CN1329506C - Recombinant bacterium with granular methane monooxygenase activity and application thereof - Google Patents
Recombinant bacterium with granular methane monooxygenase activity and application thereof Download PDFInfo
- Publication number
- CN1329506C CN1329506C CNB2005100984092A CN200510098409A CN1329506C CN 1329506 C CN1329506 C CN 1329506C CN B2005100984092 A CNB2005100984092 A CN B2005100984092A CN 200510098409 A CN200510098409 A CN 200510098409A CN 1329506 C CN1329506 C CN 1329506C
- Authority
- CN
- China
- Prior art keywords
- gene
- rhodococcus
- methane monooxygenase
- granular
- reorganization bacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention discloses a recombinant bacterium with methane monooxygenase activity and an application thereof. The recombinant bacterium with granular methane monooxygenase activity provided by the present invention is a strain which expresses granular methane monooxygenases and is obtained by that a fusion gene which is composed of a coding gene of a granular methane monooxygenase and a promoter sequence of a desulfurized gene is introduced in rhodococcus, and the mixture is screened, wherein the promoter sequence of the desulfurized gene is positioned on the upper stream of the coding gene of the granular methane monooxygenase. The recombinant bacterium thoroughly avoids the influence of methanol dehydrogenase genes, realizes that methane oxidation stays at the reaction step of methanol, overcomes the defects of wild type methane-oxidizing bacteria and is easily cultured. The recombinant bacterium can liquefy the alkane of natural gas to form relevant alcohol, convert marsh gas into methanol and oxidize propene to form 1, 2-epoxy propane.
Description
Technical field
The present invention relates to a kind of reorganization bacterium and application thereof with granular methane monooxygenase activity.
Background technology
Methyl alcohol is a kind of important chemical material, and a year consumption is only second to ethene, propylene and benzene, occupies the 4th.Can prepare products such as propylene (MTP), alkene (MTO), dimethyl formamide, methyl-formiate, methylamine, methylcarbonate and ethylene glycol from methyl alcohol.Along with the progressively exhaustion of petroleum resources, methyl alcohol begins to substitute traditional fossil oil in many aspects, is used to produce Fuel Petroleum, dimethyl ether fuel and gasoline dope, and therefore, the market requirement of methyl alcohol is increasing.At present, preparation methyl alcohol mainly is to obtain by oxidizing of methylene.Because the methane molecule quite stable, c h bond can be 104 kcalmol
-1, therefore, oxidizing of methylene generates methyl alcohol needs very harsh condition.Process modification and catalyzer improvement through for many years still need 255 ℃ temperature and the pressure of 5～15MP in the Chemical Manufacture, just can make conversion of natural gas is methyl alcohol.And natural methane-oxidizing bacteria relies on intravital methane monooxygenase, just methane oxidation can be become methyl alcohol at normal temperatures and pressures.Methane monooxygenase not only can become methyl alcohol with methane conversion, but also can react by other a series of single oxygenation of catalysis, can be widely used in bio-transformation and environmental improvement.If methane monooxygenase can be expressed, develop a kind of cellular form biological catalyst, can be methyl alcohol just so at normal temperatures and pressures with conversion of natural gas.This will reduce the production cost of methyl alcohol greatly, be a kind of high energy saving, eco-friendly methanol process.Simultaneously, be that raw material can provide cheap methane by the anaerobic methane fermentation with the renewable resources, be an approach that has potentiality that realizes cycle industrial.Therefore the research and development of the application technology as the second resource of methane have important industrial application value.
Methane monooxygenase (EC.1.14.13.25, Methane Monooxygenase, be called for short MMO) divide two kinds, a kind of is methane monooxygenase (the soluble methane monooxygenase of solubility, be called for short sMMO), another kind is to find later granular methane monooxygenase (particulate methane monooxygenase is called for short pMMO).Although sMMO and pMMO can both generate methyl alcohol by oxidizing of methylene, still there is a lot of differences in the two.SMMO is present in the tenuigenin, and its substrate scope is wide, and many hydrocarbon compounds and aromatics can both be oxidized.Compare with sMMO, the substrate selective relative narrower of pMMO, can only oxidation five carbon with interior alkane and alkene, can not oxidation aromatic hydrocarbon.But pMMO but has the advantage that a lot of sMMO do not possess.PMMO is present on the cytolemma rather than in the tenuigenin.This character helps contacting of substrate and enzyme and reaction product is in time discharged, and means that this enzymatic reaction mass transfer resistance is lower, thereby help using in bio-transformation.There is quaternary structure in pMMO, forms (being respectively the pmoA of pmoC, 27kDa of 23kDa and the pmoB of 45kDa, Genbank U31650 AF186586) by three subunits, and pMM0 is α
3β
3γ
3The tripolymer structure, cupric ion is arranged in pmoB.Although obtaining a series of progress aspect the molecular studies of pMMO enzyme, and the pmo gene of Methyllococcus capsulatus (Bath) and OB3b cloning and sequencing, but it is very little that the reorganization heterogenous expression of pMMO makes progress, and do not express successfully in colibacillus and other host cells so far.
Although utilize the wild-type methane-oxidizing bacteria can be with methane conversion methyl alcohol, also there be a series of technical problems that are difficult to overcome in it in large-scale industrial application.At first, the cultivation of methane-oxidizing bacteria is difficulty relatively, and specific growth rate is extremely slow mutually with the microorganism of other industrial application, and the cell density that can access is low.Although can promote methane oxidizing bacteria growth by adding special substrate (methyl chloride, organic acid, VITAMIN or methyl alcohol etc.), its speed of growth is still well below other mushroom.Secondly, utilize wild methane-oxidizing bacteria to carry out in the process of methane conversion methyl alcohol, the accumulation of methyl alcohol is wayward.In these bacterium, all contain methanol dehydrogenase, so methyl alcohol can be oxidized into formaldehyde, the cell anabolism that further enters further.If add special chemical reagent, optionally suppress the activity of methanol dehydrogenase, though so temporarily promote the accumulation of methyl alcohol, the pathways metabolism of cell is interrupted, and has a strong impact on the metabolic activity of cell, and then stops the methane oxidation reaction.This mainly is because for methane-oxidizing bacteria, after can only entering corresponding pathways metabolism by formaldehyde, the required NADH of MMO oxidizing of methylene could produce, produce this step of methyl alcohol if therefore cell is controlled at, when original NADH was exhausted in the born of the same parents, reaction had just stopped.
Summary of the invention
The purpose of this invention is to provide a kind of reorganization bacterium with granular methane monooxygenase activity.
Reorganization bacterium with granular methane monooxygenase activity provided by the present invention, be to import rhodococcus by the fusion gene that the promoter sequence of the encoding gene of granular methane monooxygenase (pMMO) and desulfurization gene is formed, the bacterial strain that screening obtains expressing granular methane monooxygenase is the reorganization bacterium with granular methane monooxygenase activity; The promoter sequence of described desulfurization gene is positioned at the upstream of the encoding gene of described granular methane monooxygenase (pMMO).
Described rhodococcus can be the rhodococcus erythropolis (Rhodococcus erythropolis) of Rhod, Rhodococcus aichiensis, Rhodococcus chlorophenolicus, Rhodococcuscoprophilus, Rhodococcus equi, Rhodococcus fascians, Rhodococcus globerulus, Rhodococcus luteus, Rhodococcus matinonascens, Rhodococcus Maris, Rhodococcus rhodnii, Rhodococcus rhodochrous or Rhodococcus tuber.
Described rhodococcus erythropolis (Rhodococcus erythropolis) is preferably rhodococcus erythropolis (Rhodococcuserythropolis) LSSE8-1.
The encoding gene of described granular methane monooxygenase is U31650 AF186586 at the Genbank sequence number, and can obtain in accordance with the following methods: the genomic dna with Methylosinus trichosporium OB3b is a template, carries out pcr amplification by primer 5 ' ATGAATTCAACAACAGAGACAACAG 3 ' and 5 ' AAAGCTTCCAAACGCCGCATTCTATC 3 ' and obtains.
The nucleotides sequence of the promotor of described desulfurization gene is classified as among the Genbank among the sequence number L37363 from the 1st-768 deoxynucleotides of 5 ' end; The promotor of described desulfurization gene can obtain in accordance with the following methods: the genomic dna with rhodococcus erythropolis LSSE8-1 is a template, uses primer 1:5 ' ACAAGCTTGCACGGCTCCGGGCAGTTC 3 ' and primer 2: 5 ' ACGAATTCATCGCG TATGCGTCCTTTA 3 ' carries out pcr amplification and obtains.
Described encoding gene and the fusion gene formed of the promoter sequence of desulfurization gene by granular methane monooxygenase (pMMO) forms SEQ ID № in the sequence table: 1 dna sequence dna.
Described encoding gene and the fusion gene formed of the promoter sequence of desulfurization gene by granular methane monooxygenase (pMMO) can import rhodococcus erythropolis by inserting the described recombinant expression vector that contains that existing procaryotic cell expression carrier obtains.
Described procaryotic cell expression carrier can be the plasmid vector that pBS305, pMVS301 or pRESQ etc. can duplicate in rhodococcus.
The recombinant expression vector that contains described fusion gene is pBS305-dszpmo; Described pBS305-dszpmo is that the fusion gene that will be made up of the promoter sequence of the encoding gene of granular methane monooxygenase and desulfurization gene is inserted between the HindIII restriction enzyme site of pBS305 and obtains.
Second purpose of the present invention provides a kind of method of utilizing above-mentioned reorganization bacterium to express granular methane monooxygenase.
Expression granular methane monooxygenase method provided by the present invention is to cultivate above-mentioned reorganization bacterium with granular methane monooxygenase activity, carries out abduction delivering, obtains granular methane monooxygenase.
Be that described reorganization bacterium with methane monooxygenase activity is cultured to logarithmic phase or logarithm later stage described period of carrying out abduction delivering in containing the substratum of element sulphur.
The described substratum that contains element sulphur can be the substratum commonly used that contains element sulphur of cultivating rhodococcus erythropolis LSSE8-1, specifically can be the substratum that contains following composition: 1000 milliliters of deionized waters, KH
2PO
42.44 gram; Na
2HPO
412H
2O 14.03 grams; NH
4Cl 2.00 grams; MgCl
26H
2O 0.36 gram; CaCl
22H
2O 0.001 gram FeCl
36H
2O 0.001 gram MnCl
24H
2O 0.004 gram; Glucose 10 grams, Na
2SO
41mmol/L.
In the described method, can in no element sulphur substratum, cultivate 2-4 hour, carry out abduction delivering being cultured to the logarithmic phase or the thalline in logarithm later stage.
The present invention selects to be suitable for the microorganism rhodococcus of industrial application, made up reorganization bacterium with granular methane monooxygenase activity, thoroughly avoid the influence of methanol dehydrogenase gene, make methane oxidation rest on this step reaction of methyl alcohol, overcome the defective of wild-type methane-oxidizing bacteria, easier cultivation (can with the culture medium culturing that contains common carbon sources such as glucose).The present invention also utilizes the reorganization bacterium with granular methane monooxygenase activity successfully to solve the heterogenous expression problem of granular methane monooxygenase.This reorganization bacterium can become corresponding alcohols with the alkane liquefaction of Sweet natural gas, biogas can be converted into methyl alcohol, propylene oxidation can be become 1,2 epoxy prapane.The hydroxylation that can be used for hydrocarbon compound in environment difficult degradation compound such as the oil decomposes, thereby can be used for the biological treating of environment.
Description of drawings
Fig. 1 is the restriction analysis electrophorogram of pMD-T-dsz and pMD-T-pmoCAB
Fig. 2 is the HindIII single endonuclease digestion analytical results electrophorogram of pBS305-dszpmo
Fig. 3 is the gas chromatographic analysis result of sole carbon source cultivation after LSSE8-1/pBS305-dszpmo6 hour for ethane
Embodiment
Experimental technique among the following embodiment if no special instructions, is ordinary method.
With the culture medium culturing rhodococcus erythropolis LSSE8-1 that contains following composition (this bacterium is available from China Committee for Culture Collection of Microorganisms common micro-organisms center): contain 2.44g KH in every liter of solution
2PO4,14.03g Na
2HPO412H
2O, 0.3589g MgCl
26H
2O, 0.001g CaCl
22H
2O, 0.001g FeCl
36H
2O, 0.004g MnCl
24H
2O, 1.45ml glycerine and 2.00g NH
4Cl, 0.1mmol/L dimethyl sulfoxide (DMSO), pH7.0.Wherein, the 0.1mmol/L dimethyl sulfoxide (DMSO) is as unique sulphur source.After cultivating 2-4 days, get 3 milliliters of bacterium liquid, centrifugal collection thalline extracts genomic dna.With this genomic dna is template, uses primer 1:5 '-AC
AAGCTTGCACGGCTCCGGGCAGTTC 3 ' (nucleotides sequence of band underscore is classified the recognition sequence of HindIII as) and primer 25 '-AC
GAATTCATCGCGTATGCGTCCTTTA 3 ' (nucleotides sequence of band underscore is classified the recognition sequence of EcoRI as) carries out pcr amplification.Wherein, amplification reaction condition is as follows: 94 ℃ earlier, 30 round-robin amplified reactions are carried out in pre-sex change after 4 minutes; The circulating reaction condition is: 94 sex change 1 minute, annealed 1 minute for 54 ℃, and 72 ℃ were extended 1 minute; After 30 loop ends again 72 ℃ replenish to extend 4 minutes.Obtain the fragment of the 0.8kb of expection, be the promoter fragment that contains desulfurization gene dsz.
Get the 13ml methane oxidation bacterium culture medium sterilization back of packing in the culturing bottle of 100ml and insert Methylosinustrichosporium OB3b (Sullivan JP et al.Methanotrophs, Methylosinustrichosporium OB3b, sMMO, and their application to bioremediation, Crit.Rev.Microbiol., 1998,4 (24): 335-373; Takeguchi M et al., Propertiesof the membranes containing the part iculate methane monooxygenase fromMethylosinus trichosporium OB3b, Biometals, 1998,11:229-234) seed liquor.Add 20 milliliter methane gas with the strainer of syringe by 0.2 μ m every day, 30 ℃ of 150rpm cultivate two week the back collect thalline, extract total DNA.With this DNA is template, by primer 5 ' AT
GAATTCAACAACAGAGACAACAG 3 ' (nucleotides sequence of band underscore is classified the recognition sequence of EcoRI as) and 5 ' A
AAGCTTCCAAACGCCGCATTCTATC 3 ' (nucleotides sequence of band underscore is classified the recognition sequence of HindIII as) carries out pcr amplification reaction.Reaction conditions is as follows: 94 ℃ of pre-sex change of elder generation 5 minutes; Be 94 ℃ of sex change 1 minute with cycling condition then, annealed 1 minute for 54 ℃ that 30 round-robin amplified reactions were carried out in 72 ℃ of extensions in 3 minutes; 72 ℃ of restock extended 7 minutes after circulation was finished, and the fragment that obtains the 3.5kb size promptly contains the fragment of the encoding gene of granular methane monooxygenase.
The dna fragmentation that two sections PCR obtain is transformed into colibacillus DH5 α respectively with after cloning vector pMD-T simple carrier (available from TaKaRa company) is connected through behind the purifying, through blue hickie screening, obtain positive colony, the upgrading grain is identified plasmid with HindIII and EcoR I double digestion, the result as shown in Figure 1, contain the promoter fragment of desulfurization gene dsz and recombinant plasmid that cloning vector pMD-T simple obtains behind HindIII and EcoR I double digestion, obtained the band (ellipse shows the purpose band) of 0.8kb; Contain the fragment of encoding gene of granular methane monooxygenase and recombinant plasmid that cloning vector pMD-T simple obtains behind HindIII and EcoR I double digestion, obtained the band (ellipse shows the purpose band) of 3.5kb, proved that the fragment of amplification has been inserted in the plasmid.The recombinant plasmid name pMD-T-dsz of the promoter fragment that contains desulfurization gene dsz that reorganization is correct, the segmental recombinant plasmid that contains the encoding gene of granular methane monooxygenase is named pMD-T-pmoCAB.Among Fig. 1, M is a dna molecular amount standard, and 1 is the restriction analysis of pMD-T-dsz recombinant plasmid, and 2 is the analytical results of pMD-T-pmoCAB recombinant plasmid.Plasmid pMD-T-pmoCAB and pMD-T-dsz are checked order respectively, the result show pMD-T-pmoCAB contain GenBank number for U31650AF186586 from 5 ' the 769th encoding gene (pmoCAB) sequence of end to the granular methane monooxygenase of 4084 deoxynucleotides; PMD-T-dsz contain the Genbank sequence number be among the L37363 from 5 ' promoter sequence of the desulfurization gene dsz of the 1st one 768 deoxynucleotides of end.
After pMD-T-dsz and pMD-T-pmcCAB use HindIII and EcoR I double digestion respectively, obtain having HindIII and EcoRI sticky end the promotor that contains desulfurization gene dsz dna fragmentation and have the fragment of the encoding gene that contains granular methane monooxygenase of HindIII and EcoR I sticky end, these two kinds of dna fragmentations and pBS305 plasmid (Z.Shao, W.A.Dick and R.M.Behki, An improved Escherichia coli-Rhodococcusshuttle vector and plasmid transformation in Rhodococcus spp.Usingelectroporation, letters of Applied Microbiology, 1995,21,261-266.) connection (this carrier needs with HindIII single endonuclease digestion and dephosphorylation before using), with the connection product transformed into escherichia coli DH5 α that obtains, obtain positive colony through blue hickie screening, the upgrading grain, carrying out the HindIII single endonuclease digestion identifies, enzyme is cut result such as Fig. 2, and (1 is dna molecular amount standard, 2 is pBS305-dsz-pmoCAB) shown in, the carrier segments that shows the recombinant fragment that obtains 4.2kb and about 7.9kb, enzyme cut the result with expect consistent.Enzyme is cut the correct plasmid called after pBS305-dsz-pmoCAB of evaluation.PBS305-dsz-pmoCAB is checked order, and the result shows that this plasmid contains the fusion gene sequence that the encoding gene by the promotor of desulfurization gene dsz and granular methane monooxygenase with sequence 1 in the sequence table is formed.PBS305-dsz-pmoCAB is imported rhodococcus erythropolis LSSE8-1 through the electroporation conversion method, transformed bacteria is coated in the substratum 1, screen, obtained the bacterial strain that contains pBS305-dsz-pmoCAB that in substratum 1, to grow, called after LSSE8-1/pBS305-dsz-pmoCAB.
Wherein, the composition of micro-stock solution is:
ZnCl
20.2042 gram MnCl
24H
2O 0.1575g
H
3BO
3 0.0631g Na
2MoO
4·2H
2O 0.0488g
CoCl
2·6H
2O 0.049g KI 0.0834g
CaCl
22H
2O 3.5014g deionized water is settled to 1L
CuCl
2The composition of stock solution is:
Take by weighing CuCl
22H
2O 0.85mg is dissolved in the 1L water, and final concentration is 5mM.
Collect the new fresh thalli of LSSE8-1/pBS305-dsz-pmoCAB, with the substratum of no sulphur towards Xian clean after, after in this substratum, inducing, carry out fluorescence in situ hybridization with following three the 5 ' probes that are modified with the FAM fluorescence dye, observe with fluorescent microscope then, as seen green fluorescence is arranged, illustrate that this gene all transcribed out corresponding RNA under the promotor of desulfurization gene (dsz).
| The pmoC probe | 5’CCAGCGGAATCTCGGTCCAAAG 3’ |
| The pmoA probe | 5’CACCAGAGCGGACGGGAACACC 3’ |
| The pmoB probe | 5’CGATGTCCCAACGGGCGTCCTG 3’ |
The above-mentioned recombinant bacterial strain LSSE8-1/pBS305-dsz-pmoCAB that picking nutrition inclined-plane (substratum 1) is cultivated inserts in 25 milliliters the basic medium.The composition of this basic medium: 1000 milliliters of deionized waters, KH
2PO
42.44 gram; Na
2HPO
412H
2O 14.03 grams; NH
4Cl 2.00 grams; MgCl
26H
2O 0.36 gram; CaCl
22H
2O 0.001 gram FeCl
36H
2O 0.001 gram MnCl
24H
2O 0.004 gram; Glucose 10 grams, Na
2SO
41mmol/L, pH7.0.30 ℃, cultivate after 24-48 hour for 150 rev/mins, will insert again in 500 milliliters the basic medium, after 48-72 hour, centrifugal acquisition thalline.Behind the normal saline flushing thalline, with no element sulphur substratum (1000 milliliters of deionized waters, KH
2PO
42.44 gram; Na
2HPO
412H
2O 14.03 grams; NH
4Cl 2.00 grams; MgCl
26H
2O 0.36 gram; CaCl
22H
2O0.001 restrains FeCl
36H
2O 0.001 gram MnCl
24H
2O 0.004 gram; Glucose 10 grams) on shaking table, cultivated 2-4 hour, induce promptly and finish.Centrifugal collection thalline.
Embodiment 3, reorganization bacterium are converted into ethanol with ethane
(thalline is in logarithmic phase, OD with the LSSE8-1/pBS305-dsz-pmoCAB thalline of embodiment 2
600＞20 o'clock collection thalline) join 5mM MgCl
2In the 10 milliliters of-20mM phosphoric acid buffers, in ethane: the ratio of air=1: 1 is mended into gas, and 30 ℃ following 150 rev/mins were reacted 6 hours, and the centrifuging and taking supernatant carries out gas chromatographic analysis, and the result as shown in Figure 3.Among Fig. 3, dotted line is 1% a aqueous ethanolic solution of standard, and solid line is the supernatant of LSSE8-1/pBS305-dsz-pmoCAB reaction solution, and this result shows has ethanol to exist in the LSSE8-1/pBS305-dsz-pmoCAB reaction solution.
Embodiment 4, has the liquefaction that the active recombinant bacterial strain of pMMO is applied to Sweet natural gas.
LSSE8-1/pBS305-dsz-pmoCAB thalline (OD with embodiment 2
600Collected thalline at＞20 o'clock), join 5mM MgCl respectively
210 milliliters of-20mM phosphoric acid buffers keep 60 micromolar glucose in this damping fluid, in Sweet natural gas: the ratio of air=1: 1 is mended into gas, and 30 ℃ following 150 rev/mins were reacted 12 hours, and Sweet natural gas promptly is converted into methyl alcohol, ethanol, propyl alcohol and butanols etc.
Sequence table
<160>1
<210>1
<211>4084
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400> 1
acaagcttgc acggctccgg gcagttctcg cggcgctgga ggcacggatg ggcaccctca 60
acgaactcac ccaaaccacg ccgatagcga tcctcgccga aaccctcggc tacagccctc 120
agacattgga agctcatgcg cgacgcatcc ggatcgacct ttgcacgcta cgtggcgacg 180
cggctggact gacgctggag gtccgacccg acgtgtgtgg tgtagcgccg cttaacgggt 240
gcgcacggcg ggacatcggc cagctggctt gcccctcctc cgcaggtagt cgaccacccc 300
ttcccgcagc ggtcggaggt gatcgaccgt tagggtcatt tgctcgcaga tcggctgatg 360
ttgccgatcg acgtggtcga cgggacacgc tcgcgattgg catggcgtcc ggtgcataca 420
cgacgatcta accagatcga cggttttgag cgtcggtcaa cgtcgactcg atgcgccgtg 480
cgagtgagat cctttgtggt gcttggctat tgacctcgac aaggatagag attcgaagga 540
cctcggatcg acccaaatgc ggacggccgg cagcggcgaa ggcggccaag tcatcggcac 600
cgtcaccgtc accttgaccc gacgtgcccc gtggttcaag gcctgaattt ggctggtgga 660
gcattgaaat caggtgaagt ttaacggtgg gcacaccccg ggggtggggg tgagactgct 720
tagcgacagg aatctagcca tgattgacat ttaaaggacg catacgcgat gaattcaaca 780
acagagacaa cagccggcgc agccgccggc tcggacgcga tcgttgatct gcgtggcatg 840
tgggtcggtg tcgccggcct gaacatcttc tatctgatcg tccgcattta cgagcagatc 900
tacggctggc gcgcgggcct cgactcgttc gctccggagt tccagacgta ttggctgtcg 960
tggaagaccc gtgaccgcaa cgtcgacgcg gtcgctccgc gcgaggagct gcgccgtcac 1020
gtggtcctgg tcgagtggct ggtggtctac gccgtcgcca tttactgggg cgcgagcttc 1080
ttcacggagc aggacggcac ctggcacatg acggtgattc gcgacacgga cttcacgccg 1140
tcgcacatca tcgagttcta catgagctac ccgatctact cgatcatggc ggtgggcgcg 1200
ttcttctatg cgaagacccg cattccgtat tttgctcatg gcttctcgct ggcgttcctg 1260
atcgtcgcca tcggcccgtt catgatcatc ccgaacgtcg gcctgaacga gtggggccac 1320
accttctggt tcatggaaga gctgttcgtc gctccgctgc attggggctt cgtgttcttc 1380
ggctggatgg cgctcggcgt gttcggcgtc gttctgcaga tcctgatggg cgtcaagcgc 1440
ctcatcggca aggactgcgt cgcggccctg gtcggctgaa gatgaattgg accgcccgac 1500
tttttttaag gggccgggcg gtccgcacgg acatctcgca atccgatagt ctcctgaacg 1560
ggaccttcgt ccgaacggcc gcgcaacgcg gggccggctc gggcggggtt cgggagagaa 1620
gggaacggga ggcacgaaag acaacccggc gcgagaagag tcggggactg gtcgacggct 1680
gcggcgggaa ccgccgggcg gaccgacacc aaggagaaga gtgatgttta catcgaagag 1740
cgggggggca atcgggcctt tccattcggt cgcggaagcg gcgggatgcg tcaagaccac 1800
cgattggatg tttctgacgc tgctgtttct ggcggtgctg ggcggctacc acattcactt 1860
catgctgacg gcgggcgact gggacttctg ggtcgactgg aaagaccgtc gtatgtggcc 1920
gaccgtggtt ccgatcctgg gcgtgacctt cgccgctgcg gcgcaggcgt tcttctggga 1980
gaacttcaag ctgccgttcg gcgcgacctt cgcggtctcc ggcctgctga tcggggagtg 2040
gatcaaccgc tactgcaact tctggggctg gacctatttc ccgatcagcc tggtgttccc 2100
gtccgctctg gtggttccgg cgctgtggct ggacatcatc atgctgctgt cgggctccta 2160
tgtgatcacg gcggttgtgg gctcgctggg ctggggcctt ctgttctacc cgaacaactg 2220
gccggcgatc gcggctctgc atcaggcgac ggagcagcat ggtcagctga tgtccctcgc 2280
ggatctcgtc ggcttccact tcgtccgcac gtcgatgccg gaatatatcc gcatggtcga 2340
gcgcggcacg ctgcgcacct tcggtaagga ggtcgttccg gtggccgcgt tcttctcggg 2400
cttcgtgtcg atgatggtct acttcctgtg gtggttcgtc ggtaagtggt attcgaccac 2460
caaggtgatc cagaagatct gatcgaagag agcaattagc ttctctttgg ttcctcggaa 2520
aagacgagga gcggttcccg gatcggcgat gagatcgccg cgaaggggcc gctccggaga 2580
agacgagtga ggccgcctgg cgctccgcga tgcggacagg gcgggctcca agagaaaact 2640
gggaggttag attcacatga aagctctgga aagaatggcc gaactggcga ccggacgggt 2700
cggaaagctc ctcggcctga gcgttgcggc tgcggtcgcc gcgacggcgg cttcggtggc 2760
cccggcggaa gcgcacggcg agaagtcgca gcaggcgttt ctgcgcatgc gcacgctgaa 2820
ctggtatgac gtgaagtggt cgaagacctc gttgaacgtc aacgagtcga tggttctgtc 2880
gggcaaggtt cacgtcttct cggcgtggcc gcaggcggtc gccaatccga agtcgtcgtt 2940
cctgaacgcc ggcgagcccg gcccggtttt ggttcgcacg gcgcagttca tcggcgagca 3000
gttcgctccg cgctcggtgt cgctcgaggt cggcaaggac tatgcgttct cgatcgatct 3060
gaaggctcgc cgcgccgggc gctggcacgt ccatgctcag atcaacgtcg aaggcggcgg 3120
tccgatcatc ggacccggcc agtggatcga gatcaagggc gacatggccg acttcaagga 3180
tccggtcacg ctgctcgacg gcacgaccgt ggacctcgag acctatggca tcgatcgcat 3240
ctatgcctgg catttcccgt ggatgatcgc ggccgcggcc tggatcctct actggttctt 3300
caagaagggc atcatcgctt cttatcttcg catcagcgaa ggcaaggacg aggagcagat 3360
cggcgatgac gaccgtcgcg tgggcgcgat cgttctcgcg gtgacgatcc tggcgacgat 3420
catcggctat gcggtgacga acagcacctt cccgcgcacg atcccgctgc aggccggctt 3480
gcagaagccg ctgacgccga tcatcgagga aggcaccgcc ggcgttggtc cgcatgtggt 3540
gacggccgag ctcaagggcg gcgtctacaa ggtgccgggc cgtgagctga cgatccaagt 3600
gaaggtgacg aacaagaccg acgagccgct gaagctcggc gagtatacgg cggcgggtct 3660
gcgcttcctg aaccccgacg tgttcacgac caagccggag ttcccggact atctgctggc 3720
cgaccgtggc ctgtcgaccg atccgacccc gctcgccccc ggcgagacga agacgatcga 3780
agtcaaggtg caggacgccc gttgggacat cgagcgtctc tcggacctcg cctatgacac 3840
ggacagccag atcggcggcc tgctgatgtt cttcagcccg tcgggcaagc gctacgccac 3900
cgaaatcggc ggcccggtca ttccgaagtt cgtcgccggc gacatgccct gatcgacttc 3960
gaaatcatac cgaacaaaag ccggccggac cgaaaggtcc ggccggtttt cgttgcggca 4020
gtcatggaaa tgcgaaagat cacgtttata tcgcaatgcg atagaatgcg gcgtttggaa 4080
gctt 4084
Claims (11)
1, the reorganization bacterium that has granular methane monooxygenase activity, be to import rhodococcus by the fusion gene that the promoter sequence of the encoding gene of granular methane monooxygenase and desulfurization gene is formed, the bacterial strain that screening obtains expressing granular methane monooxygenase is the reorganization bacterium with granular methane monooxygenase activity; The promoter sequence of described desulfurization gene is positioned at the upstream of the encoding gene of described granular methane monooxygenase.
2, reorganization bacterium according to claim 1 is characterized in that: described rhodococcus is the rhodococcus erythropolis (Rhodococcus erythropolis) of Rhod, Rhodococcus aichiensis, Rhodococcuschlorophenolicus, Rhodococcus coprophilus, Rhodococcus equi, Rhodococcusfascians, Rhodococcus globerulus, Rhodococcus luteus, Rhodococcusmarinonascens, Rhodococcus Maris, Rhodococcus rhodnii, Rhodococcusrhodochrous or Rhodococcus ruber.
3, reorganization bacterium according to claim 2 is characterized in that: described rhodococcus erythropolis is rhodococcus erythropolis (Rhodococcus erythropolis) LSSE8-1.
4, according to claim 1 or 2 or 3 described reorganization bacterium, it is characterized in that: the encoding gene of described granular methane monooxygenase is U31650 AF186586 at the Genbank sequence number, and the nucleotides sequence of the promotor of described desulfurization gene is classified as among the Genbank among the sequence number L37363 from the 1st-768 deoxyribonucleotides of 5 ' end.
5, according to claim 1 or 2 or 3 described reorganization bacterium, it is characterized in that: described encoding gene and the fusion gene formed of the promoter sequence of desulfurization gene by granular methane monooxygenase has SEQ ID № in the sequence table: 1 dna sequence dna.
6, according to claim 2 or 3 described reorganization bacterium, it is characterized in that: described encoding gene and the fusion gene formed of the promoter sequence of desulfurization gene by granular methane monooxygenase imports rhodococcus erythropolis by inserting the recombinant expression vector that contains described fusion gene that procaryotic cell expression carrier pBS305, pMVS301 or pRESQ obtain.
7, reorganization bacterium according to claim 6, it is characterized in that: the recombinant expression vector that contains described fusion gene is pBS305-dsz-pmoCAB; Described pBS305-dsz-pmoCAB is that the HindIII recognition site that the fusion gene that will be made up of the promoter sequence of the encoding gene of granular methane monooxygenase and desulfurization gene inserts pBS305 obtains.
8, a kind of method of expressing granular methane monooxygenase is to cultivate arbitrary described reorganization bacterium with granular methane monooxygenase activity among the claim 1-7, carries out abduction delivering, obtains granular methane monooxygenase.
9, method according to claim 8 is characterized in that: be that described reorganization bacterium with methane monooxygenase activity is cultured to logarithmic phase or logarithm later stage described period of carrying out abduction delivering in containing the substratum of element sulphur.
10, method according to claim 9 is characterized in that: in the described method, cultivated 2-4 hour in no element sulphur substratum being cultured to the logarithmic phase or the thalline in logarithm later stage, carry out abduction delivering.
11, among the claim 1-7 arbitrary described reorganization bacterium with granular methane monooxygenase activity Sweet natural gas and biogas liquefied in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100984092A CN1329506C (en) | 2005-09-06 | 2005-09-06 | Recombinant bacterium with granular methane monooxygenase activity and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100984092A CN1329506C (en) | 2005-09-06 | 2005-09-06 | Recombinant bacterium with granular methane monooxygenase activity and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1763178A CN1763178A (en) | 2006-04-26 |
| CN1329506C true CN1329506C (en) | 2007-08-01 |
Family
ID=36747501
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100984092A Expired - Fee Related CN1329506C (en) | 2005-09-06 | 2005-09-06 | Recombinant bacterium with granular methane monooxygenase activity and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1329506C (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9611487B2 (en) | 2012-12-21 | 2017-04-04 | Greenlight Biosciences, Inc. | Cell-free system for converting methane into fuel and chemical compounds |
| US10006062B2 (en) | 2010-05-07 | 2018-06-26 | The Board Of Trustees Of The Leland Stanford Junior University | Methods for control of flux in metabolic pathways through enzyme relocation |
| US10036001B2 (en) | 2010-08-31 | 2018-07-31 | The Board Of Trustees Of The Leland Stanford Junior University | Recombinant cellular iysate system for producing a product of interest |
| US10421953B2 (en) | 2013-08-05 | 2019-09-24 | Greenlight Biosciences, Inc. | Engineered proteins with a protease cleavage site |
| US10858385B2 (en) | 2017-10-11 | 2020-12-08 | Greenlight Biosciences, Inc. | Methods and compositions for nucleoside triphosphate and ribonucleic acid production |
| US10954541B2 (en) | 2016-04-06 | 2021-03-23 | Greenlight Biosciences, Inc. | Cell-free production of ribonucleic acid |
| US11274284B2 (en) | 2015-03-30 | 2022-03-15 | Greenlight Biosciences, Inc. | Cell-free production of ribonucleic acid |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014062703A1 (en) * | 2012-10-15 | 2014-04-24 | Calysta Energy, Inc. | Genetically engineered microorganisms for biological oxidation of hydrocarbons |
| CN110832073A (en) * | 2017-03-31 | 2020-02-21 | 株式会社钟化 | Novel monooxygenases and their use |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1010757A2 (en) * | 1998-12-08 | 2000-06-21 | Ajinomoto Co., Inc. | Insertion sequence from Methylococcus capsulatus |
| CN1580269A (en) * | 2003-08-06 | 2005-02-16 | 中国科学院兰州化学物理研究所 | Method for preparing methanol from methane by biological catalysis |
| CN1587382A (en) * | 2004-09-22 | 2005-03-02 | 清华大学 | Method for promoting methane oxidizing bacteria growth |
-
2005
- 2005-09-06 CN CNB2005100984092A patent/CN1329506C/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1010757A2 (en) * | 1998-12-08 | 2000-06-21 | Ajinomoto Co., Inc. | Insertion sequence from Methylococcus capsulatus |
| CN1580269A (en) * | 2003-08-06 | 2005-02-16 | 中国科学院兰州化学物理研究所 | Method for preparing methanol from methane by biological catalysis |
| CN1587382A (en) * | 2004-09-22 | 2005-03-02 | 清华大学 | Method for promoting methane oxidizing bacteria growth |
Non-Patent Citations (1)
| Title |
|---|
| Regulation of expression of methane monooxygenasesby copper ions J.Colin Murrell,et al.,Trends in Microbiology,Vol.8 No.5 2000 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10006062B2 (en) | 2010-05-07 | 2018-06-26 | The Board Of Trustees Of The Leland Stanford Junior University | Methods for control of flux in metabolic pathways through enzyme relocation |
| US10036001B2 (en) | 2010-08-31 | 2018-07-31 | The Board Of Trustees Of The Leland Stanford Junior University | Recombinant cellular iysate system for producing a product of interest |
| US9611487B2 (en) | 2012-12-21 | 2017-04-04 | Greenlight Biosciences, Inc. | Cell-free system for converting methane into fuel and chemical compounds |
| US10421953B2 (en) | 2013-08-05 | 2019-09-24 | Greenlight Biosciences, Inc. | Engineered proteins with a protease cleavage site |
| US11274284B2 (en) | 2015-03-30 | 2022-03-15 | Greenlight Biosciences, Inc. | Cell-free production of ribonucleic acid |
| US10954541B2 (en) | 2016-04-06 | 2021-03-23 | Greenlight Biosciences, Inc. | Cell-free production of ribonucleic acid |
| US10858385B2 (en) | 2017-10-11 | 2020-12-08 | Greenlight Biosciences, Inc. | Methods and compositions for nucleoside triphosphate and ribonucleic acid production |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1763178A (en) | 2006-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1329506C (en) | Recombinant bacterium with granular methane monooxygenase activity and application thereof | |
| Akhlaghi et al. | A comprehensive review on biological hydrogen production | |
| Sivagurunathan et al. | Batch fermentative hydrogen production by enriched mixed culture: combination strategy and their microbial composition | |
| Nakasaki et al. | Comparison of organic matter degradation and microbial community during thermophilic composting of two different types of anaerobic sludge | |
| Bagi et al. | Biotechnological intensification of biogas production | |
| Sompong et al. | Evaluation of methods for preparing hydrogen-producing seed inocula under thermophilic condition by process performance and microbial community analysis | |
| Kongjan et al. | Biohydrogen production from wheat straw hydrolysate by dark fermentation using extreme thermophilic mixed culture | |
| Lin et al. | Effects of initial cultivation pH on fermentative hydrogen production from xylose using natural mixed cultures | |
| KR20030034166A (en) | High Growth Methanotrophic Bacterial Strain Methylomonas 16A | |
| Jamali et al. | Particle size variations of activated carbon on biofilm formation in thermophilic biohydrogen production from palm oil mill effluent | |
| Calli et al. | Community changes during start-up in methanogenic bioreactors exposed to increasing levels of ammonia | |
| CN102471780A (en) | Compositions and methods for improved saccharification of biomass | |
| CN101395273A (en) | Methods and compositions for ethanol producing cyanobacteria | |
| Zang et al. | The distribution of active β-glucosidase-producing microbial communities in composting | |
| CN105051179A (en) | Recombinant microorganisms and uses therefor | |
| Figueiredo et al. | Clostridium | |
| EP3129489B1 (en) | Production of succinic acid from organic waste or biogas or methane using recombinant methanotrophic bacterium | |
| US10190101B2 (en) | Production of lactic acid from organic waste or biogas or methane using recombinant methanotrophic bacteria | |
| Wang et al. | Effects of NH4+-N and NO2−-N on carbon fixation in an anaerobic ammonium oxidation reactor | |
| Sarma et al. | Biohydrogen Production from Aquatic Plant and Algae Biomass by Enterobacter cloacae Strain DT‐1 | |
| Chen et al. | Characterization of active microbes in a full-scale anaerobic fluidized bed reactor treating phenolic wastewater | |
| Zhao et al. | Consolidated bioprocessing of microalgal biomass to carboxylates by a mixed culture of cow rumen bacteria using anaerobic sequencing batch reactor (ASBR) | |
| Seengenyoung et al. | Biohydrogen Production from Palm Oil Mill Effluent Pretreated | |
| Cripa et al. | Poultry slaughterhouse anaerobic ponds as a source of inoculum for biohydrogen production | |
| Danko et al. | Effect of arabinose concentration on dark fermentation hydrogen production using different mixed cultures |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070801 Termination date: 20110906 |