CN1326947A - Human thymosin alpha protogene mutant synthesis, expression and use - Google Patents
Human thymosin alpha protogene mutant synthesis, expression and use Download PDFInfo
- Publication number
- CN1326947A CN1326947A CN 00107954 CN00107954A CN1326947A CN 1326947 A CN1326947 A CN 1326947A CN 00107954 CN00107954 CN 00107954 CN 00107954 A CN00107954 A CN 00107954A CN 1326947 A CN1326947 A CN 1326947A
- Authority
- CN
- China
- Prior art keywords
- alpha
- glu
- expression
- prophymosin
- gag
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
By utilizing the facultative agency of genetic code, coliform bacteria favorable codon is designed, GC content in DNA sequence in reduced Pro T alpha DNA sequence is synthesized. PCR amplified human Pro T alpha gene and protocaryon expression vector, such as pBV220, are assembled into high efficiency expression plasmid, converted coliform bacteria are expressed with temperature induced Pro T alpha gene with a expression amount up to 20-25 % of total thallus protein. The engineering bacteria are fermentation amplified and crushed then maintain supernatant. The supernatant is heat treated, anionic exchanged and chromatographic treated and gel chromatographic purified to obtain purified product. The purified product is mixed with protective agent to prepare freeze dried preparation for the treatment of human immunodeficiency disease, viral hepatitis and cancer.
Description
The invention belongs to biological technical field, the full gene that relates to human thymosin alpha-source is synthetic, genetically engineered and the preparation that contains prophymosin-alpha be as treatment human immune deficiency disease and treatment for cancer medicine.
The multiple parahormone of thymic epithelial cells's excretory plays an important role in the process of T lymphocyte differentiation and maturation.Thymosin is exactly one of this type of polypeptide, and the iso-electric point that it is made up of 28 amino-acid residues is 4.2 Acid polypeptide, and molecular weight is 3KDa.It has the partial function of thymosin component V.Simultaneously, when thymosin component V separates α 1, found another component, it is made up of 35 amino-acid residues, and 28 aminoacid sequences and the thymosin of its N-end are in full accord, has the biologic activity identical with α 1, is referred to as extrasin alpha 2.And α 1 is all L-glutamic acid with terminal last amino acid of α 2C-, and supposition may be that the bigger protein of certain a part resolves into α 1 and 2 two kinds of activeconstituentss of α under the proteolytic enzyme effect.
Haritos etc. behind the direct fresh thymus gland of homogenate, put into the phosphate buffered saline buffer that boils rapidly, with the deactivation endogenous proteinase in liquid nitrogen, when carrying out albumen sepn, do not find thymosin and α 2, and the acidic protein that to obtain a molecular weight be 12KDa, its iso-electric point is 3.55.Amino acid sequence analysis shows that preceding 28 amino-acid residues of its N-end are identical with α 1 sequence, preceding 35 identical with α 2 sequences, therefore this protein is called prophymosin-alpha (prothymosin α, Pro T α).
The gene clone of prophymosin-alpha in the past all is the method by PCR, amplification gene from its cDNA library, because GC content is higher in its dna sequence dna, thereby expression level is generally on the low side.The external method of fusion rotein that adopts is expressed more, this has brought difficulty for later separation and Extraction again, we utilize the merger of codon to reduce GC content among its DNA, selected the codon of intestinal bacteria preferences, it is synthetic to have carried out full gene, utilizes gene engineering method to prepare human thymosin alpha-source and has obtained success.
The present invention adopts following technical proposals:
(1) property of merger and intestinal bacteria are arranged to the preference of amino acid code and the difference of human body cell in view of genetic code, specialized designs of the present invention has been synthesized the full dna fragmentation of human thymosin alpha protogene intestinal bacteria preference codons, it can improve the expression level of thymosin alpha protogene in intestinal bacteria on amino acid composition that does not change the product human thymosin alpha-source and the basis that puts in order.Its step is design dna sequence at first, full gene and initial, terminator codon, restriction enzyme site are divided into synthetic positive and negative two chains of 12 fragments, and then be forward and reverse primer with 5 of positive and negative two chains ' the 1st section sequence of end, carry out pcr amplification, obtaining the PCR product is connected with pUC19, after order-checking is correct pcr amplification product is inserted among the domestic efficient expression vector pBV220 that extensively adopts, be built into prophymosin-alpha expression plasmid pTh α.It can be in intestinal bacteria HB101 and DH5 α high expression level, make prophymosin-alpha account for about 20% of bacterial protein, expression rate does not reduce through going down to posterity more than 100 times.
(2), as basic medium, suitably increase carbon source and nitrogenous source with 2YT by the fermentation engineering bacterium, by optimizing processing parameters such as dissolved oxygen, stirring velocity, fermentation pH value, final cultures OD600 value can reach about 25, and biomass is every liter of culture 30-35g, and the product expression rate is between 20-25%.The product expression amount can reach more than every liter of culture 200mg.
(3) set up purifying process on this basis, it is refining etc. to remove foreign protein, anion-exchange chromatography and gel exclusion chromatography comprising the fragmentation of thalline and product extracting, thermal treatment.
The process stabilizing of being set up, rate of recovery height, active good.This technology has following characteristics: 1. removed the soluble proteins more than 90% by thermal treatment, and the free of losses of target protein prophymosin-alpha; 2. because prophymosin-alpha pI＜4, thereby anion-exchange chromatography can be removed nearly all foreign protein; 3. the final step gel exclusion chromatography can be removed the acidic impurities of sized molecules amount.This technology to three batches of each 22.5L tunning purifying after every batch can get pure product 3-5g.
(4) after pure product add stablizers such as medicinal N.F,USP MANNITOL and phosphate buffered saline buffer and solubility promoter, use the filtering with microporous membrane degerming, lyophilize powdering finished product.Use water for injection dissolving back, can be used for human immune deficiency disease and treatment for cancer.
This product can obviously improve lymphocyte rosette rate of formation external, can measure the biological activity of prophymosin-alpha in view of the above.
Prophymosin-alpha is treated viral hepatitis or is not found out fully as yet in the mechanism of action aspect the enhancement immune system response.In a plurality of different in vitro tests, it impels the T cell maturation effect of the peripheral blood lymphocyte after the former activation of mitogenesis, increase the T cell and activate for example α of the various lymphokines of back generation at various antigens or mitogen, IFN-, the level of the lymphokine acceptor on the secretion of interleukin-2 and interleukin-3 and the increase T cell.It strengthens allosome by the activation to T4 (aid/inductor) cell and simultaneously from the human blended lymphocyte reaction of body.Prophymosin-alpha may influence raising of NK precursor cell, and precursor cell becomes after being exposed to Interferon, rabbit more cytotoxicity.In vivo, the extrasin alpha proper energy strengthens the mouse lymphocyte increase secretion interleukin-2 after canavalin(e) activates and increases the effect of interleukin-2 receptor expression.
The present invention uses recombinant DNA technology, adopt the salvage technology to be spliced to form the full gene of prophymosin-alpha again, under the prerequisite that does not change coded amino acid, change Gene Partial Nucleotide, thereby improved the expression of product, and product is present in the intestinal bacteria endochylema with soluble form, its lytic activity height.The downstream purification mode is easy, and the yield height reaches the specification of quality of clinical application.This product is used for immunodeficiency diseases, viral hepatitis and treatment for cancer, can obtain significant curative effect.
The present invention describes with following example:
Embodiment 1, gene coded sequence design
Adopt the intestinal bacteria preference codon, and add ATG initiator codon and EcoRI restriction enzyme site at 5 ' end, 3 ' end is introduced the BamHI restriction enzyme site, the long 352bp of complete sequence, and it is synthetic to be divided into 12 fragments, and synoptic diagram is as follows:
P1 P2 P3 P4 P5 P65′
3′3′
5′
N6 N5 N4 N3 N2 N1CGGAATTCATGTCTGATGCAGCTGTAGATACTAGCTCTGAAATCACTACTAAGGACTTAAAGGAGAAGAAGGAAGTTGTGGAAAGAGCAGAAAATGGTAGAGACGCTCCTGCTAACGGTAATGCTGAGAATGAGGAAAACGGTGAGCAGGAGGCTGACAATGAGGTAGACGAAGAAGAGGAAGAAGGTGGTGAGGAAGAGGAGGAGGAAGAAGAAGGTGATGGTGAGGAAGAGGATGGTGATGAAGATGAGGAAGCTGAGTCTGCTACTGGTAAGCGTGCAGCTGAAGATGATGAGGATGACGATGTCGATACTAAGAAGCAGAAGACTGACGAGGATGACTGAGGATCCGCP1：CGG?AAT?TCA?TGT?CTG?ATG?CAG?ATG?TAG?ATA?CT32metP2：AGC?TCT?GAA?ATC?ACT?ACT?AAG?GAC?TTA?AAG?GAG?AAG?AAG?GAA?GTT?GTG?GAAGAG?GCA?GAA?AAT?G63merP3：GTA?GAG?ACG?CTC?CTG?CTA?ACG?GTA?ATG?CTG?AGA?ATG?AGG?AAA?ACG?GTG?AGCAGG?AGG?CTG?ACA?A64merP4：TGA?GGT?AGA?CGA?AGA?AGA?GGA?AGA?AGG?TGG?TGA?GGA?AGA?GGA?GGA?GGA?AGAAGA?AGG?TGA?TGG?T64merP5：GAG?GAA?GAG?GAT?GGT?GAT?GAA?GAT?GAG?GAA?GCT?GAG?TCT?GCT?ACT?GGT?AAGCGT?GCA?GCT?GAA?G64merP6：ATG?ATG?AGG?ATG?ACG?ATG?TCG?ATA?CTG?AGA?AGC?AGA?AGA?CTG?ACG?AGG?ATGACT?GAG?GAT?CCG?C64merN1：G?CGG?ATC?CTC?AGT?CAT?CCT?CGT?CAG?TCT?TCT?G32merN2：CT?TCT?TAG?TAT?CGA?CAT?CGT?CAT?CCT?CAT?CAT?CTT?CAG?CTG?CAC?GCT?TACCAG?TAG?CAG?ACT?CA64merN3：G?CTT?CCT?CAT?CTT?CAT?CAC?CAT?CCT?CTT?CCT?CAC?CAT?CAC?CTT?CTT?CTT?CCTCCT?CCT?CTT?CT64merN4：CAC?CAC?CTT?CTT?CCT?CTT?CTT?CGT?CTA?CCT?CAT?TGT?CAG?CCT?CCT?GCT?CACCGT?TTT?CCT?CAT?T64merN5：CT?CAG?CAT?TAC?CGT?TAG?CAG?GAG?CGT?CTC?TAC?CAT?TTT?CTG?CCT?CTT?CCACAA?CTT?CCT?TCT?TC64mcrN6：T?CCT?TTA?AGT?CCT?TAG?TAG?TGA?TTT?CAG?GGC?TAG?TAT?CTA?CAG?CTG?CAT?CAGACA?TGA?ATT?CCG64mer
The clone of embodiment 2, full length fragment, order-checking are identified
1) 5 ' end phosphorylation: 12 fragments of synthetic are respectively got 50pmol with water dissolution, and 40 microlitre reaction volumes are transferred to each segmental 5 ' end with the T4 polynucleotide kinase with γ-phosphate of ATP, and concrete reaction conditions is 37 ℃, 60min.70 ℃ then, the 5min deactivation.
2) annealing connects: above-mentioned reaction product, 95 ℃, 5min, slowly cooling (spending the night) in thermos cup.Add the T4 dna ligase next day, 12 ℃ spend the night (more than 12h).
3) pcr amplification: to connect product is template, and N1, P1 are primer, 63 ℃ of annealing, and 72 ℃ are extended 40s, 30 circulations.
4) reclaim the PCR product, the plasmid pUC19 that cuts with same enzyme behind the double digestion is connected, and is transformed into DH5 α recipient bacterium, and blue hickie screening obtains positive transformant, selects 10 transformant order-checkings.
5) sequencing result shows, above-mentioned 10 transformants clone has only a sequence and implementation sequence (nucleotide sequence and the amino acid sequence corresponding that record see Table 1) in full accord.
The structure of embodiment 3, expression vector
Cut the acquisition target gene fragment from pUC19/Th α enzyme, connect the pBV220 expression vector of double digestion after the recovery, transform the back and use the PCR method screening positive clone, and enzyme is cut correctly.The DH5 α engineering bacteria that contains above expression plasmid (pTh α) has more a protein band through amplification cultivation, temperature-induced about 12kd.
The fermentative production of embodiment 4, human thymosin alpha-source
After 30 ℃ of incubated overnight of engineering bacteria, be inoculated in the 2YT substratum in 5% ratio, 30 ℃ are cultivated OD600 is 2.0 o'clock, and temperature is risen to 42 ℃, and this moment, prophymosin-alpha was promptly induced generation, collected thalline behind the 4h.Add nutrient substances such as nitrogenous source, carbon source on the different opportunitys of expressing.It is 25 that final tunning density can reach OD600, and biomass is every liter of culture 30-35g.Electrophoresis is identified the prophymosin-alpha expression level, and thin layer scanning shows that prophymosin-alpha accounts between the 20-25% of bacterial protein.
The preservation of embodiment 5, engineering bacteria and stability
Engineering bacteria adds 30% glycerine ,-20 ℃ of preservations.Short-term is preserved bacterial classification can use agar LB flat board.Be to check the stability of engineering bacteria, with original strain, 50 generations and 100 generation bacterium respectively the extracting plasmid carry out enzyme and cut evaluation, the three is identical as a result.The product expression level of three bacterium amplification cultivation things is suitable simultaneously, proves that the engineering bacteria among the present invention is very stable.
The separation and purification of embodiment 6, prophymosin-alpha
Human thymosin o is former to be present in the thalline endochylema with soluble form in thalline, centrifugal recovery supernatant behind the bacterial cell disruption, and the centrifugal collection supernatant of supernatant 80 ℃ of effects 5min, product obtains preliminary purification.Supernatant can obtain electrophoretically pure prophymosin-alpha through the DEAE-Sepharose column chromatography again.At last with the refining prophymosin-alpha that obtains 12kd of Sephacryl S-100.
The evaluation of embodiment 7, prophymosin-alpha product
SDS-PAGE and HPLC purity checking are all more than 98%, and the rosette experiment shows that it has tangible biological activity.The N-terminal protein sequence analysis is identical with native protein in the body, and order is Ser-Asp-Ala-Ala-Val-Asp-Thr-Ser-Ser-Glu-Ile-Thr-Thr-Lys-Asp-Leu.
Embodiment 8, sterile filtration, packing, freeze-drying
According to protein content and activity, add auxiliary material and stablizer in following ratio
Every of restructured thymosin alpha source contains 0.75,1.5 and 3.0mg, and buffer system is 10mM PB, pH6.8, and 5% N.F,USP MANNITOL, above auxiliary material must meet the requirement of injecting drug use.
Sterile filtration: reach at environment cleanliness under 100 grades the condition, with 0.22 μ M filtering with microporous membrane, packing, freeze-drying, seal, labeling, vanning.Be stored in 2～8 ℃ the cold storage environment.1 CG?GAA?TTC?ATG?TCT?GAT?GCA?GCT?GTA?GAT?ACT?AGC?TCT?GAA?ATC?ACT?ACT?AAG?GAC?TTA2 Ser?Asp?Ala?Ala?Val?Asp?Thr?Set?Set?Glu?Ile?Thr?Thr?Lys?Asp?Leu
101 AAG?GAG?AAG?AAG?GAA?GTT?GTG?GAA?GAG?GCG?GAA?AAT?GGT?AGA?GAC?GCT?CCT?GCT?AAC?GGT2 Lys?Glu?Lys?Lys?Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Gly?Arg?Asp?Ala?Pro?Ala?Asn?Gly
20 30
AAT?GCT?GAG?AAT?GAG?GAA?AAC?GGT?GAG?CAG?GAG?GCT?GAC?AAT?GAG?GTA?GAC?GAA?GAA?GAG
Asn?Ala?Glu?Asn?Glu?Glu?Asn?Gly?Glu?Glu?Glu?Ala?Asp?Asn?Glu?Val?Asp?Glu?Glu?Glu
40 501 GAA?GAA?GGT?GGT?GAG?GAA?GAG?GAG?GAG?GAA?GAA?GAA?GGT?GAT?GGT?GAG?GAA?GAG?GAT?GGT2 Glu?Glu?Gly?Gly?Glu?Glu?Glu?Glu?Glu?Glu?Glu?Glu?Gly?Asp?Gly?Glu?Glu?Glu?Asp?Gly
60 701 GAT?GAA?GAT?GAG?GAA?GCT?GAG?TCT?GCT?ACT?GGT?AAG?CGT?GCA?GCT?GAA?GAT?GAT?GAG?GAT2 Asp?Glu?Asp?Glu?Glu?Ala?Glu?Set?Ala?Thr?Gly?Lys?Arg?Ala?ala?Glu?Asp?Asp?Glu?Asp
80 901 GAC?GAT?GTC?GAT?ACT?AAG?AAG?CAG?AAG?ACT?GAC?GAG?GAT?GAC?TGA?GGA?TCC?GC2 Asp?Asp?Val?Asp?Thr?Lys?Lys?Gln?Lys?Thr?Asp?Glu?Asp?Asp
100 110
Table 1. prophymosin-alpha cDNA and aminoacid sequence (1. nucleotide sequence 2. aminoacid sequence _ representatives are according to merger, the change part of codon)
Claims (5)
1, a kind of method for preparing human thymosin alpha-source comprises: (1) synthetic full gene that is rich in A, T; (2) gene clone that (1) is obtained is in expression vector; (3) transform prokaryotic cell prokaryocyte with described expression vector and obtain engineering bacteria; (4), obtain the high level expression of human thymosin alpha-source by fermentation technique amplification engineering bacteria.
2,, obtain the sequence shown in the table 1 according to the method for claim 1.
3, according to the process of claim 1 wherein that described expression vector selects pBV200 for use, prokaryotic cell prokaryocyte is bacillus coli DH 5 alpha and HB101.
4, the prophymosin-alpha for preparing according to claim 1 method.
5, the application of the prophymosin-alpha of claim 4 aspect human immune deficiency disease, viral hepatitis and cancer therapy.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 00107954 CN1234727C (en) | 2000-06-01 | 2000-06-01 | Human thymosin alpha protogene mutant synthesis, expression and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 00107954 CN1234727C (en) | 2000-06-01 | 2000-06-01 | Human thymosin alpha protogene mutant synthesis, expression and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1326947A true CN1326947A (en) | 2001-12-19 |
| CN1234727C CN1234727C (en) | 2006-01-04 |
Family
ID=4579048
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 00107954 Expired - Fee Related CN1234727C (en) | 2000-06-01 | 2000-06-01 | Human thymosin alpha protogene mutant synthesis, expression and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1234727C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1316028C (en) * | 2003-04-25 | 2007-05-16 | 长春金赛药业有限责任公司 | Expression vector, engineering bacteria of N* deacetylating Alpha 1 monomer of human thymosin, and preparation method |
| CN100335633C (en) * | 2003-03-20 | 2007-09-05 | 中国人民解放军军事医学科学院生物工程研究所 | Method for preparing N-end acetylation modified thymosin alpha with recombined E. coli |
-
2000
- 2000-06-01 CN CN 00107954 patent/CN1234727C/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100335633C (en) * | 2003-03-20 | 2007-09-05 | 中国人民解放军军事医学科学院生物工程研究所 | Method for preparing N-end acetylation modified thymosin alpha with recombined E. coli |
| CN1316028C (en) * | 2003-04-25 | 2007-05-16 | 长春金赛药业有限责任公司 | Expression vector, engineering bacteria of N* deacetylating Alpha 1 monomer of human thymosin, and preparation method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1234727C (en) | 2006-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5464939A (en) | Highly purified protein, production and use thereof | |
| CA1341240C (en) | Dna encoding human tumor necrosis factor and human tumor necrosis factor polypeptide | |
| US4929554A (en) | Human immune interferon | |
| US4656132A (en) | Method of improving the yield of heterologous protein produced by cultivating recombinant bacteria | |
| US4355104A (en) | Bacteriolytic proteins | |
| EP0210846B1 (en) | Method for extracting protein with organic acid | |
| EP0176299B1 (en) | Mutual separation of proteins | |
| US4894334A (en) | Method of improving the yield of heterologous protein produced by cultivating recombinant bacteria | |
| CN1234727C (en) | Human thymosin alpha protogene mutant synthesis, expression and use | |
| CN101875699B (en) | Fusion protein of human epidermal growth factor and metallothionein and preparation method and application thereof | |
| JPS5841849A (en) | Human leukocyte interferon | |
| EP0200417B1 (en) | Production of protein | |
| US5157004A (en) | Polypeptides and production thereof | |
| CN1259337C (en) | Synthesis, expression, preparation and application for human parathyroid hormone gene mutant | |
| EP0297833B1 (en) | Physiologically active lymphotoxin | |
| CN1298883A (en) | Preparing process and application of recombined human interleukin-11 | |
| US5210029A (en) | Method of producing interleukin-2 | |
| CN1188151A (en) | Method for preparing recombination human basic fibroblastic growth factor and its use | |
| CN101883784B (en) | N-terminal modified interferon-alpha | |
| CN1059929C (en) | Human thymosin alpha-source and preparing method thereof | |
| US5316919A (en) | Method of producing 2 KD to 10 KD peptides having no L-methionine residue | |
| CN102585013B (en) | Fusion protein containing omega interferon and method for preparing same | |
| KR0149955B1 (en) | Preparation of human glucagon using fusion protein | |
| KR100261987B1 (en) | Method for Preparation of Recombinant Human Interferon-α2a using argU gene in E. coli | |
| CN113717270A (en) | Porcine interferon-alpha 8 mutant and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C57 | Notification of unclear or unknown address | ||
| DD01 | Delivery of document by public notice |
Addressee: Xu Mingbo Document name: Notification of Termination of Patent Right |
|
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: GR Ref document number: 1046293 Country of ref document: HK |