CN1328377C - An allelomorphic gene of gene LAPTM 4B relevant to liver cancer of human, coded result and application - Google Patents
An allelomorphic gene of gene LAPTM 4B relevant to liver cancer of human, coded result and application Download PDFInfo
- Publication number
- CN1328377C CN1328377C CNB031097863A CN03109786A CN1328377C CN 1328377 C CN1328377 C CN 1328377C CN B031097863 A CNB031097863 A CN B031097863A CN 03109786 A CN03109786 A CN 03109786A CN 1328377 C CN1328377 C CN 1328377C
- Authority
- CN
- China
- Prior art keywords
- laptm4b
- liver cancer
- gene
- protein
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses an allele of a gene LAPTM4B relevant to human liver cancer, an encoded product and the applications thereof. The allele is one of the following nucleotide sequences: 1) SEQ ID No. 1 in a coding sequence list; 2) a polynucleotide of the amino acid sequence of a protein as SEQ ID No. 2 in the coding sequence list; 3) a DNA sequence with more than 90 percent of homology with the a DNA sequence limited by the SEQ ID No. 1 in the coding sequence list and for encoding a protein with the same function. In the present invention, the gene LAPTM4B is typed, and a genotype LAPTM4B*2/*2 is found to be closely relevant to the susceptibility of the liver cancer; thereby, a more exact novel standard is offered for the screening of the high risk group of the primary liver cancer and the accuracy of the screening, and the present invention has an important significance to the evaluation and the prevention of the high risk group which are easy to be liver cancer patients; in addition, the protein of LAPTM4B*2 can be used as a novel target point of medicine actions for developing a new medicine with the target point of the protein of LAPTM4B*2. Thereby, the possibility of developing a new approach for controlling the liver cancer exists, and the present invention is a project which can generating great social benefits.
Description
Technical field
The present invention relates to allelotrope and coded product and application in the genetically engineered field, particularly relate to allelotrope and coded product and the application of people's liver cancer related gene LAPTM4B.
Background technology
(hepatocellular carcinoma is the disease of serious harm human health HCC) to hepatocellular carcinoma, it is reported, newly-increased patient's number in whole world primary hepatocarcinoma every year surpasses 1,000,000 people, wherein 70% concentrates on the Asia.China's liver cancer patient accounts for the 40-45% of whole world liver cancer patient, annual newly-increased liver cancer patient 450,000, and be continuous ascendant trend.Liver cancer is the sickness rate height not only, and concealment, development are fast, recurrence rate and mortality ratio height, are called as " king in the cancer ".During the liver cancer patient of going to see a doctor mostly is greatly or late period, if do not treat natural history generally only 3-6 month.
Tumour is the heredopathia of cell in essence.Though the gene relevant with liver cancer found that much liver cancer takes place, the mechanism of development is still fuzzy.The proto-oncogene of finding can be classified as four classes by its coded product substantially in the location and the function of cell at present, and a class is the gene of coding somatomedin, comprises sis, int-2, hst, fgf-5; Second class is the gene of coding growth factor receptors, comprises erbB, erbB-2, fms, met, ros etc.; The 3rd class is the gene of signal transduction molecule in the Codocyte matter, comprises abl, src, ras, raf, yes, fgr, fes, lck, mos etc.; The 4th class is the gene of Codocyte propagation and apoptosis regulation molecule, comprises bcl-1, bcl-2 etc.; The 5th class is the gene of the protein (transcription factor) that combines with DNA in the Codocyte nuclear, for example genes such as myc, myb, fos, jun, B-lym, ski, ets, rel.Studies confirm that and the closely-related ras of mainly containing of generation, src, myc, the genes such as met, p53 of HCC.
Illustrate onset of liver cancer mechanism and will help prevention, diagnosis and the treatment of liver cancer.Discover that the morbidity of liver cancer is relevant with individual genetic predisposition.The individuality of different genetic backgrounds there are differences the processing power of the environmental carcinogenesis factor, causes the individual cancer risk difference of suffering from.The individual essence of this tumour genetic predisposition difference is the multiformity and the diversity of gene.
The present inventor cloned a gene LAPTM4B relevant with people's liver cancer (Chinese patent application number: 02158110.X), find that this gene expresses in that normal liver tissue is low, and in 96.88% (31/32) people's liver cancer tissue up-regulated.The degree that raises is relevant with the differentiation degree of liver cancer cell: low differentiation person significantly raises, and high differentiation person rise is lighter.Also visible the expression slightly raises in the non-cancer hepatic tissue of portion paired.Studies show that LAPTM4B in the signal transduction that propagation, migration and the extracellular matrix of cell started, and play the part of extremely important role in the generating process of liver cancer.
Summary of the invention
The allelotrope and the coded product thereof that the purpose of this invention is to provide people's liver cancer related gene LAPTM4B.
The allelotrope called after LAPTM4B*2 of people's liver cancer related gene LAPTM4B provided by the present invention is one of following nucleotide sequences:
1) the SEQ ID № in the sequence table: 1;
2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;
3) with sequence table in SEQ ID №: 1 dna sequence dna that limits has 90% above homology, and the identical function protein DNA sequence of encoding.
SEQ ID № in the sequence table: 1 by 2264 based compositions, and its reading frame is from 5 ' end the 17th to 1129 bit base.The 19bp dna fragmentation that wherein contains two copies, the sequence of 19bp dna fragmentation are gcttggagctccagca gct.The 19bp dna fragmentation of these two copies is at LAPTM4B allelotrope nt 124-nt 161.
The allelotrope LAPTM4B*2 encoded protein LAPTM4B*2 of people's liver cancer related gene, be protein, or the aminoacid sequence of sequence 2 is passed through replacement, disappearance or the interpolation of one or several amino-acid residue and has identical active by sequence 2 deutero-protein with the aminoacid sequence of sequence 2 with sequence 2 aminoacid sequences in the sequence table.
The protein that sequence 2 in the sequence table is made up of 370 amino-acid residues.
For the different genotype of definite LAPTM4B and the relation of liver cancer susceptibility, the present invention has carried out the LAPTM4B somatotype to genomic dna, with people's liver cancer related gene LAPTM4B called after LAPTM4B*1, the gene type of the LAPTM4B that obtains in the crowd is * 1/*1, * 1/*2 and * 2/*2.Discover that risk that the individuality of genotype * 2/*2 suffers from liver cancer than 2.89 times of non-* 2/*2 type heights, shows that the susceptibility of LAPTM4B*2/*2 and liver cancer is closely related.Therefore to can be used as the application, particularly genotype of examination liver cancer Susceptible population and high risk population's target compound be that LAPTM4B*2/*2 person is bigger as the accuracy of examination liver cancer susceptible and high risk population's target to the allelotrope LAPTM4B*2 of people's liver cancer related gene LAPTM4B provided by the invention.Therefore, be the reagent that the reagent of activeconstituents can be used for preparing the examination liver cancer high risk population by LAPTM4B*2/*2 expressed protein or its antibody or LAPTM4B is caught in amplification in the people's gene group material.
In order to determine the relation of LAPTM4B genotype and other cancer susceptibility, the present invention analyzes the genotypic distribution frequency of esophagus cancer patient's LAPTM4B, finds that LAPTM4B and esophagus cancer susceptibility are irrelevant.
In order to determine whether allelotrope * 1 and * 2 exist the difference of expression activity, and the 19bp nucleotides sequence of exploring 5 ' non-translational region is listed in the possible role who is played the part of in the genetic expression process, it is the reporter plasmid pGL3-*1/Luc and the pGL3-*2/Luc of reporter gene that the present invention has made up luciferase, and by transfection people liver cancer BEL7402 cell analysis the uciferase activity of reporter plasmid, the result shows that the repeated fragment of the 19bp among the allelotrope * 2 has suppressed the activity of promotor in the BEL7402 cell, therefore, the repeated fragment of 19bp may be the negativity regulatory factor in the BEL7402 cell.
Contain SEQ ID №: the expression vector of 1 described sequence and contain SEQ ID №: the transfectional cell series of 1 sequence all belongs to protection scope of the present invention.
The invention discloses the allelotrope LAPTM4B*2 of LAPTM4B, genomic dna carried out the LAPTM4B somatotype, and studied different genotype and liver cancer susceptibility relation and with the relation of the susceptibility of other tumour.The susceptibility of having found one of them genotype LAPTM4B*2/2 and liver cancer is closely related, thereby for the accuracy of primary hepatocarcinoma susceptible and high risk population's examination provides new more definite standard, assessment and prevention that commute is suffered from the excessive risk crowd of liver cancer are significant.Also the target gene of LAPTM4B*2 gene as liver cancer treatment for example can be prevented the LAPTM4B expression of gene by the siRNA perturbation technique of recent development in addition; And with LAPTM4B*2 albumen as pharmaceutically-active novel targets, development is the new drug of target spot with LAPTM4B*2 albumen.Therefore, might develop the new way of anti-liver cancer, be an engineering that will produce great social benefit.
The invention will be further described below in conjunction with specific embodiment and accompanying drawing.
Description of drawings
Fig. 1 is the allelic part fragment of LAPTM4B
Fig. 2 is the gene type of LAPTM4B
Fig. 3 allelotrope
*1 He
*2 comparisons of expression activity in BEL7402 clone
Embodiment
The source of patient and normal control group thereof
All 57 routine liver cancer patient ages, between year, the mean age was 54 ± 6.0 years old, 50 of male patients, 7 of women at 35-70.Surgical tissue is from surgical operation.Control group B comprises 209 newborn infants.Adopt the connatae umbilical vein blood of newborn infant as sample.
Between year, the mean age is 55 ± 5.4 years old to all 109 esophagus cancer patient ages at 30-70, and man/women ratio is 76/33.Surgical tissue is from surgical operation.Normal control group S is 116 crowds asymptomatic and esophagus cancer is not suffered from Clinical Laboratory.Peripheral blood sample is used to the separation and Extraction genomic dna.
Statistical method
Adopt x
2Check and single factor ANOVA variance analysis processing data
Allelic clone of embodiment 1, LAPTM4B and order-checking
(1) separation of DNA
According to the benzene phenol-chloroform method of standard, from normal people, liver cancer or esophagus cancer patient's blood lymphocytes or surgical tissue, extract genomic dna.
(2) clone and order-checking
Be the LAPTM4B gene order 3 in the Chinese patent of 02158110.X according to application number, two primers (seeing Figure 1A), F have been synthesized in design
1(nt-1492--1472): 5 ' GCG
CTCGAGGCTCCAGGTGGAAGAGTGTGC 3 ' (5 ' terminal XhoI restriction enzyme site, the part of promptly ruling introduced); R
1(nt 16-35): 5 ' GCG
AAGCTTGGACTTGGCCATGTGACCCG 3 ' (5 ' terminal HindIII restriction enzyme site, the part of promptly ruling introduced) clones the promotor of LAPTM4B first exon and the sequence of preceding continuous part thereof by the PCR method from genomic dna.
The PCR product is cut rear clone on the polylinker connection site of luciferase carrier pGL3-Basic (Promega) with XhoI and HindIII enzyme, obtains pGL3-LAPTM4B, and checks order.
Obtained the new allelotrope of LAPTM4B, called after LAPTM4B
*2, simultaneously with original LAPTM4B sequence called after LAPTM4B
*1 sequence.LAPTM4B
*2 sequence is a sequence 1 in the sequence table.Fig. 1 (A) is the promotor of LAPTM4B and the synoptic diagram of first exon.The rectangle frame table shows first exon, and black part is divided into the coding region, and white portion is a non-coding region, and grey color part is the dna sequence dna of 19bp.Horizontal line is represented promotor, F
1, F
2, R
1, R
2Be respectively four primers.This sequence is compiled to+1 with the A among the initiator codon ATG.Fig. 1 (B) is allelic partial sequence of LAPTM4B and color atlas.With the underscore mark is the dna sequence dna of 19bp.The result shows, LAPTM4B
*The 19bp dna sequence dna that contains a copy in 1, LAPTM4B
*2 contain the 19bp dna sequence dna of two copies, and they are engaged on LAPTM4B
*5 ' the non-coding region (nt-33--15) of 1 first exon.
The gene type of embodiment 2, LAPTM4B
Design a method LAPTM4B in normal people and the liver cancer patient blood sample is carried out gene type based on PCR.Two primers have been synthesized in the flanking sequence design that according to application number is the 19bp dna sequence dna in the LAPTM4B gene order 3 in the Chinese patent application of 02158110.X,
F
2(nt-85--65)：5’GCCGACTAGGGGACTGGCGGA 3’；
R
2(nt 99-119)：5’CGAGAGCTCCGAGCTTCTGCC 3’。
With the genomic dna is the partial sequence of template amplification first exon.PCR condition: 96 ℃ of pre-sex change 5 minutes; 94 ℃ 30 seconds, 68 ℃ 30 seconds, 72 ℃ 1 minute, 35 circulations; 72 ℃ were extended 5 minutes.The PCR product is identified through 2% agarose gel electrophoresis, be the results are shown in Figure 2.Swimming lane 1,6,12,13 expression LAPTM4B
*1/
*The nucleotide fragments of 204bp in 1, swimming lane 5,8,9,14,15 expression LAPTM4B
*2/
*The nucleotide fragments of 223bp in 2.Swimming lane 2,3,4,7,10,11 expression LAPTM4B
*1/
*Contain two nucleotide fragments of 204bp and 223bp in 2.Swimming lane M is Marker.It is right that the result shows at homozygous gene
*1/
*1 or
*2/
*Have only 204bp or 223bp dna fragmentation to be amplified in 2 respectively, and right at heterozygous genes
*1/
*In 2, the dna fragmentation of 204bp and 223bp is amplified simultaneously.Therefore, the genotype of LAPTM4B can be divided in Chinese population: LAPTM4B
*1/
*1,
*1/
*2 Hes
*2/
*2.
The LAPTM4B genotype of embodiment 3, liver cancer patient and normal population and allelic distribution
The present invention has analyzed 209 routine Chinese normal populations and 57 routine liver cancer patients, and the frequency ratio that its genotype occurs sees Table 1, carries out the mathematical expection analytical results with the Hardy-Weinberg equation.The LAPTM4B allelotrope of liver cancer patient and normal population
*1 He
*There were significant differences for 2 frequency, and its ratio was respectively 0.5175: 0.6746 and 0.482:: 0.3254.LAPTM4B allelotrope appears in normal population
*1 He
*2 frequency is respectively 0.6746 and 0.3254, and LAPTM4B allelotrope appears in liver cancer patient
*1 He
*2 frequency is respectively 0.5175 and 0.4825.The genotype of liver cancer group
*1/
*1 (P=0.029) and
*2/
*The frequency normal control group corresponding with it that 2 (P=0.003) occur compared has significant significant difference.In the liver cancer group, have only 29.8% to be genotype
*1/
*1, have 45.93% to be genotype in the normal control group
*1/
*1.And genotype in the liver cancer group
*2/
*2 frequency is 26.32%, compares with 11.01% of control group, and the frequency of its appearance significantly increases (P＜0.01).The analysis revealed genotype
*2/
*The risk ratio that 2 individuality is suffered from liver cancer is
*2/
*2.89 times of 2 type individualities.Therefore, LAPTM4B
*2/
*2 allelotrope are relevant with liver cancer susceptibility.
As shown in table 2, the patient of different genotype does not show the difference that liver cancer rank, stage or HBV infect, the 83.3% patient HBV positive.
The genotypic distribution of the LAPTM4B of table 1 liver cancer patient and normal population
| N(％) | The P value | ||
| Control group B (n=209) | Liver cancer group (n=57) | ||
| The LAPTM4B genotype *1/ *1 *1 */2 *2/ *2 | 96(45.93) 90(43.06) 23(11.01) | 17(29.82) 25(43.86) 15(26.32) | 0.029 a 0.914 0.003 b |
| Allelic frequency *1 *2 | 0.6746 0.3254 | 0.5175 0.4825 | |
aOR:0.500,95%CI:0.267-0.939;
bOR:2.888,95%CI:1.390-6.003 (ill risk of OR and 95%CI are fiducial interval).
Table 2 is used for the clinical data of the liver cancer patient of LAPTM4B gene type
| The LAPTM4B genotype | The P value | |||
| *1/ *1 | *1/ *2 | *2/ *2 | ||
| The total number of persons masculinity femininity | 17 14 3 | 25 24 1 | 15 12 3 | NS |
| The rank of tumour | ||||
| G1 G2 G3 G4 | 0 1 7 9 | 2 4 7 12 | 0 8 4 3 | NS |
| The stage of tumour | ||||
| I II III IV | 0 5 4 8 | 0 8 7 10 | 0 5 3 7 | NS |
| HBV infects | ||||
| The negative positive is not made a definite diagnosis | 1 13 3 | 4 16 5 | 4 10 1 | NS |
NS: difference does not have significance
Genotype in embodiment 4, the esophageal cancer cell and allelic frequency
In order to determine whether the LAPTM4B genotype is relevant with other cancer susceptibility, and 116 routine normal populations and 109 routine esophagus cancer patients from same place are analyzed.As shown in table 3, esophagus cancer patient's LAPTM4B gene type and its contrast crowd there is no significant difference.Show that LAPTM4B allelotrope and esophagus cancer susceptibility are irrelevant.
Simultaneously, do not have significant difference between LAPTM4B allelotrope and the genotype in the normal population of different areas (control group B and control group S are from different areas), there is not the difference of region in the genotypic distribution frequency of LAPTM4B that shows the crowd yet.
The genotypic distribution of the LAPTM4B of table 3 esophagus cancer patient and normal population
| N(％) | The P value | |||
| Control group B (n=209) | Control group S (n=116) | Esophagus cancer (n=109) | ||
| The LAPTM4B genotype | ||||
| *1/ *1 *1/ *2 *2/ *2 | 96(45.93) 90(43.06) 23(11.01) | 52(44.83) 49(42.24) 15(12.93) | 49(44.95) 48(44.04) 12(11.01) | ＞0.05 ＞0.05 ＞0.05 |
| Allelic frequency | ||||
| *1 *2 | 0.6746 0.3254 | 0.6595 0.3405 | 0.6697 0.3303 | |
The structure of embodiment 5, reporter plasmid and the analysis of promotor
Select LAPTM4B
*1/
*1 or
*2/
*2 homozygous gene is to making up plasmid as template.With LAPTM4B
*1/
*1 or
*2/
*2 genomic dna is a template, uses the PCR primers F
1And R
15 ' the terminal flanking sequence (comprising part first exon sequence) of the amplification LAPTM4B first exon upstream.For fear of because the sudden change that causes of pcr amplification, used high-fidelity archaeal dna polymerase (Pfx Kit, Invitrogen).LAPTM4B
*1/
*1 He
*2/
*2 PCR product is cloned on the polylinker connection site of luciferase carrier pGL3-Basic (Promega) after cutting with XhoI and HindIII enzyme, obtains recombinant plasmid pGL3-
*1/Luc and pGL3-
*2/Luc, and recombinant plasmid checked order, there is not mutant to produce with checking.Recombinant plasmid carries out separation and purification with Mini-Plasmid test kit (Qiagen).On 24 well culture plates, the method that goes up to specifications LipofectAMINE 2000 (Invitrogen) transfection human liver cancer cell BEL7402.LipofectAMINE 2000 mixtures contain pGL-3 Basic plasmid, pGL-3 promoter plasmid (positive control) or contain the luciferase reporting plasmid that has or not any additive.Liver cancer cell BEL7402 and transfection reagent temperature were bathed after 6 hours, were that substratum is cultivated with not containing antibiotic foetal calf serum.Cells transfected was cultivated after 48 hours, the lysate of collecting cell, and with the activity of the element of luciferase reporting analytical system (Promega) analysis of fluorescence on the POLARstar galaxy luminometer (bMG Corporation) enzyme.
Sequencing result shows LAPTM4B
*2 and LAPTM4B
*1 promotor is identical, does not find LAPTM4B allelotrope
*1 He
*There is difference in 2 promoter sequence.
Embodiment 6, allelotrope LAPTM4B
*2 and LAPTM4B
*The active comparison of 1 translation
In order to determine allelotrope
*1 He
*Whether 2 exist the difference of expression activity, and the 19bp nucleotides sequence of exploring 5 ' non-translational region is listed in the possible role who is played the part of in the genetic expression process, with allelotrope
*1 He
*The partial sequence of 2 the promotor and first exon is cloned into the upstream of luciferase gene of pGL-3 Basic carrier and transfection in the BEL7402 cell, and this clone is separated from people's liver cancer tissue, and its genotype is
*1/
*2.The result as shown in Figure 3, wherein 1,2,3 represent the promotor of LAPTM4B and first exon, recombinant plasmid pGL3-respectively
*1/Luc and pGL3-
*The segmental synoptic diagram of the part of 2/Luc.PGL-3-
*Uciferase activity among the 1/Luc (19910 ± 1154) and pGL-3-
*2/Luc (16099 ± 983) compares has significant significant difference (P=0.002), shows allelotrope
*The repeated fragment of 19bp in 2 has suppressed the activity of promotor in the BEL7402 cell, makes its active reduction by 19%, and therefore, the series connection repeated fragment of this 19bp may be the negativity regulatory factor in the BEL7402 cell.
Sequence table
<160>2
<210>1
<211>2264
<212>DNA
＜213〉Genus Homo people (Homo sapiens)
<400>1
gaatctcgac ccttgaatgg agttacacga acggccagat gaaagaagga aggcccggac 60
ctccactcag ggccgactag gggactggcg gagggtgcac gctgatggat ttactcaccg 120
ggtgcttgga gctccagcag ctgcttggag ctccagcagc tggctggagc ccgcgatgac 180
gtcacggact cgggtcacat ggccgagtcc gccccgcccc ctccccgtcc ccgccgctgc 240
agccgtcgcc ttcggagcga agggtaccga cccggcagaa gctcggagct ctcggggtat 300
cgaggaggca ggcccgcggg cgcacgggcg agcgggccgg gagccggagc ggcggaggag 360
ccggcagcag cggcgcggcg ggctccaggc gaggcggtcg acgctcctga aaacttgcgc 420
gcgcgctcgc gccactgcgc ccggagcgat gaagatggtc gcgccctgga cgcggttcta 480
ctccaacagc tgctgcttgt gctgccatgt ccgcaccggc accatcctgc tcggcgtctg 540
gtatctgatc atcaatgctg tggtactgtt gattttattg agtgccctgg ctgatccgga 600
tcagtataac ttttcaagtt ctgaactggg aggtgacttt gagttcatgg atgatgccaa 660
catgtgcatt gccattgcga tttctcttct catgatcctg atatgtgcta tggctactta 720
cggagcgtac aagcaacgcg cagcctggat catcccattc ttctgttacc agatctttga 780
ctttgccctg aacatgttgg ttgcaatcac tgtgcttatt tatccaaact ccattcagga 840
atacatacgg caactgcctc ctaattttcc ctacagagat gatgtcatgt cagtgaatcc 900
tacctgtttg gtccttatta ttcttctgtt tattagcatt atcttgactt ttaagggtta 960
cttgattagc tgtgtttgga actgctaccg atacatcaat ggtaggaact cctctgatgt 1020
cctggtttat gttaccagca atgacactac ggtgctgcta cccccgtatg atgatgccac 1080
tgtgaatggt gctgccaagg agccaccgcc accttacgtg tctgcctaag ccttcaagtg 1140
ggcggagctg agggcagcag cttgactttg cagacatctg agcaatagtt ctgttatttc 1200
acttttgcca tgagcctctc tgagcttgtt tgttgctgaa atgctacttt ttaaaattta 1260
gatgttagat tgaaaactgt agttttcaac atatgctttg ctggaacact gtgatagatt 1320
aactgtagaa ttcttcctgt acgattgggg atataatggg cttcactaac cttccctagg 1380
cattgaaact tcccccaaat ctgatggacc tagaagtctg cttttgtacc tgctgggccc 1440
caaagttggg catttttctc tctgttccct ctcttttgaa aatgtaaaat aaaaccaaaa 1500
atagacaact ttttcttcag ccattccagc atagagaaca aaaccttatg gaaacaggaa 1560
tgtcaattgt gtaatcattg ttctaattag gtaaatagaa gtccttatgt atgtgttaca 1620
agaatttccc ccacaacatc ctttatgact gaagttcaat gacagtttgt gtttggtggt 1680
aaaggatttt ctccatggcc tgaattaaga ccattagaaa gcaccaggcc gtgggagcag 1740
tgaccatctg ctgactgttc ttgtggatct tgtgtccagg gacatggggt gacatgcctc 1800
gtatgtgtta gagggtggaa tggatgtgtt tggcgctgca tgggatctgg tgcccctctt 1860
ctcctggatt cacatcccca cccagggccc gcttttacta agtgttctgc cctagattgg 1920
ttcaaggagg tcatccaact gactttatcg agtggaattg ggatatattt gatatacttc 1980
tgcctaacaa catggaaaag ggttttcttt tccctgcaag ctacatccta ctgctttgaa 2040
cttccaagta tgtctagtca ccttttaaaa tgtaaacatt ttcagaaaaa tgaggattgc 2100
cttccttgta tgcgcttttt accttgacta cctgaattgc aagggatttt tatatattca 2160
tatgttacaa agtcagcaac tctcctgttg gttcattatt gaatgtgctg taaattaagt 2220
tgtttgcaat taaaacaagg tttgcccaca aaaaaaaaaa aaaa 2264
<210>2
<211>370
<212>PRT
＜213〉Genus Homo people (Homo sapiens)
<400>2
Met Glu Leu His Glu Arg Pro Asp Glu Arg Arg Lys Ala Arg Thr
1 5 10 15
Ser Thr Gln Gly Arg Leu Gly Asp Trp Arg Arg Val His Ala Asp
20 25 30
Gly Phe Thr His Arg Val Leu Gly Ala Pro Ala Ala Ala Trp Ser
35 40 45
Ser Ser Ser Trp Leu Glu Pro Ala Met Thr Ser Arg Thr Arg Val
50 55 60
Thr Trp Pro Ser Pro Pro Arg Pro Leu Pro Val Pro Ala Ala Ala
65 70 75
Ala Val Ala Phe Gly Ala Lys Gly Thr Asp Pro Ala Glu Ala Arg
80 85 90
Ser Ser Arg Gly Ile Glu Glu Ala Gly Pro Arg Ala His Gly Arg
95 100 105
Ala Gly Arg Glu Pro Glu Arg Arg Arg Ser Arg Gln Gln Arg Arg
110 115 120
Gly Gly Leu Gln Ala Arg Arg Ser Thr Leu Leu Lys Thr Cys Ala
125 130 135
Arg Ala Arg Ala Thr Ala Pro Gly Ala Met Lys Met Val Ala Pro
140 145 150
Trp Thr Arg Phe Tyr Ser Asn Ser Cys Cys Leu Cys Cys His Val
155 160 165
Arg Thr Gly Thr Ile Leu Leu Gly Val Trp Tyr Leu Ile Ile Asn
170 175 180
Ala Val Val Leu Leu Ile Leu Leu Ser Ala Leu Ala Asp Pro Asp
185 190 195
Gln Tyr Asn Phe Ser Ser Ser Glu Leu Gly Gly Asp Phe Glu Phe
200 205 210
Met Asp Asp Ala Asn Met Cys Ile Ala Ile Ala Ile Ser Leu Leu
215 220 225
Met Ile Leu Ile Cys Ala Met Ala Thr Tyr Gly Ala Tyr Lys Gln
230 235 240
Arg Ala Ala Trp Ile Ile Pro Phe Phe Cys Tyr Gln Ile Phe Asp
245 250 255
Phe Ala Leu Asn Met Leu Val Ala Ile Thr Val Leu Ile Tyr Pro
260 265 270
Asn Ser Ile Gln Glu Tyr Ile Arg Gln Leu Pro Pro Asn Phe Pro
275 280 285
Tyr Arg Asp Asp Val Met Ser Val Asn Pro Thr Cys Leu Val Leu
290 295 300
Ile Ile Leu Leu Phe Ile Ser Ile Ile Leu Thr Phe Lys Gly Tyr
305 310 315
Leu Ile Ser Cys Val Trp Asn Cys Tyr Arg Tyr Ile Asn Gly Arg
320 325 330
Asn Ser Ser Asp Val Leu Val Tyr Val Thr Ser Asn Asp Thr Thr
335 340 345
Val Leu Leu Pro Pro Tyr Asp Asp Ala Thr Val Asn Gly Ala Ala
350 355 360
Lys Glu Pro Pro Pro Pro Tyr Val Ser Ala
365 370
Claims (6)
1, the allelotrope LAPTM4B*2 of people's liver cancer related gene LAPTM4B is one of following nucleotide sequences:
1) the SEQ ID № in the sequence table: 1;
2) SEQ ID № in the code sequence tabulation: the polynucleotide of the aminoacid sequence of 2 protein.
2, the allelotrope LAPTM4B*2 encoded protein LAPTM4B*2 of people's liver cancer related gene LAPTM4B is the protein with sequence 2 amino acid residue sequences in the sequence table.
3, contain the described expression carrier of claim 1.
4, transgenic cell line, its foreign gene are the allelotrope LAPTM4B*2 of the described people's liver cancer related gene of claim 1 LAPTM4B.
5, the application of the allelotrope LAPTM4B*2 of the described people's liver cancer related gene of claim 1 LAPTM4B in preparation examination liver cancer susceptible and high risk population's reagent.
6, application according to claim 5 is characterized in that: described application is that genotype is the application of genotype in preparation examination liver cancer susceptible and high risk population's reagent of LAPTM4B*2/*2.
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031097863A CN1328377C (en) | 2003-04-21 | 2003-04-21 | An allelomorphic gene of gene LAPTM 4B relevant to liver cancer of human, coded result and application |
| JP2005509681A JP4617257B2 (en) | 2002-12-24 | 2003-12-24 | Human cancer-related genes, products encoded by them and applications |
| AT03782072T ATE498012T1 (en) | 2002-12-24 | 2003-12-24 | HUMAN GENES RELATED TO CANCER, PRODUCTS ENCODED THEREOF, AND APPLICATIONS THEREOF |
| EP10153116.8A EP2230306B1 (en) | 2002-12-24 | 2003-12-24 | Human cancer-relating genes, its encoded products and applications |
| AU2003292867A AU2003292867A1 (en) | 2002-12-24 | 2003-12-24 | Human cancer-relating genes, the products encoded thereby and applications thereof |
| US10/540,539 US7910711B2 (en) | 2002-12-24 | 2003-12-24 | Human cancer-relating genes, the products encoded thereby and applications thereof |
| EP03782072A EP1577390B9 (en) | 2002-12-24 | 2003-12-24 | Human cancer-related genes, the products encoded thereby and applications thereof |
| PCT/CN2003/001109 WO2004058971A1 (en) | 2002-12-24 | 2003-12-24 | Human cancer-relating genes, the products encoded thereby and applications thereof |
| DE60336015T DE60336015D1 (en) | 2002-12-24 | 2003-12-24 | Human genes associated with cancer, including encoded products and applications thereof |
| US13/019,297 US20120148589A1 (en) | 2002-12-24 | 2011-02-01 | Human cancer-related gene, its encoded products and applications |
| US15/146,307 US9470690B2 (en) | 2002-12-24 | 2016-05-04 | Human cancer-related gene, its encoded products and applications |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031097863A CN1328377C (en) | 2003-04-21 | 2003-04-21 | An allelomorphic gene of gene LAPTM 4B relevant to liver cancer of human, coded result and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1539968A CN1539968A (en) | 2004-10-27 |
| CN1328377C true CN1328377C (en) | 2007-07-25 |
Family
ID=34319516
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031097863A Expired - Fee Related CN1328377C (en) | 2002-12-24 | 2003-04-21 | An allelomorphic gene of gene LAPTM 4B relevant to liver cancer of human, coded result and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1328377C (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1256952A (en) * | 1998-12-11 | 2000-06-21 | 湖南医科大学附属第二医院 | Gene medicine for treating liver cancer and preparation process thereof |
-
2003
- 2003-04-21 CN CNB031097863A patent/CN1328377C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1256952A (en) * | 1998-12-11 | 2000-06-21 | 湖南医科大学附属第二医院 | Gene medicine for treating liver cancer and preparation process thereof |
Non-Patent Citations (1)
| Title |
|---|
| 野生型p53基因提高肝癌细胞化疗药物敏感性的实验研究 梁云等，第二军医大学学报，第23卷第1期 2002 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1539968A (en) | 2004-10-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11931427B2 (en) | Therapeutical tools and methods for treating blindness by targeting photoreceptors | |
| Wang et al. | Analysis of the RNASEL gene in familial and sporadic prostate cancer | |
| Dunn et al. | Phenobarbital-inducible aldehyde dehydrogenase in the rat: cDNA sequence and regulation of the mRNA by phenobarbital in responsive rats | |
| Oota et al. | Extreme mtDNA homogeneity in continental Asian populations | |
| CN101632833B (en) | Prostatic cancer related gene and application thereof | |
| JPH09510869A (en) | Hematopoietic maturation factor | |
| Li et al. | Point mutations in mitochondrial DNA of patients with dilated cardiomyopathy | |
| Naeem et al. | Mutation in the tight-junction gene claudin 19 (CLDN19) and familial hypomagnesemia, hypercalciuria, nephrocalcinosis (FHHNC) and severe ocular disease | |
| CN105441560A (en) | Chicken body size trait breeding molecular marker IGF-1R (insulin-like growth factor-1 receptor) gene and application thereof | |
| Ji et al. | Leber's hereditary optic neuropathy is potentially associated with a novel m. 5587T> C mutation in two pedigrees | |
| CN101023184A (en) | Compositions, reagents and kits for and methods of diagnosing, monitoring and treating obesity and/or diabetes | |
| CN1328377C (en) | An allelomorphic gene of gene LAPTM 4B relevant to liver cancer of human, coded result and application | |
| López-Gallardo et al. | Food derived respiratory complex I inhibitors modify the effect of Leber hereditary optic neuropathy mutations | |
| CN105861514B (en) | The new mutation Disease-causing gene SLC12A3 of Gitelman syndrome and its coding albumen and application | |
| Dubois et al. | Molecular evolution of mammalian ribonucleases 1 | |
| CN102051366B (en) | Chicken fat candidate gene lpin1 and functional mutation detection method | |
| Zhang et al. | Pseudogenization of the tumor-growth promoter angiogenin in a leaf-eating monkey | |
| CN112342226B (en) | Human PFBC pathogenic gene MYORG with mutation at 607 th site and application thereof | |
| Gedamu et al. | Structure and expression of the human metallothionein genes | |
| CN101646784A (en) | Diagnostic marker and platform for drug design in myocardial infarction and heart failure | |
| Almahroos et al. | Studies of the parathyroid hormone gene in normal subjects, and in subjects with primary hyperparathyroidism and familial benign hypercalcaemia | |
| CN101237884A (en) | Int6 protein involved in hypoxia stress induction and use thereof | |
| Arikoglu et al. | Expression profile and polymorphisms of actin genes in protoscoleces of Echinococcus granulosus from sheep in central Turkey | |
| CN100408597C (en) | Human calcium ion / calmodulin deopendent protein kinase II inhibitory protein alpha, its coded sequence and use | |
| KR20230103866A (en) | CRISPR/Cas9 based irf3 specific sgRNA and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070725 Termination date: 20180421 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |