CN1325632C - construction of HD34-1 strain and method for making alcohol-free beer with HD34-1 strain as ferment strain - Google Patents

Abstract

The present invention discloses the construction of an HD34-1 strain and a method for brewing nonalcoholic beer by using the HD34-1 strain as a fermentation strain, which relates to the construction of a genetic engineering strain and a method for brewing nonalcoholic beer. The HD34-1 is constructed by the following steps: a. designing a 5' end primer and a 3' end primer; b. amplifying an ADH gene; c. connecting the amplified ADH gene with an expression carrier pYC6/CT; d. obtaining Saccharomyces cerevisiae HD34 by conversion; e. preliminarily screening transformants to obtain an HD34-1 strain. The method for brewing nonalcoholic beer by using the HD34-1 strain as a fermentation strain comprises the following steps: a. activating a strain; b. converting the strain into a culture medium for shaking culture; c. inoculating the strain treated by amplification culture into a fermentation tank containing malt wort; d. carrying out oxygenation and fermentation; e. measuring a sugar degree, and stopping the fermentation when the sugar degree descends to 5 degrees BX; f. lowering the temperature, placing the fermentation tank for a week, and taking the strain out of the fermentation tank. The strain of the present invention can catalyze the positive reaction of primary alcohol and aldehyde, reduce the yield of ethanol and simplify production techniques.

Description

It is the method that fermentation strain is brewageed alcohol-free beer that the structure of HD34-1 bacterial strain reaches with it

Technical field:

The present invention relates to a kind of structure of gene bacterial strain and the brewing method of alcohol-free beer, particularly a kind of construction process of engineering strain and be the method that fermentation strain is brewageed alcohol-free beer with it.

Background technology:

Ethanol dehydrogenase (E.C.1.1.1.1, be called for short ADH) be a kind of extensive narrow spectrum zinc-containing metal enzyme (Drewkwet al., 1988), it can NAD be the reversible reaction between the coenzyme catalysis uncle alcohols and aldehydes, be a kind of important fermentation strain in the beer fermentation process, its positive reaction catalytic activity has significance for the ethanol content that reduces in the beer.Therefore this enzyme is the key enzyme of low alcohol of Production by Microorganism Fermentation or alcohol-free beer.Alcohol-free beer is meant beer soft or that ethanol content is very little, and it is the same with ordinary beer, is main raw material with the barley, brewages through fermentation, and is still keeping the color characteristic of traditional beer.At present, the method of producing alcohol-free beer in the world mainly contains two big classes: a class is to reduce in the system wine fermentation process with the restricted fermentation method to generate the alcoholic acid amount, comprises special yeast control fermentation, interrupts fermentation, low temperature control fermentation, " cold mixing " technology, Barrell patent and high concentration diluting beer; Another kind of is in the secondary fermentation process ethanol that produces to be removed, and comprises air distillation, vacuum distilling, evaporation, reverse osmosis and dialysis.But existing these methods more or less all have corresponding problem and drawback on technology: 1, special yeast control fermentation: have dense sweet taste owing to containing a large amount of not fermentating maltoses in the mash, and in the fermenting process because the mash environment of the high sugar of low alcohol, make the microbiological manipulation of karusen require very strict, must guarantee that during the fermentation mash only has a kind of zymic to exist, otherwise all will cause the failure of fermenting; 2, interrupt fermentation: because fermentation not exclusively, its stability is not as the beer of traditional zymotic; 3, low temperature control fermentation: pleasantly sweet, secondary fermentation stage and freezing and filtering stage are very easy to bacteria infection except that residual sugar is high, and technology controlling and process is relatively stricter; 4, " cold mixing " technology, Barrell patent and high concentration diluting beer since technology need be relatively stricter for the requirement of equipment, so widespread adoption is also had any problem; 5, air distillation: owing to make the beer long-time heating, very big variation has taken place in the various flavour substancess in the beer, causes taste to be not easy to be accepted by consumers in general; 6, vacuum distilling, evaporation, reverse osmosis and dialysis:,, be not best choice for producer because these technology all have very high requirement to plant and instrument and factory building and technician though these technology have solved the beer flavor problem.

Summary of the invention:

The purpose of this invention is to provide a kind of structure of HD34-1 bacterial strain and be the method that fermentation strain is brewageed alcohol-free beer with it, it is from alcohol-free beer Yeast gene engineering bacterial strain HD34-1, brewage alcohol-free beer, can simplify production technique, reduce cost, overcome many drawbacks of existing alcohol-free beer production technique, satisfy market demand.Engineering strain HD34-1 of the present invention makes up like this: a, according to ADH gene order design 5 ' end, 3 ' end primer that GenBank goes up login adds the recognition site of Sac I and BamH I respectively at 5 ' end primer and 3 ' end primer GAGCTCWith GGATCCB, adopt PCR method with the genomic dna of Bacillus subtilis as template amplification ADH gene; C, the product that obtains is connected with expression vector pYC6/CT; D, adopt the LiAc conversion method to transform the recombinant DNA that makes up to enter Saccharomycescerevisiae HD34 (available from microorganism key lab of Heilongjiang University, Saccharomycescerevisiae HD34 is known, open bacterial strain, at Nature and Science Vol.2 No.2[CumulatedNo.3] June2004, P64～66, open in " Alcohol Dehydrogenase from Bacillus subtilis:Cloning andExpression Gene in HD34 Beer Yeast "); E, the gained transformant is carried out primary dcreening operation, the bacterial strain behind the primary dcreening operation is carried out the ADH qualitative detection, obtain the HD34-1 bacterial strain with the isozyme method.With the HD34-1 bacterial strain is that the method that fermentation strain is brewageed alcohol-free beer is achieved in that a, adopts malt extract medium solid slant activation HD34-1; B, will activate good bacterial classification forward in the 500ml malt juice liquid medium under 20～40 ℃ temperature, shake-flask culture 46～50 hours, controlled temperature are 20～40 ℃, and rotating speed is 120 rev/mins; C, the bacteria suspension that will spread cultivation are cooled to 3～5 ℃, and the inoculum size by 2～4% will spread cultivation bacterial classification inoculation in the fermentor tank that contains wort; D, oxygenation 2～3 minutes in fermentor tank are then fermented at 10～14 ℃; E, be that pol is measured by unit with the sky, when pol drops to 5 ° of BX, stop fermentation; F, be cooled to 3～5 ℃, can go out jar after placing a week, obtain alcohol-free beer.The present invention goes up Bacillussubtilis ADH (Alcohol Dehydrogenase) gene order of login according to GenBank NC 000964.Design 5 ' end, 3 ' end primer, adopt PCR method from the safe bacterial strain Bacillus subtilis that generally acknowledges, to be cloned into the ADH gene, and be connected with expression vector pYC6/CT, conversion enters among the Saccharomyces cerevis iae HD34, from the transformant that obtains, filter out the bacterial strain of ADH activity apparently higher than original strain, thereby obtain strain HD 34-1, because such bacterial strain can change the metabolic regulation of bacterial strain own, make the positive reaction increased activity of ADH, the positive reaction of catalysis uncle alcohols and aldehydes reduces ethanol production.The application of engineering strain HD34-1 in brewage can be simplified production technique, makes alcohol-free beer consistent with the production technique of ordinary beer; The color characteristic that still keeps traditional beer; Less demanding for equipment can widespread adoption; Final alcoholic strength＜1% (v/v) of beer; Fermentation period shortens to 12 days; Diacetyl content 0.106ppm; Every index such as total acid, higher alcohols is qualified.

Description of drawings:

Fig. 1 is the collection of illustrative plates of expression vector pYC6/CT.

Embodiment:

Embodiment one: the engineering strain HD34-1 of present embodiment makes up like this: a, according to ADH gene order design 5 ' end, 3 ' end primer that GenBank goes up login adds the recognition site of Sac I and BamH I respectively at 5 ' end primer and 3 ' end primer GAGCTCWith GGATCCB, adopt PCR method with the genomic dna of Bacillus subtilis as template amplification ADH gene; C, the product that obtains is connected with expression vector pYC6/CT; D, adopt the LiAc conversion method to transform the recombinant DNA that makes up to enter Saccharomyces cerevisiae HD34; E, the gained transformant is carried out primary dcreening operation, the bacterial strain behind the primary dcreening operation is carried out the ADH qualitative detection, obtain the active strain HD 34-1 of high ADH with the isozyme method.

Embodiment two: the engineering strain HD34-1 of present embodiment makes up like this:

A, according to ADH gene order design 5 ' end, 3 ' end primer that GenBank goes up login, add the recognition site of Sac I and BamH I respectively at 5 ' end primer and 3 ' end primer GAGCTCWith GGATCC:

Bacillus subtilis ADH (Alcohol Dehydrogenase) gene order of the last login of GenBank NC 000964.For:

ttat

3182941 accgttttag gcgtaaggtt aaagcagcgt ttgtagatcc agttgtatgc tttttcattt

3183001 aaatctctag ggtttccgaa ggtttgcgga tctttcattg cttctttaga caagcgttcg

3183061 atcatatcag gtgatactcc ctgctcttct aaagtcggca cttctaaatc ttcgaccaga

3183121 tcatacatcc aattgacaga tgctttcgca gcttcttctg ttgtcatctt gcttgtatca

3183181 ataccgaacg ctttcgcaat acgcgcaaac ttctcaggat agcccttcca gttgtattcc

3183241 atgacagggc ccatcatcgc cgctacacat tggccgtgag cgactgggat aataccgcca

3183301 agcgtttggc tcatcgcatg agcagcgccc gctgattcac ttccgtaaga aagaccggca

3183361 agcatcgcag cctgcgccat tccgtacctt gcttccagat cctctccatc agcaaatgcc

3183421 ctcttgatgt aatgagcggc atactcaatc gccattaagg caaccgcatc cgtgattggc

3183481 tgtgcaaatt tcattgtata gcactcaatg gcatgggcga gcgcatcaat tcccgtcata

3183541 gctgttacat gcggaggcat tgaaacatga agctcaggat caatgattgt caagtgcgct

3183601 gcaatcagcg gaccgcccgt gttgaatttg aattctcttt cttcatctgt gataaccgcc

3183661 cattgggtta cttctgatcc ggttccagct gtagtgggaa ttgtcgtcag cggaggaatg

3183721 cggttttcca gcggtttttt cccatctgcc gcttcataat caagcacgct tccttcgtga

3183781 gtcgcttcta ctccgattgc ttttgctgta tccatggagc ttccgcctcc gactgccacc

3183841 aaaccattac agttctcttt tttgtaaagc tcagatcctt cattcaccag acggacaggc

3183901 gggtttggct caactttatt aaagagtacc acttcaatgc ctgcttcttt aagtgattcg

3183961 attacgggat cagcaacacc ggctttataa atcccagggt ctgtgacaag gagcgctttt

3184021 gaaacgccca gtgcagctac ttcctcaccc gtatgcttga tggctccgat tccatgctta

3184081 atcacagtcg gaatttcaaa tgtgtggaat ttctgcatgc tttctacctt catatttaat

3184141 gtcatcat，

5 ' end: AGT GAGCTCTCTAGGGTTTCCGAAGGTTTGCG, 3 ' end: GTG GGATCCAATCGGAGCCATCAAGCATACGG;

B, adopt PCR method with the genomic dna of Bacillus subtilis as template amplification ADH gene:

94 ℃ of 1min, 67 ℃ of 1min, 72 ℃ of 3min, in 50 μ l reaction volumes, contain genomic dna template 0.5 μ g, each 50 μ mol of each 20pmol of primer, dNTP, 2 Tag of unit enzymes, 30 circulations of Bacillus subtilis, the amplifying ADH gene fragment obtains the PCR product;

C, the product that obtains is connected with expression vector pYC6/CT:

I, PCR product are dissolved in (10 * TE:12.1g Tris Base+3.7gEDTA+900ml H in the TE solution through ethanol sedimentation ₂O (deionization) transfers pH to 7.5 with HCl, is settled to 1000ml), be the length that 1% agarose gel electrophoresis detects amplified fragments with the quality volumetric concentration, be 1.2kb as going up login consistent with GenBank, then can check order;

Ii. the PCR product is connected with the pBlue carrier, the pBlue carrier is a cloning vector, wherein

Endonuclease reaction liquid: pBlue (1 μ g/ μ l) 5 μ l

10 * damping fluid, 2 μ l

Sac I(5U/μl) 1μl

BamH I(5U/μl) 1μl

ddH ₂O 11μl

Reaction conditions: 37 ℃, 2 hours;

Ligation liquid: PCR product (0.1 μ g/ μ l) 1 μ l

PBlue carrier (50ng/ μ l) 1 μ l

10 * T ₄Dna ligase Buffer 1 μ l

T ₄Dna ligase (1U/ μ l) 1 μ l

ddH ₂O 6μl

Reaction conditions: 16 ℃, spend the night;

Above-mentioned connection product is converted into E.coli competent cell JM109;

E.coli JM109 100ml LB liquid nutrient medium overnight incubation under 37 ℃, 200 rev/mins condition that iii. will contain the ADH gene;

Iv. use a large amount of extraction agent boxes of Sangon MNIQ-200 plasmid (SK241) to extract the pBlue-adh recombinant plasmid dna, its extraction step is as follows:

(1) RNase A Solution is added among the Solution I, mixing for standby use, the dehydrated alcohol of 4 times of volumes of adding in the Wash Solution bottle, Solution II is short molten with 27 ℃ of water-baths;

(2) add Solution I 2ml in the centrifuge tube of preserving E.coli, 2min is placed in operation on ice; Add Solution II 2ml in centrifuge tube, turn upside down 5-10 time, the cracking bacterium, 2min is placed in operation on ice;

(3) add 8.6ml Solution III, turn upside down 5-10 time, room temperature is placed 2min;

(4) 10,000 rev/min, 4 ℃, high speed centrifugation 10min;

(5) get above-mentioned part supernatant liquor and in the 50ml collection tube, (the UNIQ-200 post is housed) and (6ml), leaves standstill 5min, 4000 rev/mins, 4 ℃, centrifugal 2-5min;

(6) abandon waste liquid, adding residue supernatant liquor (4ml) (has post) in collection tube, and 4000 rev/mins, 4 ℃, centrifugal 2-5min;

(7) add 5ml Wash Solution 4000 rev/mins of centrifugal 2min of room temperature in post;

(8) repeated centrifugation once;

(9) abandon waste liquid, 4000 rev/mins of centrifugal 10min of room temperature;

(10) get a new centrifuge tube in addition, add 500 μ l Elution Buffer, room temperature is placed 2min, 4000 rev/mins of centrifugal 2min of room temperature;

(11) 500 μ l Elution Buffer are changed in the Eppendorf pipe, add 50 μ l 3M NaAc, 500 μ l Virahols, 4 ℃ leave standstill 20min;

(12) 14,000 rev/min, 4 ℃ centrifugal 10min;

(13) abandon supernatant liquor, add the washing with alcohol of 1ml 70%; Abandoning supernatant liquor, add 20 μ l, 1 * TE, get 5 μ l and mix 1 μ l loading buffer, is 0.8% agarose electrophoresis detected result with volume mass concentration;

(14) plasmid DNA concentration that extracts detects with RNA/DNA Calculator;

V. the structure of recombinant plasmid dna pYC6/CT-ADH: Yeast expression carrier pYC6/CT is the product of Invitrogen company, it is the expression vector of low copy, thereby have when in producing bacterial strain, expressing stable and reduce characteristics such as influence as far as possible recipient cell, the collection of illustrative plates of expression vector pYC6/CT is seen Fig. 1, pBlue-adh and pYC6/CT (4.5Kb) are used Sac I and BamH I double digestion respectively

Endonuclease reaction liquid A: recombinant plasmid pBlue-aldc (1 μ g/ μ l) 5 μ l

10 * damping fluid, 2 μ l

Sac I(5U/μl) 1μl

BamH I(5U/μl) 1μl

ddH ₂O 11μl

Endonuclease reaction liquid B:pYC6/CT (1 μ g/ μ l) 5 μ l

10 * damping fluid, 2 μ l

Sac I(5U/μl) 1μl

BamH I(5U/μl) 1μl

ddH ₂O 11μl

Reaction conditions: 37 ℃, 2 hours;

With the quality volumetric concentration is that 1% agarose gel electrophoresis detects, and reclaims test kit (available from Shanghai China Shun biotechnology company limited) with DNA glue and reclaim gene fragment and pYC6/CT fragment from gel, uses T ₄Dna ligase connects this two fragments, wherein

Ligation liquid: gene fragment (0.1 μ g/ μ l) 1 μ l

Carrier segments (50ng/ μ l) 1 μ l

T ₄Dna ligase (1U/ μ l) 1 μ l

ddH ₂O 7μl

Reaction conditions: 16 ℃, spend the night;

With above-mentioned connection product Transformed E .coli competent cell JM109.

The E.coli 100ml LB liquid nutrient medium that vi. will contain the ADH gene, 37 ℃, 200 rev/mins of overnight incubation;

D, adopt the LiAc conversion method to transform the recombinant DNA that makes up to enter Saccharomyces cerevisiaeHD34:

The LiAc method for transformation is as follows: 1500g HD34 bacterium liquid centrifugal (＜3000 rev/mins) 5min that (1) will cultivate 2～4h, abandon supernatant liquor; (2) add 40ml 1 * TE, centrifugal (＜3000 rev/mins) 5min abandons supernatant liquor; (3) add 2ml 1 * LiAc/0.5 * TE, room temperature is placed 10min, adds 1 μ g plasmid DNA, 100 μ gdenatured sheared salmon sperm DNA and 100 μ l yeast suspension; (4) add 700 μ l, 1 * LiAc/40%PEG-4000/1 * TE and mix, 30 ℃ of reaction 30min; (5) add 88 μ l DMSO stostes, mix 40 ℃ of heating in water bath 7min; (6) 13,000 rev/min centrifugal 10 seconds, abandon supernatant liquor, with twice of 1 * TE washing precipitation; (7) add 1ml 1 * TE washing, 14000 rev/mins centrifugal 10 seconds, draw supernatant liquor, add 50-100 μ l1 * TE, coat on the flat board that contains Blasticidin, 30 ℃ of overnight incubation transform empty plasmid (being stored in E.coli) as positive control simultaneously, and blank as negative contrast (only being coated with bacterial classification);

E, the gained transformant is carried out primary dcreening operation, the bacterial strain behind the primary dcreening operation is carried out the ADH qualitative detection, obtain the active strain HD 34-1 of high ADH with the isozyme method:

Prescreening method is as follows:

The extraction of A, zymoprotein: will be through cultivating (30 ℃, 350 rev/mins) HD34 transformed bacteria suspension centrifugal (3000 rev/mins) 5min, abandon supernatant liquor, bacterial sediment moves into the liquid nitrogen mortar is housed, and grind to form lyophilized powder rapidly, in the centrifuge tube of packing into, add 1ml albumen storage liquid (Tris-HCl (pH7.5) 20mM EDTA 0.1mM Glycerol 10% KCl 100mM DTT 1mM PMSF 1mM, boiled 4 ℃ of preservations 5 minutes) centrifugal (1000 rev/mins) 2min;

B, discontinuous polyethylene propionic acid amide detected through gel electrophoresis:

PAGE prescription: storage liquid making method (100ml)

1 1mol/L HCl 48ml+36.6gTris+52ml H ₂O

2 28.0gArc+0.74gBis+100ml H ₂O

3 0.28g ammonium persulphate+50ml H ₂O (an available week)

4 1mol/L HCl 48ml+5.98gTris+52ml H ₂O

5 10.0gArc+2.5gBis+100ml H ₂O

6 40.0g sucrose+100ml H ₂O

7 TEMED stostes

8 Tris 0.60g+ glycine 2.88g+100ml H ₂O

Separation gel (7.0%) 32ml:

Label (application of sample order) milliliter number ratio

1 4 1

2 8 2

H ₂O 16 4

3 4 1

7 19.2μl 4.8μl

Concentrate glue (2.5%) 16ml:

Label (application of sample order) milliliter number ratio

4 2 1

5 4 2

6 8 4

3 2 1

7 24μl 12μl

Prepare PAGE according to the above ratio, the point sample electrophoresis, add 20 μ l sample supernatant liquors, 10 μ l, 40% sucrose, 20 μ l, 0.1% tetrabromophenol sulfonphthalein, concentrate glue 15mA and separation gel 30mA, stop electrophoresis about 1 hour, take out glue, will concentrate glue and remove, separation gel is dyeed, perform position mark, wherein dyeing process is as follows:

1. 50ml Tris-HCl (0.05mol/L, pH8.0) 6.06g Tris+1000mlH ₂O+1mol/LHCl transfers to pH8.0;

2. 4 alcohol 95%ethanol);

3. 16 nadide (1%NAD) 0.5gNAD+50ml H ₂O;

4. 16 nitroblue tetrazolium(NBT)s (1%NBT or use 1%MTT) 0.1gNBT+10ml H ₂O;

5. 4 azophenlyene methyl-sulfuric acids (1%PMS) 0.2gPMS+20ml H ₂O;

In 30 ℃ of incubators, dyeing 30min in dark place observes band, and the bacterial strain of the blue band of the existing specificity of taking-up is done the ADH active level and detected, and its method is as follows:

A, determination of protein concentration: get 14 test tubes, divide two groups by table 1 parallel running (Xylene Brilliant Cyanine G reagent: Xylene Brilliant Cyanine G G-250100mg is dissolved in 50ml 95% ethanol, adds 100ml 85% phosphoric acid, with distilled water diluting to 1000ml, filter paper filtering.Contain 0.01% (W/V) Xylene Brilliant Cyanine G G-250,4.7% (W/V) ethanol, 8.5% (W/V) phosphoric acid in the final reagent; Standard protein solution: BSA (measuring protein nitrogen content in advance), be mixed with 1mg/ml according to its purity with 0.15mol/LnaCl, 0.1mg/ml protein solution), drawing standard curve then: with A595nm is ordinate zou, standard protein content is X-coordinate, drawing standard curve on graph paper is got suitable sample volume, makes its measured value in the linear extent of typical curve.According to the A595nm value of being measured, on typical curve, find it and be equivalent to the proteic amount of typical curve, thereby calculate the protein concentration of unknown sample;

Table 1

The test tube numbering	0	1	2	3	4	5	6
								1mg/ml standard protein solution/ml	0	0.01	0.02	0.03	0.04	0.05	0.06
0.15mol/LnaCl/ml	0.10	0.09	0..08	0.07	0.06	0.05	0.04
								Xylene Brilliant Cyanine G reagent/ml	5ml
Shake up, 1h is interior to be blank with No. 0 test tube, in 595nm place colorimetric
								A 595nm

The B.ADH active level is measured: cultivate bacterial strain again, extracting zymoprotein as aforesaid method is dissolved in the albumen storage liquid, get 200 μ l supernatant liquors, add the BSA of 200 μ l 1%, the phosphoric acid buffer of 600 μ lpH=7.5,0.1M mixes, therefrom take out 100 μ l mixed solutions, add tetra-sodium damping fluid, the ethanol of 0.5ml 2.0mol/L and the nadide of 1.0ml 0.025mol/L of 1.5ml 0.1mol/L, at 30 ℃ of warm down 3～4min that bathe, measure OD value under the 340nm, calculate the ADH activity.

Embodiment three: the alcohol-free beer of present embodiment is achieved in that a, adopts malt extract medium solid slant activation HD34-1; B, under 20～40 ℃ temperature, will activate good bacterial classification and forward in the 500ml malt juice liquid medium, shake-flask culture 46～50 hours, wherein temperature is 20～40 ℃, rotating speed is 120 rev/mins; C, the bacteria suspension that will spread cultivation are cooled to 3～5 ℃, will spread cultivation bacterial classification inoculation in the fermentor tank that contains wort by 2～4% inoculum sizes; D, oxygenation 2～3 minutes in fermentor tank are then fermented at 10～14 ℃; E, be that pol is measured by unit with the sky, when pol drops to 5 ° of BX, stop fermentation; F, be cooled to 3～5 ℃, can go out jar after placing a week, obtain alcohol-free beer.

Embodiment four: the alcohol-free beer of present embodiment is achieved in that a, adopts malt extract medium solid slant activation HD34-1; B, under 30 ℃ temperature, will activate good bacterial classification and forward in the 500ml malt juice liquid medium, shake-flask culture 48 hours, wherein temperature is 30 ℃, rotating speed is 120 rev/mins; C, the bacteria suspension that will spread cultivation are cooled to 4 ℃, will spread cultivation bacterial classification inoculation in the fermentor tank that contains wort (10～11 ° of P) by 2% inoculum size; D, oxygenation 2～3 minutes in fermentor tank are then fermented at 12 ℃; E, be that pol is measured by unit with the sky, when pol drops to 5 ° of BX, stop fermentation; F, be cooled to 4 ℃, can go out jar after placing a week, obtain alcohol-free beer.Utilize alcohol-free beer Yeast gene engineering bacterial strain HD34-1 to carry out beer fermentation, the testing method of its technic index is as follows:

I, fermentation degree are measured: get fermented liquid, elimination yeast, low baking temperature heating evaporation extremely former volumetrical 1/3 add water and recover to measure 20 ℃ proportion behind the former volume to remove ethanol, are calculated as follows fermentation degree:

$w_r(\%)=\frac{w{\·w}_1}{w}\×100\%$

In the formula: the w preceding wort concentration (%) of representing to ferment, w ₁The fermented liquid concentration (%) behind the alcohol, w are got rid of in expression fermentation back _rExpression attenuation real degree (%).

II, alcoholic strength are measured: add the 10.00ml potassium bichromate standardized solution and the 5ml vitriol oil in Florence flask, cooling adds 12ml distilled water in distilling flask and 1.00ml removes CO ₂After beer sample, connect water distilling apparatus, on electric furnace, be heated to boiling, continue boiling 4 minutes, with the Florence flask cooling, add 10mlKI solution, put the dark place and placed 5 minutes, add water to 300ml, use Na ₂S ₂O ₃Standard solution titration adds the 1ml Starch Indicator during near terminal point, use Na ₂S ₂O ₃Solution continues titration to terminal, according to the Na that consumes ₂S ₂O ₃, ethanol content in the calculation sample, ethanol content g/100ml=12～0.4A, A represent the standard Na that consumes ₂S ₂O ₃Milliliter number, wherein 30ml standard Na ₂S ₂O ₃The suitable 120g/L alcohol of solution.

III, suspension yeast number are measured: the bacteria suspension of yeast being made proper concn with stroke-physiological saline solution, before application of sample, earlier nucleonics is carried out microscopy, if there is dirt then need clean, just can count after drying up, the blood counting chamber covered that cleaning is clean is dripped a droplet with the yeast saccharomyces cerevisiae bacteria suspension that shakes up by the cover glass edge with aseptic capillary burette again, allows bacterium liquid enter nucleonics along the slit automatically by capillary osmosis; Behind the application of sample static five minutes, then blood counting chamber is placed on the microscope stage; Earlier find the nucleonics position, change high power lens then into and count with low power lens.

IV, total acidity test: utilize the acid-base neutralisation principle, with the total acid of standard solution of sodium hydroxide direct titration beer sample, measure titration end point with pH meter, last volume by the standard solution of sodium hydroxide that consumes, calculate the content of total acid in the beer, calculation formula is as follows:

X＝2·C·V

Wherein: X represents total acid content, i.e. the total acid content of 100ml wine sample (ml/100ml); C represents NaOH standardized solution (C=0.1002mol/L); V represents the ml number of the NaOH that 50ml wine sample consumes; 2 expressions are converted into the coefficient of 100ml wine sample.

V, higher alcohols are measured: adopt the variation of gas chromatography determination higher alcohols.

VI, diacetyl content are measured: install the di-acetyl distiller, 100ml wine sample is added rapidly in the distiller of preheating, add thermal distillation, until distillate during near 25ml, get the 10ml distillate and add 0.5ml 1% O-Phenylene Diamine, fully shake up the reaction 20～30min that opens in dark place, add 2ml 4NHCl, survey its optical density with 335nm behind the mixing, calculate diacetyl content.

VII, yeast cohesive force are measured: adopt the cell count relative method to measure yeast cohesive force, under the same conditions yeast suspension is left standstill 30min at 25 ℃, sampling counting suspension yeast number S will precipitate yeast again and shake up, survey yeast number T, for improving tolerance range, repeat 5 times as above-mentioned operation, averaging respectively obtains S, T, then agglomerating yeast is counted F=T-S, F '=F/T, ratio are bigger, and cohesive force is stronger.

VIII, pol are measured: the sugar degree (%) of measuring fermented liquid with saccharometer (WYT-10-32%).

Detect the alcohol-free beer of brewageing through present method according to the method described above, final alcoholic strength＜1% (v/v) of its beer; Diacetyl content 0.106ppm; Every index such as total acid, higher alcohols is qualified.

Claims (2)

1, the construction process of HD34-1 bacterial strain is characterized in that it is to make up like this: a, according to ADH gene order design 5 ' end, 3 ' end primer that GenBank goes up login adds the recognition site of SacI and BamHI respectively at 5 ' end primer and 3 ' end primer GAGCTCWith GGATCCB, adopt PCR method with the genomic dna of Bacillus subtilis as template amplification ADH gene; C, the product that obtains is connected with expression vector pYC6/CT; D, adopt the LiAc conversion method to transform the recombinant DNA that makes up to enter Saccharomyces cerevisiae HD34; E, the gained transformant is carried out primary dcreening operation, the bacterial strain behind the primary dcreening operation is carried out the ADH qualitative detection, obtain the HD34-1 bacterial strain with the isozyme method.

2, be the method that fermentation strain is brewageed alcohol-free beer with the HD34-1 bacterial strain, it is characterized in that it is achieved in that a, adopts malt extract medium solid slant activation HD34-1; B, under 20～40 ℃ temperature, will activate good bacterial classification and forward in the 500ml malt juice liquid medium, shake-flask culture 46～50 hours, wherein temperature is 20～40 ℃, rotating speed is 120 rev/mins; C, the bacteria suspension that will spread cultivation are cooled to 3～5 ℃, will spread cultivation bacterial classification inoculation in the fermentor tank that contains wort by 2%～4% inoculum size; D, oxygenation 2～3 minutes in fermentor tank are then fermented at 10～14 ℃; E, be that pol is measured by unit with the sky, when pol drops to 5 ° of BX, stop fermentation; F, be cooled to 3～5 ℃, can go out jar after placing a week, obtain alcohol-free beer.