind III and CIAP, reclaim bigger fragment.Then under the effect of T4 ligase enzyme, connect the big fragment and the small segment that reclaim.With connecting product transformed into escherichia coli DH5 α.Through the Ampr resistance screening, obtain to carry the recon of cck-33 gene 8 concatermers (8cck).With Auele Specific Primer P3/P4 the recon that contains 8cck is carried out the PCR screening then.PCR method is with reference to " implementation method 1 ".Electrophoresis detection PCR product is observed specific band (Fig. 2).To PCR screening male bacterium, picking list colony inoculation is in the 3mLLA substratum, and 37 ℃, 16~20h is cultivated in the 200r/m jolting, the extracting plasmid, and again through digestion with restriction enzyme and sequencing, the recombinant plasmid called after pRSETA-8CCK of acquisition.
6, expression and the evaluation of cholecystokinin 33 peptides, 4 concatermers (4CCK) in intestinal bacteria
At first, will be through recombinant plasmid pRSETA-4CCK Transformed E .coLi BL-21 (DE3) recipient bacterium of order-checking evaluation, the single reorganization bacterium colony of picking, be inoculated in the 3mL LA liquid nutrient medium, after 5h is cultivated in 37 ℃ of joltings, be PCR with Auele Specific Primer P3/P4 and identify, positive bacteria is for expressing the genetic engineering bacterium of 4CCK, called after E~4CCK.
Then, it is streak culture 16~20 hours in 37 ℃ on the LA flat board to get E-4CCK.The single bacterium colony of picking in 37 ℃ of cultivation 12~16h, places 4 ℃ of refrigerators to preserve bacterium liquid in the LA liquid nutrient medium.In 1% ratio inoculation LA liquid nutrient medium, 37 ℃, when the 200r/m jolting was cultured to 0D600 value and reaches 0.5 left and right sides, adding final concentration was the IPTG of 1mmol/L, respectively behind adding IPTG 0,1,2,3,4h gets bacterium liquid, identify with SDS-PAGE.With the CCK positive serum fusion rotein of expressing being carried out Western Blot analyzes.
The SDS-PAGE method is as follows: bacterial suspension in the centrifugal 1min of 10000r/m, is got precipitation.Add a certain amount of distilled water, resuspended bacterium.Sample retention is standby at 4 ℃ of refrigerators." protein handbook method prepares SDS-polyacrylamide gel (SDS-PAGE) with reference to volume such as Wang Jiazheng (2000).Spacer gel concentration is 5%, and resolving gel concentration is 12%.Sample to be checked is boiled 5min, get 10 μ L and add in the gel point sample hole, under electric field action, carry out electrophoresis.Electrophoretic buffer is the Tris-glycine.Voltage is 80v/cm, and voltage is elevated to 160v/cm when treating tetrabromophenol sulfonphthalein arrival spacer gel bottom.When treating tetrabromophenol sulfonphthalein, stop electrophoresis, take off gel, place the dyeing of 1% Xylene Brilliant Cyanine G solution to spend the night, decolour with destainer near the gel bottom.Electrophoresis result (Fig. 4) shows that the molecular weight of 4CCK fusion rotein is about 21kD.Along with the prolongation of induction time, the amount of expression product progressively increases, and tends towards stability behind the 3h.With VL gel imaging system BioID++ program electrophoresis result is carried out scanning analysis, result's following (table 1).
The content (%) of table 1CCK33 peptide 4 concatermers (4CCK) in total bacterial protein
Induction time (h) | 1 | 2 | 3 | 4 |
4CCK(%) | 24.0 | 25.1 | 25.6 | 25.8 |
Western Blot analytical procedure is as follows: the SDS-PAGE electrophoresis does not dye to gel after finishing.Cut nitrocellulose filter and two filter paper big or small together, at soaking at room temperature 15min in transfering buffering liquid, by the order of sponge-filter paper-gel-nitrocellulose filter-filter paper-sponge transfer printing is installed and presss from both sides with the gel after the electrophoresis with gel phase.To in the folder side joint positive pole of film be arranged, and under the voltage of 15V, shift 1.5h.Film after the transfer spends the night with the sealing of 5% skim-milk, discards confining liquid, washes film three times with TBS.Discard TBS, add the anti-CCK-8 peptide of rabbit positive serum (Sigma company), gentle jolting 3h with 1000 times of dilutions of 1% skim-milk.Discard an antiserum(antisera), wash film three times, about at every turn 10min with TBS.Discard TBS, add two anti-(the goat anti-rabbit igg antibody of horseradish peroxidase-labeled, magnificent companies) with 50 times of dilutions of 1% skim-milk, gentle jolting is 1h at least.Discard two and resist, wash film three times with TBS, about at every turn 30min.Discard TBS, add the colour developing of DAB solution, the jog nitrocellulose filter treats that colour developing reaches to a certain degree, washes the reaction of film color development stopping with distilled water.The visible specific band (Fig. 6) in the 21kD position.
The purifying of 7 cholecystokinin 33 peptides, 4 concatermers (4CCK)
Behind the E-4CCK microorganism collection with the IPTG abduction delivering, in carry out on 0 ℃ of ice bath ultrasonication, centrifugal after, precipitation is dissolved with the urea of 8mol/L.Under the sex change condition, carry out purifying with 50%Ni-NTA purifying resin.Concrete operations are as follows:
In IPTG abduction delivering 4h sampling, 4 ℃ of centrifugal 2min of 10000r/m collect thalline and are kept at-20 ℃ with 1000mL genetic engineering bacterium E-4CCK; The bacterium bacterial sediment of preserving is put the 15min that thaws on ice, add 20mL Buffer B suspension bacterium, suspension gentleness on condition of ice bath underlying shaking table is shaken 30min, abundant sex change cracking inclusion body, carry out ultrasonication then in ice bath, ultrasonic time is 6 seconds, and be 8 seconds pitch time, power is 400W, broken number of times 40 times.4 ℃ of centrifugal 20min of 10000r/m get supernatant and carry out purifying.
Pack in the purification column Buffer B of 20mL with purifying resin 50%Ni-NTA mixing, takes out 4mL dress post, treat that resin precipitated is good after, the switch of purification column cuts out, usefulness Buffer B balance purification column needs 12h approximately.Clean purification column with Buffer B.When treating that Buffer B is about to flow to end (but can not drain off) cracking supernatant 2mL is slowly joined in the purification column, cross the post wash-out with 4mLBuffer C, 4mL Buffer D, 4mL Buffer E successively then, and collect sample respectively.Purifying buffer B uffer B, Buffer C, Buffer D, the necessary fresh preparation of Buffer E, it is composed as follows:
Buffer B:100mmol/L NaH2PO4,10mmol/L Tris HCL, 8mol/L urea, pH8.0;
Buffer C:100mmol/L NaH2PO4,10mmol/L Tris-HCL, 8mol/L urea, pH6.3;
Buffer D:100mmol/L NaH
2PO
4, 10mmol/L Tris-HCL, 8mol/L urea, pH5.9;
Buffer E:100mmol/L NaH
2PO
4, 10mmol/L Tris-HCL, 8mol/L urea, pH4.5.
Above sample is carried out SDS-PAGE analyze, in the eluate of visible Buffer E purer target protein (Fig. 7) is arranged.
Albumen through the 50%Ni-NTA resin purification is dialysed with dialysis tubing again.With cotton cord that one side-line of dialysis tubing is tight, an amount of protein purification solution is contained in the dialysis tubing, again the opposite side of dialysis tubing is fastened with cotton cord; The dialysis tubing that purifying protein is housed is placed among the dialyzate I of large volume, on magnetic stirring apparatus, stirs 4~5h under 4 ℃.Change dialyzate II, III, IV, V, VI, VII, VIII successively, repeat the aforesaid operations process.Dialyzate composed as follows:
Dialyzate I:6mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH4.5;
Dialyzate II:6mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH5.5;
Dialyzate III:4mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH5.5;
Dialyzate IV:4mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH6.5;
Dialyzate V:2mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH6.5;
Dialyzate VI:2mol/L urea, 10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH7.5;
Dialyzate VII:10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH7.5;
Dialyzate VIII:10mmol/L Tris-HCL, 0.1mol/L NaH
2PO
4, pH8.5.
Last dialysis tubing is placed in the physiological saline of large volume, stirs 4~5h under 4 ℃ on magnetic stirring apparatus.Dialysis tubing is embedded in and carries out albumen in the silica gel and concentrate, and the albumen after concentrating is taken out be placed on 4 ℃ of refrigerators and preserve.Albumen after concentrating is carried out SDS-PAGE detect, the albumen on the electrophorogram after the visible dialysis has only a band (Fig. 8).
8, the expression of cholecystokinin 33 peptides, 6 concatermers (6cck) in intestinal bacteria
At first, will be through recombinant plasmid pRSETA-6CCK Transformed E .coLi BL-21 (DE3) recipient bacterium of order-checking evaluation, the single reorganization bacterium colony of picking, be inoculated in the 3mL LA liquid nutrient medium, after 5h is cultivated in 37 ℃ of joltings, be PCR with Auele Specific Primer P3/P4 and identify, positive bacteria is for expressing the genetic engineering bacterium of 6CCK, called after E-6CCK.
Then, it is streak culture 16~20 hours in 37 ℃ on the LA flat board to get E-6CCK.The single bacterium colony of picking in 37 ℃ of cultivations 12~16 hours, places 4 ℃ of refrigerators to preserve bacterium liquid in the LA liquid nutrient medium.In 1% ratio inoculation LA liquid nutrient medium, 37 ℃, when the 200r/m jolting was cultured to OD600 value and reaches 0.5 left and right sides, adding final concentration was the IPTG of 1mmol/L, respectively behind adding IPTG 0,1,2,3h gets bacterium liquid, analyze with SDS-PAGE.The SDS-PAGE method is with reference to implementation method 6.Electrophoresis result (Fig. 5) shows that the molecular weight of 6CCK fusion rotein is about 27kD.Along with the prolongation of induction time, the amount of expression product progressively increases, and tends towards stability behind the 3h.With VL gel imaging system BioID++ program electrophoresis result is carried out scanning analysis, result's following (table 2).
The content (%) of table 2 CCK33 peptide 6 concatermers (6CCK) in total bacterial protein
Induction time (h) | 1 | 2 | 3 |
6CCK(%) | 24.1 | 32.1 | 34.6 |
The ELISA of 10 change of serum C CK antibody detects
4CCK fusion rotein with purifying is an antigen, sets up enzyme linked immunosorbent assay (ELISA) method that detects change of serum C CK antibody.Use the square formation method, the 4CCK fusion rotein of purifying is cushioned the liquid dilution with 10 10,1020,10 40,10 80,100 160,10 320,10 640 ratio with bag, every hole adds 4 ℃ of bags of 100 μ L and is spent the night.Discard coating buffer, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, and after patting dry cleaning buffer solution on the gauze, every hole adds confining liquid (5% skim-milk) 100 μ L, 37 ℃ of sealing 2h.Discard confining liquid, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, on gauze, pat dry cleaning buffer solution, every hole adds with 10 10,10 102,10 103,10 104,10 105,10 106 ratio anti-ly (exempts from anti-CCK positive serum or the preceding rabbit negative serum of immunity with one of dilution buffer liquid dilution, wherein the CCK positive serum is available from Huaxi Medical Univ) 100 μ L, 37 ℃ of reaction 1h.Discarding one resists, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, after patting dry cleaning buffer solution on the gauze, every hole adds two anti-(the goat anti-rabbit igg antibody of horseradish peroxidase-labeled) 100 μ L with the dilution in 1: 1000 of dilution buffer liquid, 37 ℃ of reaction 1h.Discarding two resists, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, and after patting dry cleaning buffer solution on the gauze, every hole adds colour developing damping fluid 100 μ L, (about 10~30min) add lmol/L H2SO4 100 μ L termination reactions, read the OD450 value on microplate reader when reaching the colour developing peak.Envelope antigen 4CCK fusion rotein is in 1: 80 times of dilution (4CCK concentration is equivalent to 0.2mg/ml), and positive serum reaches maximum (table 3) 1: 102 o'clock P/N value, and the concentration of antigen-antibody of this moment is defined as the suitableeest working concentration.
Table 3 antigen (4CCK) is determined with antibody (positive serum) best effort concentration
The antigen diluent multiple | Serum diluting multiple | |||||
1∶10 1 | 1∶10 2 | 1∶10 3 | 1∶10 4 | 1∶10 5 | 1∶10 6 | |
1∶10 | 4.10 | 4.06 | 5.07 | 5.09 | 3.52 | 2.03 |
1∶20 | 5.58 | 5.83 | 3.04 | 3.74 | 1.96 | 2.15 |
1∶40 | 4.98 | 6.07 | 6.74 | 4.19 | 4.03 | 2.20 |
1∶80 | 6.35 | 9.03 | 7.91 | 4.00 | 2.41 | 2.28 |
1∶160 | 6.36 | 6.91 | 4.90 | 3.59 | 3.04 | 1.87 |
1∶320 | 5.53 | 3.72 | 3.95 | 3.28 | 1.19 | 1.48 |
1∶640 | 5.59 | 3.71 | 3.58 | 3.62 | 2.73 | 1.58 |
This method has good specificity, detects non-immune chicken, mouse, rabbit anteserum with this method, and its P/N is all less than 2.
11 active immunity CCK fusion roteins are to the influence of meat chicken production performance
The fusion rotein 4CCK of purifying is made oil emulsion vaccine carry out the fryer immunization experiment, the content of 4CCK fusion rotein is 1mg/mL in the vaccine.To be divided into 2 groups at random behind 360 beard feeding of broiler to 20 ages in days, every group of three repetitions, each repeats 60 chickens, and 1 group is control group, and 2 groups is the 4CCK immune group.The immunity of 20 ages in days later on every immunity in 20 days once, is total to immunity 3 times for the first time.Feeding of broiler to 90 age in days finishes.When experiment finishes, weigh and add up feed consumption rate, calculate the average weight gain of full phase, average food consumption and feedstuff-meat ratio.The result shows the body weight gains of 4CCK immune group apparently higher than control group (P<0.05), and food consumption is also apparently higher than control group (P<0.05), and feedstuff-meat ratio also descends to some extent, but difference not significantly (P>0.05).
Table 3 CCK immunity is to the influence of chicken production performance: body weight, food consumption and feedstuff-meat ratio
Group | Body weight gains (g/ only) | Food consumption (g/ only) | Feedstuff-meat ratio |
Control group | 808.64±12.80 | 3031.62±71.34 | 3.75±0.03 |
The CCK immune group | 861.43±23.80 | 3129.05±45.90 | 3.63±0.13 |
The variation of change of serum C CK antibody after the 12 usefulness 4CCK fusion protein immunization fryer
The fusion rotein 4CCK of purifying is made oil emulsion vaccine carry out the fryer immunization experiment, the content of 4CCK fusion rotein is 1mg/mL in the vaccine.To be divided into 2 groups at random behind 360 beard feeding of broiler to 20 ages in days, every group of three repetitions, each repeats 60 chickens, and 1 group is control group, and 2 groups is the 4CCK immune group.The immunity of 20 ages in days later on every immunity in 20 days once, is total to immunity 3 times for the first time.Feeding of broiler to 90 age in days finishes.When 35,55 and 90 day age, took a blood sample respectively, measure CCK antibody in the serum.
On 96 hole enzyme plates, every hole adds that 4 ℃ of bags are spent the night with 0.2mg/ml4CCK fusion rotein 100 μ L.Discard coating buffer, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, and after patting dry cleaning buffer solution on the gauze, every hole adds 5% skim-milk, 100 μ L confining liquids, 37 ℃ of sealing 2h.Discard confining liquid, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, pats dry cleaning buffer solution on gauze, and every hole adds the most anti-100 μ L of suitable weaker concn, 37 ℃ of reaction 1h.Discard one and resist, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, and after patting dry cleaning buffer solution on the gauze, every hole adds two anti-100 μ L with dilution in 1: 1000,37 ℃ of reaction 1h.Discard two and resist, enzyme plate is washed 3 times with 200 μ L cleaning buffer solutions in every hole, and after patting dry cleaning buffer solution on the gauze, every hole adds colour developing damping fluid 100 μ L, and (about 10~30min) add 1mol/L H when reaching the colour developing peak
2SO
4100 μ L termination reactions read OD on microplate reader
450Value.Represent antibody horizontal with P/N.The result that the blank group detects for 3 times is P/N<2, and three times results change amplitude is very little.And immune group detects P/N for 3 times all above 2, and the back two times result is higher than (table 4) for the first time.
The ELISA detected result (P/N) of CCK antibody in the chicken blood after the table 4 recombinant C CK immunity
Group | The mensuration age in days (my god) | ||
35 | 55 | 90 | |
Control group | 1.350±0.016 | 1.566±0.045 | 1.568±0.045 |
Immune group | 2.181±0.137 | 2.761±0.191 | 2.675±0.089 |
Sequence table
SEQUENCE LISTING
<110〉Agricultural University Of South China
<120〉tandem expression of cholecystokinin active fragments and application thereof
<130>15
<160>2
<170>PatentIn version 3.3
<210>1
<211>99
<212>DNA
<213〉cholecystokinin-33 (Cholecystokinin-33, CCK-33)
<220>
<221>cDNA seqence
<222>(1)..(99)
<220>
<221>CDS
<222>(1)..(99)
<400>1
ggt tct act ggc cgc ttc tct gtc ctt ggc aac cgt gta cag agc att 48
Gly Ser Thr Gly Arg Phe Ser Val Leu Gly Asn Arg Val Gln Ser Ile
1 5 10 15
gat ccg acg cac cgt att aat gac cgt gac tac atg ggc tgg atg gat 96
Asp Pro Thr His Arg Ile Asn Asp Arg Asp Tyr Met Gly Trp Met Asp
20 25 30
ttt 99
Phe
<210>2
<211>33
<212>PRT
<213〉cholecystokinin-33 (Cholecystokinin-33, CCK-33)
<400> 2
Gly Ser Thr Gly Arg Phe Ser Val Leu Gly Asn Arg Val Gln Ser Ile
1 5 10 15
Asp Pro Thr His Arg Ile Asn Asp Arg Asp Tyr Met Gly Trp Met Asp
20 25 30
Phe
Claims (9)
1. nucleotide sequence of cholecystokinin active fragments of encoding, it is characterized in that: it is in series end to end by the sequence that two or more have SEQ ID NO:1.
2. recombinant expression vector contains the described sequence of claim 1.
3. host cell or transformant contain the described recombinant expression vector of claim 2.
4. cholecystokinin polypeptide, it is characterized in that: it is in series end to end by the sequence that two or more have SEQ ID NO:2.
5. obtain the method for the described polypeptide of claim 4, comprising:
A. make up the described recombinant expression vector of claim 2;
B. the recombinant expression vector transformed into escherichia coli is expressed;
C. separation and purification expression product.
6. recombinant vaccine contains the described polypeptide of claim 4.
7. the application of the described polypeptide of claim 4 in preparation cholecystokinin antibody.
8. the described polypeptide of claim 4 is used for application in the reagent of vitro detection serum cholecystokinin antibody horizontal in preparation.
9. the fodder additives that contains the described cholecystokinin polypeptide of claim 4.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2005100115839A CN1333077C (en) | 2005-04-15 | 2005-04-15 | Cascade expression of active fragment of cholecystokinin and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2005100115839A CN1333077C (en) | 2005-04-15 | 2005-04-15 | Cascade expression of active fragment of cholecystokinin and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1687412A CN1687412A (en) | 2005-10-26 |
CN1333077C true CN1333077C (en) | 2007-08-22 |
Family
ID=35305454
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB2005100115839A Expired - Fee Related CN1333077C (en) | 2005-04-15 | 2005-04-15 | Cascade expression of active fragment of cholecystokinin and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1333077C (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103865934B (en) * | 2014-03-26 | 2017-02-22 | 中国人民解放军成都军区疾病预防控制中心 | Bungatotoxin antigen epitope gene and application of bungatotoxin antigen epitope gene to preparation of gene vaccine and antigen |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1120843A (en) * | 1993-04-15 | 1996-04-17 | 格拉克索有限公司 | 1,5-benzodiazepine derivatives having CCK antagonistic or agonistic activity |
-
2005
- 2005-04-15 CN CNB2005100115839A patent/CN1333077C/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1120843A (en) * | 1993-04-15 | 1996-04-17 | 格拉克索有限公司 | 1,5-benzodiazepine derivatives having CCK antagonistic or agonistic activity |
Non-Patent Citations (3)
Title |
---|
缩胆囊素的生物学功能研究进展 舒鼎铭,饲料工业,第25卷第11期 2004 * |
缩胆囊素的生物学功能研究进展 舒鼎铭,饲料工业,第25卷第11期 2004;鲑鱼隆钙素串联基因的克隆,表达及重级蛋白生物学活性 黄迎春等,生物技术,第13卷第6期 2003 * |
鲑鱼隆钙素串联基因的克隆,表达及重级蛋白生物学活性 黄迎春等,生物技术,第13卷第6期 2003 * |
Also Published As
Publication number | Publication date |
---|---|
CN1687412A (en) | 2005-10-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104593397B (en) | A kind of enterotoxigenic escherichia coil polyvalent antigen gene order of optimization and its application in preventing post-weaning diarrhea | |
CN105949287A (en) | A-type avibacterium paragallinarum immunizing protective antigen and application thereof | |
CN105087616B (en) | A kind of fusion of mycoplasma hyopneumoniae and preparation method thereof | |
CN112851792A (en) | Preparation method and application of grass carp TNF-alpha recombinant protein | |
CN109207417A (en) | Dual Avian tubercula plain agglutination test antigen of white diarrhea-J subgroup avian leucosis and preparation method thereof | |
KR100872042B1 (en) | Cell Surface Expression Vector of Myostatin and Microorganisms Transformed Thereby | |
CN101376887B (en) | Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide | |
CN1333077C (en) | Cascade expression of active fragment of cholecystokinin and application thereof | |
CN101955942B (en) | DNA (Deoxyribonucleic Acid) molecule for encoding pig alpha-interferon and recombinant colibacillus as well as application thereof | |
CN102277373B (en) | Schistosoma japonica vaccine expression vector for attenuated salmonella secretion expression and use thereof | |
CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
CN104673735B (en) | A kind of cortex chalone growth hormone release inhibiting hormone double expression DNA vaccination and preparation method and application | |
CN102766645A (en) | Oral recombinant protein TAT-GH for promoting ricefield eel growth, and preparation method and application thereof | |
WO2009051290A1 (en) | Surface expression vector for fusion protein of myo-2 peptide multimer and myostatin, and microorganism transformed by thereof | |
US6316004B1 (en) | Chimeric somatostatin containing protein and encoding DNA, plasmids of expression, method for preparing chimeric protein, strain-producers, immunogenic composition, method for increasing the productivity of farm animals | |
CN106397602B (en) | A kind of reinforced chicken Marek's disease protein engineering vaccine of molecule adjuvant | |
CN113181349B (en) | M cell-targeted multi-epitope oral vaccine and application thereof in hydatid vaccine | |
CN103864939A (en) | mGM-CSF/beta hCG fusion protein, and preparation method and application thereof | |
CN101538572B (en) | Recombinant lactic acid bacteria containing recombinant alpha-2b interferon and application thereof | |
CN116987201B (en) | Multimeric recombinant protein for regulating and controlling reproductive capacity of mammal, preparation method and application | |
CN117003898B (en) | LHRH4-CRM197-LF multimeric recombinant protein and preparation method and application thereof | |
CN102181437A (en) | gAd gene of porcine globular adiponectin and protein encoded by gAd gene and application | |
CN110526959A (en) | A kind of foot-and-mouth disease virus antigen, the gene for expressing foot-and-mouth disease virus antigen and its recombinant vector and Recombinant Lactococcus lactis | |
RU2614115C1 (en) | Recombinant somatostatin-containing protein, method for production, injecting drug to increase meat and dairy efficiency of agricultural animals, and method for drug application | |
CN109868281A (en) | A method of Gluca Gen sample peptide -1 is expressed using bacillus subtilis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070822 Termination date: 20110415 |