CN1327070A

CN1327070A - Diagnosis method based on nucleic acid having catalytic activity

Info

Publication number: CN1327070A
Application number: CN 00122574
Authority: CN
Inventors: A·V·托德; C·J·菲里; M·J·凯恩斯
Original assignee: Johnson and Johnson Research Pty Ltd
Current assignee: Johnson and Johnson Research Pty Ltd
Priority date: 2000-06-03
Filing date: 2000-06-03
Publication date: 2001-12-19

Abstract

The present invention provides one method and kit for diagnosis of disease caused by nucleic acid mutatino(s). The method includes the following steps: separating nucleic acid molecule sample; cloning one or several catalytic nucleic acid molecules; cracking specifically the target sequence in either disease sample or corresponding wild nucleic acid segment; and measurement of cracked cloned segment.

Description

Diagnostic method based on nucleic acid with catalytic activity

In this application, various documents have been quoted as proof.The content of these documents is enrolled the application as a reference to describe the present situation in the field that the present invention relates to more fully.

The present invention relates to diagnostic characteristic is the method for the disease of known nucleic acid sudden change.Present method adopts the nucleic acid molecule of catalytic activity, and is used for combining with diagnosis such as the disease of cancer and AIDS.

Various heredity and acquired disease and such as point mutation, disappearance is relevant with the hereditary change of inserting.Some change directly relevant with the existence of disease, and other change is relevant with disease risks and/or prognosis.There is the genetic diseases more than 500 kinds to cause (21,22) by the sudden change of individual gene.They comprise cystic fibrosis, muscular dystrophy, alpha1-antitrypsin defective, pku, sickle cell disease or characteristic, various other hemoglobinopathies (21,22).And to some common polygene illnesss, the individuality that increases as atherosclerosis heart trouble susceptibility demonstrates the genetic correlation with the specific dna sequence polymorphism.

It is believed that cancer is that accumulation owing to genetic damage in the gene that relates to hyperplasia or differentiation forms.The ras proto-oncogene, K-ras, N-ras and H-ras, and the p53 tumor suppressor gene is the example of the gene of frequent sudden change in the human cancer.Specific sudden change causes transforming potentiality in these genes increases.Estimating disease risks, the diagnosis of disease, prediction patient's prognosis or be unpriced to genetic analysis in the reaction of treatment clinical.Yet, to introduce this class genetic test and depend on that exploitation is simple, cheap and test rapidly is used for hereditary change.

The method of external nucleic acid amplification has been widely used in the diagnosis of genetics and disease.In nearest 10 years, many nucleic acid amplification technologies have been described.They comprise polymerase chain reaction (PCR) (1-7), ligase chain reaction (LCR) (8), the amplification (TMA) (10,11) (being also referred to as the sequence replicating (SSR) that the oneself keeps) of strand displacement amplification test (SDA) (9) and transcriptive intermediate.By PCR, the amplified production (amplicon) that LCR and SDA produce is DNA, and TMA produces rna replicon.Can analyze the DNA that produces by these methods or other method or RNA template to determine to change the existence of (i.e. sudden change) with the sequence of disease-related.

Use nucleic acid amplification, furtherd investigate catalytic nucleic acid recent years.Use catalytic nucleic acid as the potentiality of therapeutical agent suppressor gene function extensive discussions (12-18) in the literature.Shown the RNA of catalytic activity molecule (ribozyme) energy cleaving rna (12) and DNA (17) molecule have been arranged.Equally, show that also catalytic dna molecular (DNAzymes) can cleaving rna (13,19) and DNA (18) molecule.Catalytic nucleic acid only can the cracking target nucleic acid sequence, as long as target sequence can satisfy the minmal sequence requirement.Target sequence must must contain particular sequence at cracking site with the hybridization region complementation and the target of catalytic nucleic acid.Need the example of this sequence to comprise that a class DNA zyme cracking (10-23 type) is to purine at cracking site: the needs of pyrimidine sequence (19), hammerhead ribozyme are to the needs of sequence uridylic: H, and wherein H can equal A, C or U, but can not be G (23).

Except its therapeutic potentiality, the catalytic nucleic acid molecule also can be distinguished the target (14-16) that its difference is a single point sudden change.Be present in wild-type and the mutagenicity template does not exist or just opposite specific sequence is realized this point through target.So far, this separating capacity only is used as the method that the genetic expression therapeutic is transformed.

The nucleic acid type that the summary of Nollau-Wagener (24) is just analyzed, the sudden change percentage ratio of detection, time of testing and cost relate to the problem of using toxic reagent and have compared some and be used for the method for point mutation detection.The method of each inspection all has its shortcoming.For example, denaturing gradient gel electrophoresis is consuming time, and the RNA enzymatic lysis only can detect about 70% possible sudden change, and chemical cracking relates to the use toxic substance.

The other method that is called restriction fragment length polymorphism (RFLP) relates to determines whether there is the Restriction Enzyme site on interested locus.Under few situation, can detect sudden change, because they are positioned at naturally occurring restriction endonuclease identification/cracking site (31) by chance.

Be used to help the primer of amplification in vitro to include wrong base and may cause introducing artificial restriction endonuclease identification/cracking site, therefore, the locus number of available rflp analysis increases (32).The Mdification primer that contains base mismatch is used for introducing on the crucial codon artificial congnition/cracking site of restriction endonuclease in the ras gene family.Set up (36) at the general rule that contains the primer of base mismatch near primer 3 ' end design.

Although use the mispairing primer to widen the practicality of rflp analysis, this technology still is subjected to the restriction of this fact, i.e. Restriction Enzyme identification and 4 base pairs of the minimum needs of cracking.

The invention provides and determine whether the experimenter suffers from the method for the disease that it is characterized in that existing the known nucleic acid sudden change, and this method comprises the steps: (a) isolated nucleic acid molecule sample from the experimenter; (b) (i) nucleic acid fragment that exists in the sample separation of amplification, this fragment is known to contain sudden change in suffering from the experimenter of this disease, (ii) under appropriate condition, the amplified fragments and the catalytic nucleic acid molecule of contact gained, identification of this catalytic nucleic acid molecular specificity ground and cracking (1) in having the nucleic acid fragment of known mutations or (2) in corresponding wild type nucleic acid fragment, but be not simultaneous target sequence among both, prerequisite is that step (ii) can be carried out afterwards or simultaneously at step (i); (c), determination step (b) (ii) in catalytic nucleic acid molecule cracking amplified fragments whether, to determine whether the experimenter suffers from this disease.

The present invention also provides definite experimenter whether to suffer to it is characterized in that the method for the disease that has many places known nucleic acid sudden change, comprises the steps; (a) sample of isolated nucleic acid molecule from the experimenter; (b). (i) nucleic acid fragment that exists in the isolating sample of amplification, the known many places of containing in suffering from the experimenter of this disease of this fragment suddenly change, (ii) under appropriate condition, the amplified fragments of gained is contacted with multiple catalytic nucleic acid molecule, every kind of catalytic nucleic acid molecule all identification and cracking (i) specifically in having the nucleic acid fragment of known mutations or (2) in corresponding wild type nucleic acid fragment, but be not the target sequence that exists among both, prerequisite is that step (ii) can be carried out afterwards or simultaneously at step (i); (c) determination step (b) (ii) in each catalytic nucleic acid molecule cracking amplified fragments whether, to determine whether this experimenter suffers from this disease.

The present invention also provides and has measured the method whether experimenter suffers from the disease that it is characterized in that existing many places known nucleic acid sudden change, and this method comprises the steps: (a) isolated nucleic acid molecule sample from the experimenter; (b). (i) nucleic acid fragment that exists in the isolating sample of amplification, the known many places of containing jointly in suffering from the experimenter of this disease of these fragments suddenly change, (ii) under appropriate condition, the amplified fragments and the multiple catalytic nucleic acid molecule of contact gained, every kind of catalytic nucleic acid molecule all identification and cracking (1) specifically in having a kind of a kind of nucleic acid fragment of known mutations, or (2) are in corresponding wild type nucleic acid fragment, but be not the target sequence that exists among both, prerequisite is that step (ii) can be carried out afterwards or simultaneously at step (i); (c) determination step b) (ii) in each catalytic nucleic acid molecule whether cracking contain its separately the amplified fragments of target sequence to determine whether this experimenter suffers from this disease.

At last, the invention provides the test kit that is used to implement this diagnostic method.First kind of this class test kit comprises: (a) a kind of catalytic nucleic acid molecule, it is discerned specifically and cracking (i) is in a kind of nucleic acid fragment of sudden change of feature of disease or (ii) in corresponding wild type nucleic acid fragment having known, but not the target sequence that in both, exists simultaneously, be applicable to that (b) amplification contains the nucleic acid reagent of the nucleic acid fragment of target sequence.

Second kind of this class test kit comprises: (a) 10-23 DNAzyme, it is discerned specifically and cracking (i) is in a kind of nucleic acid fragment of sudden change of feature of disease or (ii) in corresponding wild type nucleic acid fragment having known, but not the target sequence that in both, exists simultaneously, (b) be suitable under the polymerase chain reaction condition dna primer of this fragment amplification of starting, this primer contains at least one purine ribonucleotide residue, and it is used as by the 5 ' side site in 10-23 DNAzyme identification and the cracked amplified fragments.

The third this class test kit comprises (a), first dna primer, it contains the enzyme gene of the 10-23DNAzyme that encodes, this DNAzyme discerns specifically and cracking (i) is in a kind of nucleic acid fragment of characteristic sudden change of disease or (ii) in corresponding wild type nucleic acid fragment having known, but be not the target sequence that exists in both simultaneously, this first primer is suitable for this segmental amplification of starting under the polymerase chain reaction condition; (b) a kind of second dna primer that is suitable for this fragment amplification of starting under the polymerase chain reaction condition, this second primer contains at least one purine ribonucleotide residue, be used as by the 5 ' side site in 10-23 DNAzyme identification and the cracked amplified fragments, like this, when amplification, (i) nucleic acid molecule of the amplification of gained contains 10-23 DNAzyme, and the nucleic acid fragment of (ii) amplification is discerned and cracking by the DNAzyme cis.

The invention provides the method that adopts catalytic nucleic acid molecular assay experimenter whether to suffer to it is characterized in that the disease that has a place or the sudden change of many places known nucleic acid.These methods are applicable to following scheme jointly, and wherein this disease is characterised in that (i) single sudden change in single nucleic acid fragment, or the (ii) a plurality of sudden changes in single nucleic acid fragment, or the (iii) sudden change of the many places in a plurality of nucleic acid fragments.For with nucleic acid amplification, each sudden change of specificity cracking and analytical test, this method provides the answer of " be or not " to whether there being sudden change.Whether this answer finally causes again existing corresponding disease to draw the answer of " be or not " in the experimenter.

Specifically, the invention provides and measure the method whether experimenter suffers from the disease that it is characterized in that existing the known nucleic acid sudden change, it comprises following steps: (a) isolated nucleic acid molecule sample from the experimenter; (b) nucleic acid fragment that (i) increases and in isolating sample, exist, known in suffering from the experimenter of this disease this fragment contain sudden change, (ii) under appropriate condition, the amplified fragments of gained is contacted with the catalytic nucleic acid molecule, identification of this catalytic nucleic acid molecular specificity ground and cracking (i) in having the nucleic acid fragment of known mutations or (2) in corresponding wild type nucleic acid fragment, but be not the target sequence that exists in both simultaneously, prerequisite is that step (ii) can be carried out afterwards or simultaneously at step (i); (c) the catalytic nucleic acid molecule of determination step (b) in (ii) cracking amplified fragments whether is so that determine whether the experimenter suffers from this disease.

The present invention also provides definite experimenter whether to suffer to it is characterized in that the method for the disease that has many places known nucleic acid sudden change, and it comprises the steps, (a) from the sample of experimenter's isolated nucleic acid molecule; (b) (I) nucleic acid fragment that exists in the isolating sample of amplification, known in suffering from the experimenter of this disease this fragment contain many places sudden changes, (ii) under conditions suitable, the amplified fragments and the multiple catalytic nucleic acid molecule of contact gained, identification of every kind of catalytic nucleic acid molecular specificity ground and cracking (i) in having the nucleic acid fragment of known mutations or (2) in corresponding wild type nucleic acid fragment, but not the target sequence that in both, exists simultaneously, prerequisite is that step (ii) can be carried out afterwards or simultaneously at step (i), (c) determination step (b) each catalytic nucleic acid molecule in (ii) fragment of cracking amplification whether is so that determine whether the experimenter suffers from this disease.

The present invention also provides and has measured the method whether experimenter suffers from the disease that it is characterized in that existing multiple known nucleic acid mutation, comprises following step: (a) isolated nucleic acid molecule sample from the experimenter; (b) nucleic acid fragment that (i) increases and in isolating sample, exist, known in suffering from the experimenter of this disease these fragments contain various mutations jointly, and (ii) under conditions suitable, the amplified fragments and the multiple catalytic nucleic acid molecule of contact gained, identification of every kind of catalytic nucleic acid molecular specificity ground and cracking (1) in having a kind of a kind of nucleic acid fragment of known mutations or (2) in corresponding wild type nucleic acid fragment, but be not a kind of target sequence that exists in both simultaneously, prerequisite is that step (ii) can be carried out afterwards or simultaneously at step (i); (c) whether cracking contains the amplified fragments of target sequence separately to determination step (b) each catalytic nucleic acid molecule in (ii), to determine whether this experimenter suffers from this disease.

Present method is used among any experimenter and diagnoses the illness." experimenter " used herein refers to any animal, for example, comprises mouse, rat, dog, cavy, ferret, rabbit and primates.In preferred embodiments, the experimenter is human.

The disease of the present invention's diagnosis can be any disease that it is characterized in that existing at least a known nucleic acid mutation, when not having this disease, and should sudden change.This disease is known in this area, for example, comprises cancer, AIDS, cystic fibrosis, muscular dystrophy, alpha1-antitrypsin defective, pku, herrik syndrome or feature and various other hemoglobinopathy.In one embodiment, this disease is selected from cancer, AIDS and cystic fibrosis.In preferred embodiments, this disease is a cancer.Experiment is below described in detail in the part, has provided specific mutant, contains the target sequence of this sudden change and is used for diagnosis such as cancer, many examples of the catalytic nucleic acid of the disease of AIDS and cystic fibrosis.

" catalytic nucleic acid molecule " used herein refers to discern specifically dna molecular (this area is also referred to as " DNAzyme ") or the RNA molecule (this area is also referred to as " ribozyme ") with the different target nucleic acid sequences of cracking.For DNAzymes and ribozyme, target nucleic acid sequence can be DNA or RNA.

Having the nucleotide sequence (that is the sequence that increases in the method) of known genius morbi sudden change can be DNA or RNA sequence.These sudden changes comprise, for example, point mutation, sudden change and phase shift mutation are inserted in deletion mutantion.The nucleic acid fragment of various amplifications and catalytic nucleic acid molecule can be DNA or RNA.In one embodiment, the nucleic acid fragment of amplification is RNA, and the catalytic nucleic acid molecule is DNA or RNA.In another embodiment, the nucleic acid fragment of amplification is DNA, and the catalytic nucleic acid molecule is RNA or DNA (25).

The separation that the present invention uses and the method for amplifier nucleic acid molecule are known in the art.More particularly, the method for isolated nucleic acid molecule sample comprises from the experimenter, for example, the phenol chloroform extraction, fast cracking, on post, catch and multimeric capture (20,26-29).The method of amplifying nucleic acid sequence comprises, for example, PCR, LCR, SDA and TMA (being also referred to as (SSR)) are (1-11).

Amplification of nucleic acid fragment and catalytic nucleic acid molecule that contact contains target sequence are well known in the art so that allow the conditions suitable of specific recognition and cracking target sequence.In addition, this condition is tested below to describe in detail partly and is given an example.

Measure the catalytic nucleic acid molecule whether the method for the nucleic acid fragment of cracking amplification also be the ordinary skill in the art.For example, this method comprises, polyacrylamide gel electrophoresis and capillary electrophoresis (20,30).

In the preferred embodiment of the invention, (a) use polymerase chain reaction to increase; (b) the catalytic nucleic acid molecule is 10-23 DNAzyme; (c) polymerase chain reaction adopts the dna primer (that is, " chimeric " primer) that is suitable for starting the nucleic acid fragment amplification, and this primer contains at least one purine ribonucleotide residue, as the 5 ' side site in 10-23 DNAzyme identification and the cracked amplified fragments.This purine ribonucleotide residue in the chimeric primers be for the 10-23DNAzyme cracking necessary.Therefore, use this chimeric primers to allow in the PCR reaction, to produce 10-23 DNAzyme cracking site.Chimeric primers also can comprise, for example, is used as the ribonucleotide residue in 10-23 DNAzyme identification and cracked 3 ' side site.

In a kind of form of this embodiment, the fragment of amplification is by trans identification of DNAzyme and cracking.In another form, (a) second kind of dna primer being suitable for starting fragment amplification adopted in the polymerase chain reaction, and this second kind of primer comprises the enzyme gene of coding 10-23 DNAzyme, so that during amplification, the amplifier nucleic acid molecule of gained comprises 10-23 DNAzyme; (b) Kuo Zeng nucleic acid fragment is discerned and cracking by the DNAzyme cis.

Used hereinly referred to that by DNAzyme " cis " cracking DNAzyme identification and cracking and its coexist as the sequence on the identical amplifier nucleic acid molecule.Trans cracking refers to that the DNAzyme cracking is positioned at the substrate on the differing molecular.At last, " enzyme gene " refers to comprise the nucleotide sequence of catalytic nucleic acid molecule antisense (that is, complementation) sequence, and its transcription product is a catalytic nucleic acid molecule itself.

The present invention also provides the test kit that is used to implement this diagnostic method.First kind of this test kit comprises (a) a kind of catalytic nucleic acid molecule, it is discerned specifically and cracking (i) is in a kind of nucleic acid fragment of characteristic sudden change of disease or (ii) in corresponding wild type nucleic acid fragment having known, but not the target sequence that in both, exists simultaneously and (b) be applicable to that amplification contains the nucleic acid reagent of the nucleic acid fragment of target sequence.

In one embodiment, this test kit comprises multiple catalytic nucleic acid molecule.Being applicable to that the nucleic acid reagent of nucleic acid fragment that amplification contains target sequence can be, for example, a kind of nucleic acid primer.In one embodiment, this test kit comprises multiple this nucleic acid reagent.

More particularly, second kind of this class test kit comprises (a) a kind of 10-23 DNAzyme, it is discerned specifically and cracking (i) is in a kind of nucleic acid fragment of characteristic sudden change of disease or (ii) in corresponding wild type nucleic acid fragment having known, but not the target sequence that in both, exists simultaneously, (b) under the polymerase chain reaction condition, be suitable for this segmental dna primer of starting amplification, this primer contains at least one purine ribonucleotide residue, and it is used as by the 5 ' side site in 10-23 DNAzyme identification and the cracked amplified fragments.

The third this class test kit comprises: (a) first dna primer, it contains the enzyme gene of the 10-23DNAzyme that encodes, this 10-23 DNAzyme discerns specifically and cracking (i) is in a kind of nucleic acid fragment of characteristic sudden change of disease or (ii) in corresponding wild type nucleic acid fragment having known, but be not the target sequence that exists in both simultaneously, this first primer is suitable for this segmental amplification of starting under the polymerase chain reaction condition; (b) a kind of second dna primer, it is suitable for this fragment amplification of starting under the polymerase chain reaction condition, this second primer contains at least one purine ribonucleotide residue, as the 5 ' side site in 10-23 DNAzyme identification and the cracked amplified fragments, so that when amplification, (i) amplifier nucleic acid molecule of gained contain 10-23 DNAzyme and (ii) the amplification nucleic acid fragment discerned and cracking by the DNAzyme cis.

In one embodiment, this test kit further comprises one or more following composition: (a) be used for from the reagent of experimenter's isolated nucleic acid molecule sample of being diagnosed; (b) be used for the increasing reagent of the nucleic acid fragment that is present in isolating sample, the known sudden change that contains in suffering from the experimenter of this disease of this fragment; (c), be used to produce the reagent of the active suitable reaction conditions of catalytic nucleic acid.Reagent in this test kit composition (a)-(c) can obtain from commercial channels or according to method preparation well known in the art, this tests below to describe in detail in the part and gives an example.

The composition of this test kit can be solution or freeze-drying on demand.In one embodiment, the composition of this test kit is in same compartment, and in another embodiment, the composition of this test kit is in the compartment that separates.In preferred embodiments, this test kit also comprises working instructions.

Be easier to understand the present invention with reference to following experiment detailed description, but those skilled in the art reckons with that easily the concrete experiment of detailed description only is to explanation of the present invention, has done to describe more fully in claims thereafter.

Below the example of listed DNAzymes and ribozyme based on 10-23 DNAzyme (19), and be designed to the following medically important target of cracking.Below the example of listed ribozyme based on hammerhead ribozyme (12).I.DNAzymes

R=purine wherein, A or G

The y=pyrimidine, C, T or U

H=A, T, U or C (not being G)

D=A, T, U or G (not being C)

R=C, T, U or G (not being A)

V=A, C, or G (not being T, is not U).

W=T, U, or A.

Italics=use contains with the primer of target sequence mismatched bases and imports through amplification in vitro is artificial

Base.

Black matrix with=the target base or the sequence that are used to analyze.

Underscore=recognition site (Ry/R).

The sequence (primer inductive artificial sequence) that E=modifies.A, acquired disease (1) cancer (a) K-ras codon 12, position 2-mutant (G sports C, U or A).

5 '-GUU GGA GCU GGU GGC GUA GGC-3 ' wild-type

RNA

5 '-GUU GGA GCU GYU GGC GUA GGC-3 ' mutant RNA

3′-CAA?CCT?CGA RA?CCG?CAT?CCG-5′ DNAzyme

5 '-GUU GGA GCU GAU GGC GUA GGC-3 ' mutant

3 '-CAA CCU CGA CUA CCG CAU CCG-5 ' antisense

5 '-GCC UAC GCC AUC AGC UCC AAC-3 ' antisense

3 '-CGG ATG CGG AG TCG AGG TTG-5 ' DNAzyme

(b) the K-ras codon 13, position 1-mutant (G is mutated into A, U or C)

5 '-GGA GCU GGU GGC GUA GGC AAG-3 ' wild-type

RNA

5 '-GGA GCU GGU HGC GUA GGC AAG-3 ' mutant RNA

3 '-CCT CGA C A UCG CAT CCG TTC-5 DNAzyme (c) the H-ras codon 61, position 1-mutant (G is mutated into G, U or A)

5 '-ACC GCC GGC CAG GAG GAG-3 ' wild-type

RNA

5 '-ACC GCC GGC DAG GAG GAG-3 ' mutant RNA

3 '-TGG CGG C G HTC CTC CTC-5 ' DNAzyme (d) the H-ras codon 61, position 2-mutant (A is mutated into C, G or U)

5 '-ACC GCC GGC CAG GAG GAG-3 ＇ wild-type

RNA

3 '-UGG CGG CCG GUC GUC CUC-5 ' E wild-type

RNA

5 '-CUC CUG CUG GCC GGC GGU-3 ' E wild-type

RNA

3 '-GAG GA GAC CGG CCG CCA-5 ' DNAzyme (e) the H-ras codon 61, position 3-mutant (G is mutated into C or U)

(annotate: it is silent mutation that C is mutated into A)

5 '-ACC GCC GCC CAG GAG GAG-3 ' wild-type

HNA

5 '-ACC GCC GGC CAY GAG GAG-3 ' mutant RNA

3 '-UGG CGG CCG GUR CUC CUC-5 ' antisense

5 '-CUC CUC RUG GCC GGC GGU-3 ' antisense

3 '-GAG GAG AC CGG CCG CCA-5 ' DNAzyme

(f) the N-ras codon 61, position 1-mutant (C is mutated into A, G or U)

5 '-GCU GGA CAA GAA GAG-3 ' wild type rna

5 '-GCU GGA DAA GAA GAG-3 ' mutant RNA

3 '-CGA CCU HUG CUU CUC-5 ' E mutant RNA

5 '-CUC UUC GUH UCC AGC-3 ' E mutant RNA

3′-GAG?AAG AD?AGG?TCG-5′ DNAzyme

5 '-GCU CGA UAA GAA GAG-3 ' mutant RNA

3 '-CGA CC ATT CTT CTC-5 ' DNAzyme

(2) HIV 1-AZT resistance, point mutation (a) codon 41-mutant (A is mutated into U or C)

5 '-UGU ACA GAA AUG GAA AAG-3 ' wild-type

RNA

5 '-UGU ACA GAA YUG GAA AAG-3 ' mutant RNA

3 ' ACA TGT CT RAC CTT TTC-5 ' DNAzyme (b) codon 70-mutant (A is mutated into G)

5 '-GAC AGU ACU AAA UGG AGA AAA-3 ' wild-type

RNA

5 '-GAC AGU ACU AGA UGG AGA AAA-5 ' mutant RNA

3 '-CTG TCA TGA TC ACC TCT TTT-3 ' DNAzyme

(c) codon 215-mutant (C is mutated into U or A)

5 '-AGG UGG GGA UUU ACC ACA CCA GAC-3 ' wild-type

RNA

5 '-AGG UGG GGA UUU AUC ACA CCA GAC-5 ' mutant RNA

3′-TCC?ACC?CCT?AAA AG?TGT?GGT?CTG-3′?DNAzyme

5 '-AGG UGG GGA UUU AAC ACA CCA GAC-5 ' mutant RNA

3 '-TCC ACC CCT AAA T G TGT GGT CTG-3 ' DNAzyme

(d) codon 74-mutant (U is mutated into G the ddT resistance is provided)

5 '-AAA UGG AGA AAA UUA GUA GAU-3 ' wild-type

RNA

5 '-AAA UGG AGA AAA GUA GUA GAU-3 ' mutant RNA

3 '-TTT ACC TCT TTT AT CAT CTA-3 ' DNAzyme

B. inherited disease (1) cystic fibrosis (a) codon 542-wild-type

5 '-UAGUUCUUGGAGAAGGU-3 ' life type RNA

5 '-UAGUUCGUGGAGAAGGU-3 ' E wild type rna

3 '-ATCAAG ACCTCTTCCA-5 ' DNAzyme

Codon 542-mutant (G is mutated into U)

5 '-UAGUUCUUUGAGAAGGU-3 ' mutant RNA

5 '-UAGUUCGUUGAGAAGGU-3 ' E-mutant RNA

3 '-ATCAAG AACTCTTCCA-5 ' DNAzyme

(b) codon 551-wild-type

5 '-GAGUGGAGGUCAACGAG-3 ' wild type rna

3 '-CUCACCUCCAGUUGCUC-5 ' antisense

5 '-CUCGUUGACCUCCACUC-3 ' antisense

3 '-GAGCAAC GGAGGTGAG-5 ' DNAzyme Codon 551-mutant (G is mutated into A)

5 '-GAGUCGAGAUCAACGAG-3 ' mutant RNA

3 '-CUCACCUCUAGUUGCUC-5 ' antisense

5 '-CUCGUUGAUCUCCACUC-3 ' antisense

3 '-GAGCAAC AGAGGTGAG-5 ' DNAzyme

(c) codon 508-wild-type

5 '-GAAAUAUCAUCUUUGGUGUUU-3 ' wild type rna

3 '-CTTTATAG AGAAACCACAAA-5 ' DNAzyme

Codon 508-mutant (CTT disappearance)

5 '-AAAUAUCAUUGGUGUUU-5 ' mutant RNA

3 '-TTTATAG AACCACAAA-3 ' DNAzyme

(2) α 1-antisteapsin defective codon 342-mutant (G is mutated into A)

5 '-GACCAUCGACGAGAAAGG-3 ' wild type rna

5 '-GACCAUCGACAAGAAAGG-3 ' mutant RNA

3 '-CTGGTAGC GTTCTTTCC-5 ' DNAzyme II. ribozyme

The target base of boldface type=be used to analyze wherein

Underscore=recognition site (UH) A. acquired disease (1) cancer K-ras codon 12, position 1-mutant (G is mutated into A, C or U)

5 '-GUA GUU GGA GCU GGU GGC GUA-3 ' wild-type

RNA

5 '-GUA GUU GGA GCU HGU GGC GUA-3 ' mutant RNA

3 '-CAU CAA CCU CGA CA CCG CAU-5 ' ribozyme

K-ras codon 12. position 2-mutants (G is mutated into U)

5 '-GUU GGA GCU GGU GGC GUA GGC-3 ' wild-type

RNA

5 '-GUU GGA GCU GUU GGC GUA GGC-3 ' mutant RNA

3 '-CAA CCU CGA CA CCG CAU CCG-5 ' ribozyme

(2) HIV 1-AZT resistance (a) codon 41-mutant (A is mutated into U or C)

5 '-UGU ACA GAA AUG GAA AAG-3 ' wild-type

RNA

5 '-UGU ACA GAA YUG GAA AAG-3 ' mutant RNA

3 '-ACA UGU CUU RAC CUU UUC-5 ' antisense

5 '-CUU UUC CAR UUC UGU ACA-3 ' antisense

3 '-GAA AAG GUY A G ACA UGU-5 ' ribozyme

(b) codon 70-mutant (A is mutated into G)

5 '-GAC AGU ACU AAA UGG AGA AAA-3 ' wild-type

RNA

5 '-GAC AGU ACU AGA UGG AGA AAA-3 ' mutant RNA

3 '-CUG UCA UGA UCU ACC UCU UUU-5 ' antisense

5 '-UUU UCU CCA UCU AGU ACU GUC-3 ' antisense

3 '-AAA AGA GGU AGA CA UGA CAG-5 ' ribozyme

(c) codon 215-mutant (C is mutated into U or A)

5 '-AGG UGG GGA UUU ACC ACA CCA GAC-3 ' wild-type

RNA

5 '-AGG UGG GGA UUU AWC ACA CCA GAC-3 ' mutant RNA

3 '-UCC ACC CCU AAA UWG UGU GGU CUG-5 ' antisense

5 '-GUC UGG UGU GWU AAA UCC CCA CCU-3 ' antisense

3 '-CAG ACC ACA CWA UU AGG GGU GGA-5 ' ribozyme

(d) codon 74-mutant (U is mutated into G the ddT resistance is provided)

5′-AAA?UGG?AGA?AAA?UUA?GUA?GAU-3′

Wild-type

RNA

5 '-AAA UGG AGA AAA GUA GUA GAU-3 ' mutant RNA

3 '-UUU ACC UCU UUU CA CAU CUA-5 ' ribozyme B. inherited disease (1) cystic fibrosis (a) codon 542-wild-type

5 '-UAGUUCUUGGAGAAGGUGGA-3 ' wild-type

RNA

3 '-AUCAAGA CCUCUUCCACCU-5 ' ribozyme Codon 542-mutant (G is mutated into U)

5 '-UAGUUCUUUGAGAAGGU-5 ' mutant RNA

3 '-AUCAAGA ACUCUUCCA-3 ' ribozyme

(b) codon 551-wild-type

5 '-GAGUGGAGGUCAACGAG-3 ' wild-type

RNA

3 '-CUCACCUCCA UUGCUC-5 ' ribozyme

Codon 551-mutant (G is mutated into A)

5 '-GAGUGGAGAUCAACGAG-3 ' mutant RNA

3 '-CUCACCUCUA UUGCUC-5 ' ribozyme (c) codon 508-wild-type

5 '-GAAAUAUCAUCUUUGGUGUUU-3 ' wild-type

RNA

3 '-CUUUAUAGUAGA ACCACAAA-5 ' ribozyme Or codon 508-mutant (CUU disappearance)

5 '-GAAAUAUCAUUGGUGUUU-3 ' mutant RNA

3 '-CUUUAUAGUA CCACAAA-5 ' ribozyme (2) beta-globin β+-boldface type (poly a-signal)-mutant (U is mutated into C)

5 '-UCUGCCUAAUAAAAAAACAU-3 ' wild-type

RNA

5 '-UCUGCCUAACAAAAAACAU-3 ' mutant RNA

3 '-AGACGGAUUGUUUUUUGUA-5 ' antisense

5 '-AUGUUUUUUGUUAGGCAGA-3 ' antisense

3 '-UACAAAAAACA UCCGUCU-5 ' ribozyme III. use ribozyme to carry out K-ras and analyze the ribozyme target sudden change of A at K-ras codon 12 places

The human K-ras gene is GGT in the sequence at codon 12 places.Often observe point mutation and pancreas on preceding 2 bases of this sequence, lung and colorectal carcinoma interrelate.Designed that 2 ribozymes come the cracking mutant but not cracking wild-type K-ras.K-ras5 ' AGUUGGAGCUHGUGGCGUAGG3 ' ribozyme I3 ' UCAACCUCGA CACCGCAUCC 5 '

(K-ras codon 12-boldface letter; Ribozyme target doublet-underscore)

Top ribozyme I is designed to cracking and contains all RNA molecules of point mutation 12 first of codons, but is designed to not cracking wild-type sequence.The target sequence of ribozyme is UH, and wherein H can equal C, U or A, but be not equal to G.Because wild-type sequence in this position is G, so with these all mutants of ribozyme cleavable.

K-ras 5′····UUGGAGCUGUUGGCGUAGGCA·····3′

Ribozyme II 3 ' AACCUCGACA CCGCAUCCGU 5 '

(K-ras codon mutation equipotential group-boldface letter; Ribozyme target doublet-underscore)

Ribozyme II is designed to target and is replaced to U second of codon 12 by G.Wild-type sequence G can not match with the primary A that ribozyme is hybridized in the arm, so the wild-type sequence expection can be by this ribozyme cracking.

With Macromolecular Resources (Fort Collins, Co) dna sequence dna of composite coding ribozyme I and II.The antisense of annealing ribozyme and sense strand and clone advance carrier pSP70, and (Promega Corporaton, Madison is WI) behind the T7 polymerase promoter in.Through digesting at 3 ' site of ribozyme these clones of line styleization, purifying then with NdeI.With the outer radiolabeled ribozyme of rna transcription prepared in reaction of standard body, wherein use these templates mix [α- ³²P] UTP (20).B. prepare the K-ras template

(Rockville MD) obtains human cell line SW480 and CaluI from American type culture collection.Colon carcinoma cell line SW 480 has homozygous mutation (GTT) on the 2nd in K-ras codon 12.Calu I is a lung cancer cell line, and it is a heterozygosis on the position 1 in K-ras codon 12, has wild-type (GGT) and mutant (TGT) allelotrope.

Through pcr amplification Calu I and SW 480 DNA and contain codon 12 for the K-ras of mutant inserts segmental PUC plasmid clone generation K-ras dna profiling (4 mutants and 1 wild-type are arranged at codon 12 places).The sequence of 5 ' PCR primer is TGGACTTAATACGACTCACTATAGG GCGACTGAATATAAACTTGTGGTAG.This 5 ' primer inserts in the T7 promotor at 5 ' end.The sequence of 3 ＇ primers is CCTCTATTGTTGGATCATATTCG.Mix [α- ³²P] use the T7/K-rasPCR product to produce radiolabeled K-rasRNA template (20) in the outer rna transcription reaction of standard body of UTP.C. check point sudden change

Carry out external cracking experiment as described below.At lysis buffer (10mM MgCl ₂250mM TrisCl is pH7.5) with 4: 1 mol ratio incubation ribozyme and substrate.50 ℃ with radiolabeled K-rasRNA template and ribozyme I and II insulation 6 hours to measure external cracking ability.With the polyacrylamide gel electrophoresis analytical reaction.Ribozyme I successfully cracking contains C on the position 1 of codon 12, the K-ras RNA of A or U sudden change but can not cracking wild-type sequence G.Ribozyme II successfully cracking contain in codon 12 positions 2 U sudden change K-ras RNA but can not cracking wild-type sequence G.Therefore exist cleaved K-rasRNA to be diagnosed as on codon 12 and have point mutation.

This analysis has confirmed the ability of the external template of catalytic nucleic acid specificity cracking, and this ability provides the basis of diagnosis with the disease that exists mutant nucleotide sequence to interrelate.Nucleic acid can increase with various technology, and for example, PCR or TMA use catalytic nucleic acid then, for example, and DNAzyme (10-23 type) or ribozyme cracking.This method can be used for detecting the point mutation among the K-ras, this sudden change and lung, and colon and carcinoma of the pancreas are got in touch specifically.This scheme can be used for diagnosing any disease that it is characterized in that existing acquired or genetic mutation.

IV. use 10-23 DNAzymes and chimeric primers to carry out the K-ras mutation analysis.

Walder etc. (38) had shown that the extensible DNA/RNA chimeric primers of TaqDNA polysaccharase, this primer contained one or 23 ' end ribose residue in the past.Santoro and Joyce (19) have shown 10-23DNAzyme crack DNA/prna chimera substrate.Here use chimeric primers to produce pcr amplification, it is as the substrate of 10-23DNAzyme.A uses DNAzymes to distinguish the allelotrope of variation; With the trans DNAzymes target sequence that provides.

Realize the DNAzyme substrate that cracking produces from chimeric primers through the DNAzyme that in the PCR mixture, adds chemosynthesis.In this reaction, DNAzyme is with trans direction cracking substrate.

(1) sudden change of DNAzymes target on K-ras codon 12; Natural cracking site (a) scheme

Use a zone of the pcr amplification K-ras gene of 5 ' DNA/RNA chimeric primers (5K42r) and 3 ' primer (3K2).5K42r is with the K-ras sequence hybridization that is close to codon 12 and contain the purine that forms potential dna zyme cracking site: the pyrimidine residue.Chimeric primers is complementary fully with the K-ras sequence that the natural cracking site of 10-23DNAzyme is provided.Extend the codon 12 of amplification K-ras gene from 5K42r 3 ' end with the Taq archaeal dna polymerase.Design dna zyme, Dzl contain the amplicon of wild-type sequence at K-ras codon 12 with cracking.5 ' arm of DNAzyme is complementary fully with the sequence that at codon 12 places is wild-type.Cause and the mispairing of 5 ＇ DNAzyme hybridization arm in the sudden change of K-ras codon 12 places, expection can obviously reduce DNAzyme cracked efficient.(b) primer and DNAzyme sequence

5′TATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAA?3′K-ras

5 ' TATAAACTTGTGGTAGTTGGAgcT 3 ' " 5K42r " primer

3′ TGAACACCATCAACCT?GACCACCG?5′ “Dzl”DNAzyme

(codon 12 underscores of K-ras wild-type sequence, the ribonucleotide base among the primer 5K42r is a lowercase.)

Design another PCR primer 3K2, when increasing, produce the amplicon of 82 base pairs with 5K42r.The sequence of 3K2 is:

5 ' CGTCCACAAAATGATTCTGA 3 ' " 3K2 " primer

Primer and DNAzyme by Pacific Oligos Pty.Ltd. (Lismore, NSW, Australia) or OligosEtc., Inc. (Wilsonville, OR.USA) synthetic.Come modifying DNA zyme Dzl through adding 3 ' phosphoric acid (phosphate) group to prevent to be extended by the Taq archaeal dna polymerase.Through primer and 2.5 μ l polynucleotide kinases (10 * 10 with 25 μ l20 μ M ³U/ml does not have 3 ' phosphorus enzyme enzyme, Boehringer Mannheim), 2.5 μ lRNasin (40U/ul reorganization RNasin , ribonuclease inhibitor, Promega), and 5 μ l polynucleotide kinase damping fluids (Boehringer Mannheim), 10 μ l γ- ³²P adenosine 5'-triphosphate (2.5 μ M, stable labelling Gold ^TM, Bresatec) and 5 μ l DEPC water 37 ℃ of following incubations 30 minutes with γ- ³²P5 ' end mark 5 ' primer, 5K42r.

(c) preparation K-ras template

Contain at codon 12 places is that the puc18 plasmid vector of K-ras exons 1 sequence of wild-type (GGT) or mutant (CGT or AGT) is as the dna profiling of PCR.

(d) check point sudden change

The PCR mixture contains 0.2pg/ μ l plasmid DNA, 10pmole γ- ³²The 5K42r of P mark, 2pmole 3K2,1mM DTT, 8mM MgCl ₂, dNTP (dATP, dCTP, dTTP, dGTP) each 100 μ M, 0.4U/ulRNasin  and 1 * damping fluid (100mM NaCl, 50mM Tris pH8.3,25 ℃).Set up two parts of reactions with 0.5uM Dzl, the single reaction of no Dzl is as control reaction.With the Taq archaeal dna polymerase of 6 units (5U/ul AmpliTaq, Perkin-Elmer) and TaqStart ^TMAntibody (Clontech) mixes to produce Taq archaeal dna polymerase: TaqStart ^TMAntibody is 1: 5 final molar ratio.Taq archaeal dna polymerase: Taqstart ^TMMixtures of antibodies incubation 15 minutes at room temperature before adding the PCR mixture.Total reaction volume is 50ul.Reactant is positioned among the GeneAmpPCR9600 (Perkin-Elmer) and 94 ℃ of sex change 2 minutes, then 60 ℃ following 1 minute, then carried out 15 circulations in 20 seconds at 94 ℃.Be reflected at 40 ℃ following 1 minute, then carried out 25 circulations in following 20 seconds again at 94 ℃.

2.5ul the sample aliquot of each reaction and 2.5ul go up sample dyestuff (97.5% methane amide, 0.1% dimethylbenzene nitrile indigo plant, 0.1% tetrabromophenol sulfonphthalein and 0.01MEDTA) mix, 75 ℃ of incubations 2 minutes, go up sample then immediately to pre-warm 16% sex change (urea) acrylamide gel.About 1 hour of gel electrophoresis.Observe PCR product and crack fragment through using molecular dynamics phosphorus imager 445S1 scanning gel.

Visible several bands (data not shown) on gel.Fragment is (a) .PCR amplicon (moving with doublet) by mobility from the order to the fastest (that is, from starting point to the end of telling somebody what one's real intentions are with fixed attention) the most slowly, (b) uncorporated primer and (c) cracked pcr amplification.A spot of 2 fragments that in 5 ' primer, produced by the background hydrolysis on the ribonucleotide residue also as seen, it moves between primer and cracked amplicon, and with the parallel migration of cracked amplicon.Respond visible PCR product and uncorporated primer.Contain at codon 12 places is that the reactant of template DNA (that is, with DNAzyme fully complementary) of wild-type contains the cracking amplicon.The reactant that contains the template DNA (that is, with the DNAzyme mispairing) that suddenlys change at codon 12 places does not contain the cracking amplicon.In these reactants on gel in this position only visible low-level background hydrolysate.

(2) target is at the DNAzymes of K-ras codon 12 places sudden change; The inductive cracking site.

(a) scheme

Use a zone of the pcr amplification K-ras gene of 5 ' DNA/RNA chimeric primers (5K44r) and 3 ' primer (3K2).The K-ras sequence hybridization of 5K44 γ and contiguous codon 12, and contain the purine that forms potential DNAzyme cracking site: the pyrimidine residue.Purine ribonucleotide in 5K44 γ and wild-type sequence have the K-ras template mispairing of a pyrimidine in this position.Therefore, this primer inducing DNA zyme cracking site.The Taq archaeal dna polymerase extends the codon 12 that amplifies the K-ras gene from 3 of 5K44r ' end.DNAzyme, Dz3 are designed to cracking contains wild-type sequence at K-ras codon 12 places amplicon.5 ' arm of DNAzyme is complementary fully with the sequence that at codon 12 places is wild-type.Sudden change at K-ras codon 12 places causes and the mispairing of 5 ' DNAzyme hybridization arm, and expection significantly reduces DNAzyme cracked efficient.

(b) design PCR primer and DNAzymes 5 ' TATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAA 3 ' K-ras 5 ' TATAAACTTGTGGTAGTTGGAGgu 3 ' " 5K44r " primer 3 ' GAACACCATCAACCTC ACCACCGC 5 ' " Dz3 " DNAzyme

(at codon 12 underscores of K-ras wild-type sequence, the ribonucleotide base of primer 5K44r is represented with lowercase.Ribonucleotide among the primer 5K44r " g " and the mispairing of K-ras sequence).

Another PCR primer 3K2 is designed to produce the amplicon of 82 base pairs when increasing with 5K44r.The sequence of 3K2 is:

5 ' CGTCCACAAAATGATTCTGA 3 ' " 3K2 " primer

Primer and DNAzyme by Pacific Oligos Pty.Ltd. (Lismore, NSW, Australia) or Oligos Etc., Inc. (Wilsonville, OR, USA) synthetic.DNAzyme Dz3 modifies preventing and is extended by the Taq archaeal dna polymerase through adding 3 ' phosphate group.Through primer and 2.5 μ l polynucleotide kinases (10 * 10 with 25ul 20uM ³U/ml does not have 3 ' phosphorus enzyme enzyme, Boehringer Marnnheim), 2.5 μ lRNasin (40U/ul reorganization RNasin , ribonuclease inhibitor, Promega), and 5 μ l polynucleotide kinase damping fluids (Boehringer Mannheim), 10 μ l γ- ³²P adenosine 5'-triphosphate (2.5 μ M, stable labelling Gold ^TM, Bresatec) and 5 μ lDEPC water 37 ℃ of following incubations 30 minutes with γ- ³²P5 ' end mark 5 ' primer, 5K44r.

(c) preparation K-ras template

Contain at codon 12 places is that the puc18 plasmid vector of K-ras exons 1 sequence of wild-type (GGT) or mutant (CGT) is as the dna profiling of PCR.

(d) check point sudden change

The PCR mixture contains 0.2pg/ μ l plasmid DNA, 10pmole γ- ³²The 5K44r of P mark, 2pmole 3K2,1mM DTT, 8mM MgCl ₂, dNTP (dATP, dCTP, dTTP, dGTP) each 100 μ M, 0.4U/ulRNasin  and 1 * damping fluid (100mM NaCl, 50mM Tris pH8.3,25 ℃).Set up two parts of reactions with 0.5uM Dz3DNAzyme, the single reaction of no Dz3 is as control reaction.With the Taq archaeal dna polymerase of 6 units (5U/ul AmpliTaq, Perkin-Elmer) and TaqStart ^TMAntibody (Clonteeh) mixes to produce Taq archaeal dna polymerase: TaqStart ^TMAntibody is 1: 5 final molar ratio.Taq archaeal dna polymerase: Taqstart ^TMMixtures of antibodies incubation 15 minutes at room temperature before adding the PCR mixture.Total reaction volume is 50ul.Reactant is positioned among the GeneAmp PCR9600 (Perkin-Elmer) and 94 ℃ of sex change 2 minutes, then 60 ℃ following 1 minute, then carried out 30 circulations in 20 seconds at 94 ℃.Be reflected at 50 ℃ following 1 minute, then carried out 10 circulations in following 20 seconds again at 94 ℃.

Visible several bands (data not shown) on gel.Fragment is (a) pcr amplification (with the doublet migration) by mobility from the order to the fastest (that is, from starting point to the gel bottom) the most slowly, (b) uncorporated primer and (c) cracked pcr amplification.The a spot of fragment that in 5 ' primer, is produced by the background hydrolysis on the ribonucleotide key also as seen, it and the parallel migration of cracked amplicon.Respond visible PCR product and uncorporated primer.Contain at codon 12 places is that the reactant of template DNA (that is, with DNAzyme fully complementary) of wild-type contains the cracked amplicon.The reactant that contains the template DNA (that is, with the DNAzyme mispairing) that suddenlys change at codon 12 places does not contain the cracking amplicon.In these reactants on gel in this position only visible low-level background hydrolysate.

(B) target is at the DNAzymes of K-ras codon 12 places sudden change; With the cracking of cis direction.

Synthetic active dna zymes also can realize the amplicon that cracking produces from chimeric primers during using PCR.In an example of this reaction, DNAzyme is with cis direction cracking substrate.

(a) scheme

Use a zone of the pcr amplification K-ras gene of 5 ' DNA/RNA chimeric primers (5K42r) and 3 ' enzyme gene primer (3K42Dz2).The K-ras sequence hybridization of 5K42 γ and contiguous codon 12, and contain the purine that forms potential DNAzyme cracking site: the pyrimidine residue.Enzyme gene primer 3K42Dz2 has with K-ras complementary 3 ' distinguish and contains 5 of DNAzyme antisense sequences ' district.The enzyme gene primer itself does not have heritable catalytic activity, when being used in combination with 5K42r, helping being created in close its 5 ' end and has the DNAzyme cracking site has activity (justice is arranged) DNAzymes at its 3 ' end amplicon.DNAzyme is designed to 5 of cis cracking amplicon ' end.

5 ' arm of DNAzyme is complementary fully with the sequence that at codon 12 places is wild-type.Sudden change at K-ras codon 12 places causes and the mispairing of 5 ' DNAzyme arm, and expection significantly reduces DNAzyme cracked efficient.

(b) primer sequence

5 ' chimeric primers 5K42r

(capitalization-deoxyribonucleotide residue; Lowercase-ribonucleotide residue)

5′TATAAACTTGTGGTAGTTGGA?gcT?3′

3 ' enzyme gene primer 3K42Dz2

(complementation of 10: 23 catalytic cores (antisense) sequence is a boldface type)

5′ACTTGTGGTAGTTGGATCGTTGTAGCTAGCCCTGG

TGGCAGCTGTATCGTCAAGGCACTC?3′

Primer by Pacific Oligos Pty.Ltd. (Lismore, NSW, Australia) or Oligos Etc., Inc. (Wilsonville, OR, USA) synthetic.Through primer and 2.5 μ l polynucleotide kinases (10 * 10 with 25ul 20uM ³U/ml does not have 3 ' Phosphoric acid esterase, Boehringer Mannheim), 2.5 μ l RNasin (40U/nl reorganization RNasin , ribonuclease inhibitor, Promega), and 5 μ l polynucleotide kinase damping fluids (Boehringer Mannheim), 10 μ l γ- ³²P adenosine 5'-triphosphate (2.5 μ M, stable labelling Gold ^TM, Bresatec) and 5 μ lDEPC water 37 ℃ of following incubations 30 minutes with γ- ³²P 5 ' end mark 5 ' primer, 5K42r.

(c) K-rasDNA template

(d) synthetic DNAzymes cis cracking during the PCR

The PCR mixture contains 0.2pg/ μ l K-ras plasmid DNA, 10pmole γ- ³²The 5K42r of P mark, 2pmole 3K42Dz2,1mM DTT, 8mM MgCl ₂, dNTP (dATP, dCTP, dTTP, dGTP) each 100 μ M, 0.4U/ul RNasin  and 1 * damping fluid (100mM NaCl, 50mM Tris pH8.3,25 ℃).Each dna profiling is set up two parts of reactions.(5U/ul AmpliTaq, Perkin-Elmer) mix with TaqStartTM antibody (Clontech) to produce the Taq archaeal dna polymerase: TaqStartTM antibody is 1: 5 final molar ratio with the Taq archaeal dna polymerase of 6 units.TaqDNA polysaccharase: TaqstartTM mixtures of antibodies incubation 15 minutes at room temperature before adding the PCR mixture.Total reaction volume is 50ul.Reactant is positioned among the GeneAmp PCR 9600 (Perkin-Elmer) and 94 ℃ of sex change 2 minutes, then 60 ℃ following 1 minute, then handle and carried out 30 circulations in 20 seconds at 94 ℃.Be reflected at 50 ℃ following 1 minute, then handle down and carried out 10 circulations in 20 seconds again at 94 ℃.

2.5ul the sample aliquot of each reaction and 2.5ul go up sample dyestuff (97.5% methane amide, 0.1% dimethylbenzene nitrile indigo plant, 0.1% tetrabromophenol sulfonphthalein and 0.01M EDTA) mix, 75 ℃ of incubations 2 minutes, go up sample then immediately to pre-warm 16% sex change (urea) acrylamide gel.About 1 hour of gel electrophoresis.Observe PCR product and crack fragment through using molecular dynamics phosphorus imager 445S1 scanning gel.

Visible several bands (data not shown) on gel.Fragment is (a) .PCR amplicon (with the doublet migration) by mobility from the order to the fastest (that is, from starting point to the gel bottom) the most slowly, (b) uncorporated primer and (c) cracked pcr amplification.Also as seen a spot of 2 fragments that produced by the background hydrolysis on the ribonucleotide residue in 5 ' primer move between it and primer and the cracked amplicon, and with the parallel migration of cracked amplicon.Respond visible PCR product and uncorporated primer.Contain at codon 12 places is that the reactant of template DNA (that is, with DNAzyme fully complementary) of wild-type contains the cracking amplicon.The reactant that contains the template DNA (that is, with the DNAzyme mispairing) that suddenlys change at codon 12 places does not contain the cracking amplicon.In these reactants on gel in this position only visible low-level background hydrolysate.

Following sequences is the amplicon of locating in the position 1 of the codon shown in the conformation 12 (underscore) to wild-type, and wherein DNAzyme (boldface type) is hybridized with cis.

5′TATAAACTTGTGGTAGTTGGAgcTGGTGGCGTAGGCAAGAGTGC

C

3′TGAACACCATCAACCT?GACCACCGTCGACATAGCAGTT

V. conclusion

This diagnostic method has advantage.Catalytic nucleic acid need be less to the specific sequence of 2 base pairs to produce cracking site.Catalytic nucleic acid dinucleotides cracking site than restriction enzyme site with the natural appearance of higher frequency.And the mispairing primer can be used for by being used to induce the cracking site of the identical mode inducing catalysis nucleic acid of artificial restriction enzyme site with the mispairing primer.

Only needing the example of the catalytic nucleic acid of dinucleotide sequence at cracking site is hammerhead ribozyme and 10-23DNAzyme.These two kinds of molecules also need hybridization region (arm) and treat complementation between the cracking molecule.Yet target-specific can be made in these zones.Although the catalytic nucleic acid molecule is cleavable single-chain nucleic acid template only, the method that produces suitable single-stranded template is well known in the art.For example, the single stranded RNA template can produce through the method such as TMA, and single stranded DNA can pass through asymmetric PCR (37) generation or produce through the double-stranded product of sex change.

Present method provides than rflp analysis has the potential new tool that is used for sequential analysis more flexibly.The bind nucleic acid amplification has overcome the limitation of using Restriction Enzyme to analyze with the catalytic nucleic acid cracking.Like this, reduced the required minmal sequence of cracking.And, because therefore catalytic nucleic acid also must also influence lysis efficiency in these zones of dinucleotide cracking site flank in the hybridization region complementation.Therefore, the sequence length of a catalytic nucleic acid scanning is longer than the length of single Restriction Enzyme scanning.Use the sequential analysis of catalytic nucleic acid also to have advantage, because it does not need proteolytic enzyme (for example, Restriction Enzyme or RNAaseA) or toxic chemical with respect to other scheme.

Reference 1. MUllis, K.B., U.S. Patent No.4,683,202.2. Arnheim, N., et al., U.S.Patent No.4,683,195.3. Arnheim, N., et al., U.S.Patent No.4,000,159.4. Ehrlich H.A., et al., U.S.Patent No.4,965,188.5. Ehrlich H.A., et al., U.S.Patent No.5,176,995.6. F.F.Chehab, et al. (1987) Nature 329:293-294.7. R.K.Saiki, et al. (1985) Science 230:1350-1354.8. Barany, F. (1991) Proc.Natl.Acad.Sci.88:189-193.9. Walker, G.T., et al. (1992) Nucleic Acids Res. 20:1691.10.Jonas, V., et al. (1993) Journal of Clinical Microbiology 31:2410-2416.11.Fahy, E., et al. (1991) PCR Methods Appl 1:25-33.12.Haseloff, J.and Gerlach, W.L. (1988) Nature 334:585-591.13.Breaker, R.R.and Joyce, G. (1994) Chemistry and Biology 1:223-229.14.Koizumi, M., et al. (1989) Nucleic Acids Research 17:7059-7069.15.E.Otsuka and M.Koizumi, Japanese Patent No. 4,235,919.16.Kashani-Sabet, M., et al. (1992) Antisense Research and Development 2:3-15.17.Raillard, S.A.and Joyce, G.F. (1996) Biochemistry 35:11693-11701.18.Carmi, N., et al. (1996) Chemistry and Biology 3:1039-1046.19.Santoro, S.W.and Joyce, G. (1997) PNAS 94:4262-4266.20.Promega Protocols and Applications Guide.Titus, D.E. (Ed), Promega Corporation (1991) .21.Watson, J.D., Tooze, J.and Kurtz, D.T. (1983) Recombinant DNA:A short Course.Scientific American Books, New York.22.Antonarakis, S.E. (1989) New England Journal of Medicine 320:153-163.23.Perriman, R. and Gerlach, W.L. (1992) Gene 113:157-163.24.Nollau-Wagener, P. (1997) Clinical Chemistry 43:1114-1128.25.Carmi, N., et al. (1996) Chemistry and Biology 3:1039-1046.26.Kramvis, A., et al. (1996) Journal of Clinical Microbiology 34:2731-2733.27.Yong, S.L., Thomas, R.J.S.and Phillips, W.A. (1995) Nucleic Acids Research 23:1640.28.Sambrook, J., Fritsch, E.F.and Maniatis, T. (1989) Molecular Cloning:A Laboratory Manual, 2nd Ed., New York:Cold Spring Harbour Laboratory Press.29.Backus, J.W., et al., U.S.Patent No.5,582,988.30.Wei, L., Dai-Shu, H., Ju, Y.and Andrieu, J.-M. (1994) Nature 368; 269-271.31.Bradley, S.M., et al., PCT International Publication No.WO 84/01389.32.Cohen, J.B.and Levinson, A.D. (1988) Nature 334:119-124.33.Kumar, R.and Barbacid, M. (1988) Oncogene 3:647-651.34.Todd, A.V., et al. (1991) Leukemia 5:160.35.Levi, S., et al. (1991) Cancer Res.6:1079.36.Kwok, S., et al. (1990) Nucleic Acids Research 18:999-1005.37.Gyllensten, U.B. and Erlich, H.A. (1988) PNAS 95:7652-7656.38.Walder, R.Y., et al. (1993) Nucleic Acid Research 21 (18): 4339-4343.

Claims

1, measure the method whether experimenter suffers from the disease that it is characterized in that existing the known nucleic acid sudden change, it comprises step:

(a) from experimenter's isolated nucleic acid molecule sample;

(b) nucleic acid fragment that (i) increases and in isolating sample, exist, this fragment is known to contain the sudden change that exists in suffering from the experimenter of this disease, (ii) under appropriate condition, the amplified fragments of gained is contacted with the catalytic nucleic acid molecule, wherein identification of this catalytic nucleic acid molecular specificity ground and cracking (1) in having the nucleic acid fragment of known mutations or (2) in corresponding wild type nucleic acid fragment, but be not the target sequence that exists in both simultaneously, prerequisite is that step (ii) can be carried out afterwards or simultaneously at step (i); With

(c) the catalytic nucleic acid molecule of determination step (b) in the (ii) fragment of cracking amplification whether is to determine whether the experimenter suffers from this disease.

2, measure the method whether experimenter suffers from the disease that it is characterized in that existing multiple known nucleic acid sudden change, it comprises step:

(a) from experimenter's isolated nucleic acid molecule sample;

(b) nucleic acid fragment that (i) increases and in isolating sample, exist, the known various mutations that in suffering from the experimenter of this disease, exists that contains of this fragment, (ii) under appropriate condition, the amplified fragments of gained is contacted with multiple catalytic nucleic acid molecule, wherein identification of each catalytic nucleic acid molecular specificity ground and cracking (1) in having the nucleic acid fragment of known mutations or (2) in corresponding wild type nucleic acid fragment, but be not the target sequence that exists in both simultaneously, prerequisite is that step (ii) can be carried out afterwards or simultaneously at step (i); With

(c) determination step (b) each catalytic nucleic acid molecule in (ii) fragment of cracking amplification whether is to determine whether the experimenter suffers from this disease.

3, measure the method whether experimenter suffers from the disease that it is characterized in that existing multiple known nucleic acid sudden change, it comprises step:

(a) from experimenter's isolated nucleic acid molecule sample;

(b) nucleic acid fragment that (i) increases and in isolating sample, exist, the known various mutations that in suffering from the experimenter of this disease, exists that contains jointly of these fragments, (ii) under appropriate condition, the amplified fragments of gained is contacted with multiple catalytic nucleic acid molecule, wherein identification of each catalytic nucleic acid molecular specificity ground and cracking (1) in having a kind of a kind of nucleic acid fragment of known mutations or (2) in corresponding wild type nucleic acid fragment, but be not the target sequence that exists in both simultaneously, prerequisite is that step (ii) can be carried out afterwards or simultaneously at step (i); With

(c) whether cracking contains its amplified fragments of target sequence separately to determination step (b) each catalytic nucleic acid molecule in (ii), to determine whether the experimenter suffers from this disease.

4, the method for claim 1,2 or 3, wherein the experimenter is human.

5, the method for claim 1,2 or 3, wherein disease is selected from cancer, AIDS and cystic fibrosis.

6, the method for claim 5, wherein this disease is a cancer.

7, the method for claim 1,2 or 3, wherein Kuo Zeng nucleic acid fragment is RNA, and the catalytic nucleic acid molecule is selected from DNA and RNA.

8, the method for claim 1,2 or 3, wherein Kuo Zeng nucleic acid fragment is DNA, the catalytic nucleic acid molecule is RNA or DNA.

9, the method for claim 1,2 or 3, wherein (a) uses polymerase chain reaction to increase; (b) the catalytic nucleic acid molecule is 10-23DNAzyme; (c) polymerase chain reaction adopts the dna primer that is suitable for starting this fragment amplification, and this primer contains at least one purine ribonucleotide residue, and it is used as by the 5 ' side site in 10-23DNAzyme identification and the cracked amplified fragments.

10, the method for claim 9, wherein amplified fragments is by trans identification of DNAzyme and cracking.

11, the method for claim 9, wherein (a) polymer chain reaction adopts a kind of second dna primer that is suitable for starting this fragment amplification, this second primer comprises the enzyme gene of coding 10-23 DNAzyme, so that during amplification, the nucleic acid molecule of the amplification of gained comprises 10-23 DNAzyme; (b) Kuo Zeng nucleic acid fragment is discerned and cracking by the DNAzyme cis.

12, be used to implement claim 1, the test kit of 2 or 3 method, comprise (a) a kind of catalytic nucleic acid molecule, it is discerned specifically and cracking (i) is in a kind of nucleic acid fragment of sudden change of feature of disease or (ii) in corresponding wild type nucleic acid fragment having known, but not the target sequence that in both, exists simultaneously, (b) a kind of nucleic acid reagent, it is applicable to that amplification contains the nucleic acid fragment of target sequence.

13, be used to implement the test kit of the method for claim 9, comprise (a) 10-23 DNAzyme, it is discerned specifically and cracking (i) is in a kind of nucleic acid fragment of sudden change of genius morbi or (ii) in corresponding wild type nucleic acid fragment having known, but not the target sequence that in both, exists simultaneously, (b) be suitable under the condition of polymerase chain reaction the dna primer of this fragment amplification of starting, this primer contains at least one purine ribonucleotide residue, and it is used as by the 5 ' side site in 10-23 DNAzyme identification and the cracked amplified fragments.

14, be used to implement the test kit of the method for claim 11, comprise:

(a) first dna primer, it comprises the enzyme gene of coding 10-23 DNAzyme, this 10-23DNAzyme discerns specifically and cracking (i) known be in a kind of nucleic acid fragment of sudden change of genius morbi or (ii) in corresponding wild type nucleic acid fragment, but be not the target sequence that exists in both simultaneously, this first primer is suitable for this segmental amplification of starting under the condition of polymerase chain reaction; With

(b) a kind of second dna primer, it is suitable for this segmental amplification of starting under the condition of polymerase chain reaction, this second primer contains at least one purine ribonucleotide residue, and it is used as by the 5 ' side site in 10-23 DNAzyme identification and the cracked amplified fragments

So that in when amplification, (i) nucleic acid molecule of the amplification of the gained nucleic acid fragment that comprises 10-23 DNAzyme and (ii) amplification is discerned and cracking by the DNAzyme cis.