CN1316878A

CN1316878A - Method of performing transgenesis

Info

Publication number: CN1316878A
Application number: CN99810645.3A
Authority: CN
Inventors: 安东尼C·F·佩里; 若山辉彦
Original assignee: Individual
Current assignee: Individual
Priority date: 1998-08-11
Filing date: 1999-08-11
Publication date: 2001-10-10
Also published as: WO2000008924A1; CA2340242A1; WO2000008924A9; NZ509861A; IL141362A0; BR9913644A; JP2002524054A; EP1111991A4; MXPA01001586A; EP1111991A1

Abstract

The invention provides a method for generating transgenic animals and cells by the coinsertion of nucleic acid and a nucleus into an unfertilized oocyte. Preferably, the coinsertion is by microinjection and more preferably by piezo-electrically actuated microinjection. Transgene (tg) expressing embryos are here produced following coinjection of unfertilized mouse oocytes with sperm heads and exogenous DNA encoding either a green fluorescent protein (GFP) or beta-galactosidase reporter. The microinjected oocyte may be allowed to develop into differentiated cells or stem cells; into an embryo in vitro prior to transfer into a host surrogate mother, or it may be transferred directly into a host surrogate mother. Embryonic development can occur to term, such that the offspring possess transgenic modifications that may alter their characteristics (phenotype) and are, in turn, transmitted to their offspring.

Description

Carry out transgene method

This patent file comprises the accompanying drawing of at least one width of cloth colour, and the copy of the color drawings of this patent will be provided by United States Patent and Trademark Office after will reaching the payment necessary fee as requested.

The background of invention

People wish to go to change with a kind of mode of regulation the characteristic of all animals and plants (perhaps their embryo's precursor).So-called transgenosis is exactly the method for selecting in order to reach this target.Used here " transgenosis " is meant that genome is owing to carrying the process that a new dna sequence dna of introducing changes.This process needs the genomic integration of dna sequence dna external source or metastatic gene usually.This dna sequence dna can be encoded to needed vegeto-animal characteristic.Any so genetically modified animals and plants that have the genome change can have one or more and plant by the coded characteristic of the foreign DNA of this new introduction.Ideally, such gene alteration can transmit by kind of a system, therefore just can pass to the offspring, and then can vertically transmit along the pedigree of transgenic organism.We usually wish to contain metastatic gene in each cell of a specific transgenic organism, and this can obtain by transgenosis.Genetically modified animals and plants have very big potential application in the production of agricultural, medicine and bioactive compound (in and preparation and medicament).For example, can will help to make such animal in heteroplastic transplantation, to play a role in the production of the transgene pig of its cell surface expression people's tissue compatible (MHC) albumen.

At present, aspect the animal transgenosis several method is being arranged.Preceding cell nucleus microinjection is the method for being used widely at first.This method grew up by experiment on mice in early days in the eighties in 20th century, and it need be expelled to metastatic gene DNA in unicellular embryo's the precursor nuclear.Reported first (Gordon, J.W., Scangos, G.A., Plotkin, D.J., Barbosa, J.A.﹠amp in this method; Ruddle, F.H., Proceedings ofthe National Academy of Science USA 77,7380[1980]) in, in 78 pups of birth, have only two to have transfer DNA, transgene efficiency is less than 3% (2/78).Along with people to the updating of this method, the cell nucleus microinjection carries out genetically modified efficient and has been increased to common numerical value about 15% before utilizing at present in mouse.Yet, for other species, as ox, sheep, pig and goat (example) with species of commercial value, corresponding genetically modified efficient very low (about 1%).This acquisition that may reflect the unicellular embryo of mouse with handle that to compare with the difficulty of the unicellular embryo's of other species acquisition and processing be relatively easy.With single celled embryo's difference of mouse, when observing these single celled embryos with commercial value species at the normalized optical microscopically, the result who sees very fuzzy (because these species contain high-caliber lipid inclusion).This is a great defective for preceding cell nucleus microinjection, because this method requires entry needle to be expelled to accurately in the specific cavity of an ovum (precursor nuclear).Precursor nuclear must be positioned, so it must be visible.In the trial of attempting to address this problem, introduced this additional step of low-speed centrifugal.

Because the integration site of gene and be integrated into the randomness of host genome gene copy quantity utilizes precursor nuclear microinjection to carry out transgenosis and can't the insertion result of metastatic gene be controlled and predict.(normally mouse ES) can be controlled preferably to the result who integrates by utilizing embryonic stem cell.Such embryonic stem cell is to carry out transfection by the structure with target gene group homologous recombination to obtain.Thereby transfected embryonic stem cell can screen, identify and remove to confirm those structural integration sites external.Next, those reorganization embryos that have as the embryonic stem cell target gene can be used to produce chimeric offspring (hybrid generation).The method of this gene alteration is limited on one's body those mouse that help the existence of system genitale embryonic stem cell that built up at present, and does not also have on other species and can confirmedly use.

Owing to modify the restriction of the Existing policies of mammalian genes system, method, impel people to seek alternative method.These methods comprise that the retrovirus of using reorganization removes to infect the transfering system that adenovirus mediated of the pre-embryo who transplants of egg mother cell, replication defect type or with the carrier of sperm as DNA transfer during in vitro fertilization.In last a kind of method, the sperm of living is by external a carrier of recombinant DNA introducing egg mother cell with being made in.Because phenomenon biologically is difficult to be identified, and define its application owing to its unreliability.

Intracytoplasmic sperm injection (ICSI) is entered the incident that is in metaphase in cell division II mouse egg mother cell below once reporting in the past.The head of sperm because they are immovable, once was considered to " dead " when injection, however, they can support that still sperm reaches full growth.The more important thing is that the ruined sperm of cell membrane also can be supported reaching full growth of sperm.(Perry,A.C.F.,Wakayama,T.&?Yanagimachi,R.Biology?of?Reproduction?60,747[1999])。The structure of the cell membrane of sperm below whole biologically be what highly to keep.The major protein composition of this structure (mainly being cell nucleus and cell nucleus Zhou Jizhi) is the alkaline protein that has positive charge.They can support the mutual electrostatic interaction of polyanion of the nucleic acid as comprising DNA and RNA this expression.These characteristics are utilized in a kind of research and development of new transgenic method, and this method will be narrated at this.This method and existing method relatively have obvious superiority: it can high efficiency generation transgenic progeny; It can be used for the production of the transgenic animal of various different plant species; Its flexibility allows relatively, and dissimilar metastatic gene and other molecules of wide region imports; It can carry out biologically operation to non-fertilized egg; It supports a branch-so-called gene target in the transgenosis.Utilize the gene target method in a complete genome, can carry out the change of specific site.After this method of this invention will narrated.

The overview of this invention

This invention provides introducing metastatic gene (tg) nucleic acid (NA) to enter in the cell of organism as animals and plants, or enter in the cell of culture in vitro, or utilize in advance and metastatic gene nucleic acid that cell nucleus mixes is co-injected into method in an immature egg mother cell, unfertilized egg mother cell or the non-nucleus egg mother cell (henceforth just being called egg mother cell) by injection metastatic gene nucleic acid.

In one embodiment of the invention, those unfertilized egg mother cells were suppressed in the II stage in the mid-term of reductional cell division.Mid-term, the egg mother cell of II was fertilized normal participation of this stage mammal.The present invention further provides metastatic gene nucleic acid (NA) has been introduced a method that contains in the residual cells nuclear composition cell, grown activation subsequently.

Here the technical term of usefulness " transgenosis nucleic acid " (or " tg NA ") intention comprises and anyly can be introduced into an egg mother cell and be induced to till this moment still nucleic acid and the derivative thereof that the genomic order for natural type changes, and this variation has changed genome.In one embodiment, genetically modified nucleic acid is that DNA (deoxyribonucleic acid) is DNA.Technical term " cell nucleus " referred to herein as whole nuclear or necessary part is grown in embryonic development fully or further.In a most preferred embodiment, this nuclear is the cell nucleus of a sperm.

This invention further provides by metastatic gene and cell nucleus and has inserted the method that produces transgenic animal altogether.For example, in this method, make this cell nucleus contact metastatic gene nucleic acid by mixing.In one embodiment, cell nucleus is the cell nucleus of the cell membrane sperm that has been removed or destroyed.This invention allows to use the method for various destruction films.

In a most preferred embodiment of the present invention, cell nucleus is by microinjection or preferably adopts piezoelectricity to activate microinjection and insert in the egg mother cell.Piezoelectricity activates the process that microinjection (traditional relatively method) has promoted microinjection, makes process rapider.So just reduce cellular damage, increased embryo's survival rate.Chong Zu cell makes the bud into possibility by this way.In one embodiment, grow the cell (for example stem cell) of the homogenic type that has produced quite big quantity.In a further embodiment, recombinant cell can develop into a blastular in culture in vitro subsequently.And the embryo who obtains at this moment or the previous stage of embryonic development can be transferred among the suitable surrogate mother (acceptor mother) so that grow fully.

We have verified that the method for inserting altogether by a sperm head and metastatic gene DNA produces the result of study of transgenic progeny alive at this.We have verified that not only metastatic gene is present among the offspring, and these metastatic genes have carried out expressing in the offspring and changed offspring's feature.In different most preferred embodiment of the present invention, we confirm that the ruined sperm head of cell membrane has promoted transgenosis expeditiously.The destruction of cell membrane can obtain with diverse ways, and this comprises with cleaning agent, freeze thawing or freeze-drying handles sperm.The destruction of sperm head cell membrane is enough to show that spermoblast is fit to be applied in this method.We use the head of sperm here, comprise the head of the sperm that cell membrane sustains damage, and go to prove the principle of this invention.In one embodiment of the invention, the damage of cell membrane allows metastatic gene DNA near the subcellular fraction nuclear element, and these subcellular fraction nuclear elements include but not limited to examine Zhou Jizhi (with regard to sperm), paralinin, chromatin and genomic DNA.

In one embodiment of the invention, metastatic gene nucleic acid is the linear dna fragmentation of an encoded phenotype mark that is easy to detect.Insert the genetically modified embryo and the offspring that obtain altogether by cell nucleus and DNA and had genomic change.This genomic change can change their characteristic in a kind of mode that is easy to detect (phenotype).The mark that is easy to detect that can be suitable for comprises: the green fluorescent protein (GFP) of firefly luciferase (Luc), the sweet enzyme of Escherichia coli beta galactose (LacZ) and Aequoria victoria.

Preferably, before injecting altogether, carry out metastatic gene nucleic acid and nuclear mixing with a micropipettor.In another most preferred embodiment, injection enters one the repressed embryo of reductional cell division II in mid-term altogether.We here usefulness be the DNA of green fluorescent protein (GFP) of coding Aequoria victoria or the DNA (LacZ) of the sweet enzyme of Escherichia coli beta galactose, thereby expressed to prove principle of the present invention with a high frequency by the metastatic gene sequence that the method that shows this invention produces in the transgenic embryo.In an alternative embodiment of the invention, metastatic gene nucleic acid is and artificial chromosome, such as: the artificial chromosome of mammal, yeast and bacterium be corresponding (be respectively: MAC, YAC, BAC:Schindelhauer, D.Bioessays21,76[1999]; Peterson, K.R.Method in Enzymology 306,186[1999]; Kim, U.J., Birren, B.W., Spleak, T., Mancino, V., Boysen, C., Kang, H.L., Simon, M.I. ， ﹠amp; Shizuya, H.Genomics34,213[1996]).In further embodiment of the present invention, metastatic gene nucleic acid is corresponding to ribonucleic acid (RNA), for example: mRNA (mRNA), or corresponding to RNA-DNA heteroduplex (chimera that has a mispairing at least), or corresponding to peptide nucleic acid.

Therefore, thus this invention is co-injected in the unfertilized egg mother cell to producing transgenic progeny by nuclear and metastatic gene DNA a kind of high efficiency method is provided.The present invention can be applied to the set of all organisms and mutant and stem cell.And these mutants and stem cell can or may be inserted into a unfertilized egg mother cell and produce along with a cell nucleus.These nuclear sources without limits, it comprises and derives from amphibian, fish, bird (such as tame chicken, turkey, goose or the like) and mammal, such as primate, sheep, ox, pig, bear, goat, cat, dog, horse, mouse or the like.In one embodiment of the invention, cell nucleus derives from sperm, has been retained with spermoblast nuclear some attributes in close relations.(see Kimura, Y., Yanagimachi, R., Kuretake, S., Bortkiewicz, H., Perry, A.C.F ﹠amp; Yanagimachi, HBiology ofReproducticn 58,1407[1998]).

Utilize microinjection carry out metastatic gene DNA/ nuclear material common importing method with need artificial or by different on the space-time are arranged at external raising cell fusion method.(Lavitrano,M.,Camaioni,A.,Fazio,V.M.,Dolci,S.,Farace,M.G.&?Spadafora,C.Cell?57,717[1989])。In one embodiment, microinjection at first need carry out the screening of cell nucleus (and nucleic acid), and next their sediments enters egg mother cell by the plasmalemma that penetrates egg mother cell.

The metastatic gene and the nuclear injection altogether that utilize this inventive method to carry out do not need to obtain cell nucleus from living cells.This further makes the method for this invention be different from those to think that sperm alive and metastatic gene DNA (adult is outer in vivo) are mixed, introduce the method that the DNA illustration is explained by insemination then.And, according to the method for this invention, metastatic gene DNA and a nuclear common injection that derives from the destroyed cell of film, permission may to the result of program effectively, the common importing of the reagent that is subjected to accurately controlling.Such reagent can comprise enzyme, the inhibitor of signal transduction on antibody or the pharmacology, they can be by regulating reorganization or/and embryonic development promotes transgenosis, these reagent can be before metastatic gene DNA nucleic acid and cell nucleus import the embryo altogether, during or import the embryo afterwards.

Brief description of drawings

Referring to accompanying drawing, the present invention will be described in more detail below, wherein:

Fig. 1 has shown the radial section of typical mouse sperm head, these radial sections or intact (fresh) are (A), perhaps their cell membrane is destroyed (B) freeze thawing (C) or freeze drying (D) by Triton X-100, shown in example 1, and wherein abbreviation expression:

Ac: Forward End Cap eq: equator section pa: back-end region

The cell membrane of protoplast and front end lacks or destroyed (except the equatorial zone).Destruction in the Forward End Cap part is the most clearly.

Fig. 2 has shown that genetically modified embryo produces by single-shot double transgenesis (" singles two " transgenosis).With pCX-LacZ and pCX-EGFP metastatic gene are mixed the micro-microinjection egg mother cell of cultivating in advance of sperm.Shown in example 3.Shown the contrast (A) of same embryo (X400) situation that arrives after 3.5 days with dahlia violet dyeing adjustment and undyed microscopic examination among the figure, (B) be at long wave (480nm) the ultraviolet ray expression of green fluorescent protein (GFP) down, and (C) be the expression of the beta galactosidase after expression is dyeed with X-gal.

Fig. 3 represents deriving from genetically modified person of foundation and the sharp vivisection analysis of the tail of non-transgenic control group.(A) for coming from (the b of non-transgenic (X40) (a:#16 mouse) and transgenosis green fluorescence kind system; The green fluorescence microexamination of the tail point #3 mouse).By non--green hair, the micromicro of green fluorescence is to be observed.(B) for utilizing the pCX-EGFP genetic fragment to make probe, respectively to contrast B6D2F1 (0), #3 (5-9), #19 (＞50), #28 (5-9) and #41 (2) do the total dna content of southem hybridization analysis.(metastatic gene the copy number in each genome of numeral for estimating in the bracket).(C) for utilizing polymerase chain trans (PCR) to #16, #17, #30, #36, #47, #49 and contrast B6D2F1, the result that #3, #19, #28, #41 analyze sees example 5.

Transgene method is carried out in detailed description of the present invention

The invention describes the unique method of a cover that contains a genetically modified cell that is integrated that produces.The method of this invention may further comprise the steps: (I) makes foreign gene-metastatic gene nucleic acid contact (cell nucleus, or its part comprise chromosome) with the cell nucleus composition; (II) microinjection metastatic gene nucleic acid-nuclear mixture or metastatic gene nucleic acid enter in the unfertilized ovum; (III) makes the cell development that obtains.The possibility of result of growing produces mutant or stem cell, forms the embryo afterwards, embryo transplantation produces body one by one on one's body to acceptor mother.We are now with regard to each step of more detailed description, and show that these steps are arranged how originally.I, external source metastatic gene nucleic acid are exposed to the cell nucleus composition

This method permission external source metastatic gene nucleic acid before microinjection is exposed to the cell nucleus composition, cell nucleus can derive from somatic cell or other cell, external source metastatic gene nucleic acid can be by the method for illustration, but be not limited to, as electroporation, lipofection, infection protocol, the microinjection guiding before mixing or cell nucleus insert enters cell, and these methods are known the people who is familiar with this field.

In one embodiment of the invention, pCX-EGTP dna fragmentation (seeing example 1 or example 2) is passing through ground and mixed 30-180 second with not genetically modified sperm on ice or under 25 ℃ of conditions, and the cell membrane of these sperms is destroyed by detergent treatment, these cleaning agents such as Triton X-100, (3-[3-monoethanolamine) dimethylamino) 1-propane sulfonic acid ester) (CHAPS), dodecyl sodium sulfate (SDS), lauryl sodium sulfate (SLS), alkyl trimethyl amine bromide (ATAB), but also be not limited only to this.In the further embodiment of the present invention, the cell membrane of sperm is by freezing/melt or freeze-drying method destruction.These methods are drawn to be made sperm be subjected to sufficient damage and has lost a part of sperm.The ruined degree of cell membrane increases progressively in the following order: the new sperm＜TritonX-100 that separates＜freeze repeatedly/melt＜freeze drying.

The range of choice that has enlarged metastatic gene nucleic acid is an aspect of the great superiority compared with previous method of method of the present invention.Metastatic gene nucleic acid can comprise strand or double-stranded RNA or DNA, and the species of heterozygosis allos double source (for example RNA-DNA heterozygote, face as follows) and relative big molecule are as chromosome.In an embodiment of this invention, nucleic acid can be corresponding with big dna molecular (for example 50,000 base-pairs are to＞1 hundred ten thousand base-pair).The example of big dna molecular comprises the artificial chromosome (being respectively MACs, YACs and BACs) that resembles mammal, yeast and bacterium, but also is not limited only to this.Big like this molecule is responsive (for little molecule) for damage, especially during micromanipulation.Therefore; in one embodiment of the invention; make big dna molecular stable by the step of leniently mixing the easy sperm head of being given that destroys of cell membrane; this mainly allows the relative big protection structure of these big dna moleculars and sperm head not allow them be subjected to the damage of chemistry or physical action (as shearing force) during injecting in conjunction with (ⅱ) based on following some (ⅰ), has therefore increased successful probability.

Method of the present invention is the invention provides the method that makes that the new characteristic of unfertilized egg mother cell cytoplasm (metaphase in cell division II) is utilized for a further aspect of the remarkable advantage of in the past method.Especially, nuclear the separating behind the egg mother cell of cell nucleus injection metaphase in cell division II provides the situation that makes genomic DNA exposed relatively with fixed attention; Therefore have more activity (at Perry, A.C.F, Wakayama, T.﹠amp; Yanagimachi introduces among the RBiology of Repoduction 60,747 (1999)).And, because being expelled to sperm in the metaphase in cell division II egg mother cell is damaged or is heated to 48 ℃ and cause that reorganization produces bicentric (being transposition), off-centre or annular chromosome or chromosome segment, just the embryo who gets the metaphase in cell division II is contained the factor of some recombination genes, (Ward, W.S., Perry, A.C.F. ， ﹠amp; Balhom, R.Biology of Reproducton has prepared to deliver).Method of the present invention is for by homologous recombination and/or by collecting DNA being repaired the factor that works, just as providing the gene target at chimeric example (face as follows).In one embodiment, this invention is also considered by comprising in cell nucleus-mixtures of nucleic acids and is into had the reagent that locus specificity or non-locus specificity can improve recombination efficiency reorganization is provided.These reagent comprise colibacillary ReCA albumen, corresponding human ReCA albumen, HsDmc-1, are combined with single-stranded DNA binding protein as phage T4 gene 32 products, site-specific recombinase (resembling Cre and Flp recombinase) or the like, but are not limited only to these reagent.In a further embodiment, the nucleic acid that is used to gene target DNA structure contains a sequence widely, this sequence and genome natural gene seat part sequence pairing (usually being 1).The standard of gene targeting vector design is for can be good at designing and knowing the people who is familiar with this field.

The method that the present invention here introduces also allows nucleic acid (NA) and chimera to be complementary.In one embodiment, these molecules all are short RNA-DNA allos double sources (＜100 nucleotide), (for example, Yoon, k., cole-strauss, A.﹠amp; Kmiec, E.B.Proceedings of the National Academy of SciencesUSA 93,2071[1996]), except the 1-3 base near the mispairing center, this heteroduplex contains the sequence extremely complementary with genome sequence.Such molecule can instruct cell DNA to repair machine and go genome sequence is introduced in mispairing (base).In this embodiment of the present invention, DNA repairs machine in egg mother cell, inject the egg mother cell that enters the metaphase in cell division II altogether or under the non-existent situation of cell nucleus at cell nucleus-chimera like this, chimera be injected into egg mother cell during or subsequently, site-specific sudden change just can be introduced into.

This invention allows during mixing to comprise more additional material.This conditioning agent that may comprise nuclease (for example, [EDTA] ethylenediamine tetra-acetic acid, golden red tricarboxylic acids, restriction enzyme or the like), apoptosis (for example golden red tricarboxylic acids or the like), proteolysis (leupeptin for example, E, 64 or the like), also have DNA in conjunction with albumen such as nucleoprotamine and topoisomerase etc., but be not limited only to these added substances.In one embodiment of the invention, the auxilliary reagent that adds does not exist under the situation and metastatic gene nucleic acid mixes at cell nucleus, in this case, by egg mother cell is advanced in metastatic gene nucleic acid (tgNA) microinjection, and nuclear residue provides genome in the egg mother cell, this just as the metaphase in cell division II egg mother cell of a stoning accepted situation in the egg mother cell of metaphase in cell division II of the cell nucleus of an individual cells or a non-stoning by nuclear transplantation.These cells are by using gynecogenic reagent, and the artificial activation grows, and these Activiation methods familiar people in field hereto are (cytokinesin, closed reagent are as cytochalasin B, D or the like) that knows.

The mixture of cell nucleus-nucleic acid should be held a period of time so that allow cell nucleus-nucleic acid combination.In one embodiment, this combination just can occur at least in 30 seconds, and mixture is transferred to and carries out microinjection under the microscope stage then.In a further embodiment, microinjection is exposed to nucleic acid at cell nucleus and is done in 1 hour.II. microinjection metastatic gene nucleic acid (tg NA)-cell nucleus mixture or metastatic gene nucleic acid enter in the unfertilized ovum.

Those are inserted in the unfertilized egg mother cell by microinjection with the cell nucleus that metastatic gene nucleic acid fully contacts.Cell nucleus-mixtures of nucleic acids is transferred on the microscope stage of microinjection instrument becomes a droplet, so just can be collected into the pin that is used for microinjection and inject.In one embodiment, cell nucleus-mixtures of nucleic acids is replenished by polyvinylpyrrolidonesolution solution and goes to help operation.The collection of injected metastatic gene-cell nucleus sample is to use in the suction pipe of an injection of haustorium inspiration.In a most preferred embodiment of the present invention, the microinjection syringe needle is the pressure activation formula.Suitable piezoelectric actuator element is on sale in Prime technology Co., Ltd (Tsukuba, Ibaraki-ke, Japan) and Eppendorf Scientific (New York, the U.S.), can use according to the seller's instruction.This element can with one highly controlled and fast mode transmit the piezoelectricity pulse and be attracted to (0.5 μ m) in the very short distance to promote microinjection suction pipe tip.Intensity (changes according to control element is different with per twice piezoelectricity and gap, strength values with generality is 1-5, and speed is 1-16) be applied to promoting the clear area (egg mother cell is derived from little aspirator of a support suction pipe and fixed) that tip passes egg mother cell.The tip of suction pipe and egg mother cell protoplasm somatocyte film are staggered relatively up and down and promote (towards the relative face of egg mother cell) forward and be absorbed in deeply up to egg mother cell protoplasm somatocyte film.In case use (commonly used is 1) piezoelectricity pulse (common intensity 1-4, speed 1) in a small amount, the protoplasm somatocyte film will be penetrated, and so just allows metastatic gene nucleic acid-cell nucleus or transfer base to be stranded the cytoplasm that nucleic acid enters egg mother cell.In one embodiment, this injection is with the glass needle of a concordant terminal borosilicateization (typical inherent diameter is 4.5-10um), and this pin contains mercury near endways.Mercury has increased the momentum and the control of piezoelectricity activation needle point.The amending method of optional microinjection in addition can be used to insert (tg NA) metastatic gene nucleic acid and/or cell nucleus, this is included in Yanagida (K., Yanagimachi, R., Perreault, S.D.and Kleinfeld, in the description of R.G.Biology ofProduction 44,44 (1991) as those traditional suction pipes of illustrations.

Cell nucleus can be injected in the egg mother cell of those same species of originating, or derive from an egg mother cell of different plant species, and, the method of this explanation allows nucleic acid injection or nucleic acid-cell nucleus to be injected into egg mother cell, enucleation oocyte or immature (as the blastocyst stage) egg mother cell altogether, is also included within the preovulatory egg mother cell of maturation in vitro.(IV M) is needed at external oocyte maturation, but ripe egg mother cell source is limited or non-existent, and must they just are more suitable for microinjection under the situation that some reagent exists.The egg mother cell IV M (maturation of egg mother cell) of ox was introduced in WO98/07841; The IV M of mouse egg mother cell (maturation of egg mother cell) is at Eppig ﹠amp; Telfer (Methods in Erzymology 225,77, Academicpress[1993]) the middle introduction.Ripe egg mother cell can induce superovulation to obtain by the short sexual gland of continuous dispensing or other parahormone.(for example, continuous dispensing people's human chorionic gonadtropin and pregnant mare serum gonadotrop(h)in (PMSG)).Next be to collect ovum as operation.(for example cat began the back 80-84 hour in oestrus, and ox is 72-96 hour, and mouse is 13-15 hour).

Among the other embodiment of this invention, be exposed to nuclear nucleic acid and derive from the dliploid somatic cell, and it is inserted in the cytoplasm of egg cell, and the dyeing private savings of this egg mother cell are removed (enucleation oocyte); The non-nucleus egg mother cell method for the people who is familiar with this field be know and also be utilized, for example at Wakayama, T., perry, A.C.F., Johnson, k., Zuccotti, M.﹠amp; Yanagimachi, R.Nature394 is in 369 (1998).Cell nucleus is from passing through as trypsase (0.025%) and edetic acid (EDTA; 0.75mM) obtain collecting in the dispersed cell crossed of mixture process.Cell was germinated by artificial stimulation after reorganization in 0-6 hour, according to known method, used as Sr ²⁺, ethanol or electronic impulse stimulate, but are not limited only to this.That method of the present invention is applicable to and is obtained from amphibian, fish, birds (resembling tame chicken, turkey, goose or the like) and mammal such as primate, sheep, ox, pig, bear, goat, hunts, dog, horse, mouse or the like are extracted or in vivo or at the cell nucleus of growth in vitro.

In further embodiment of the present invention, in the head of the involved sperm as being vulnerable to destroy at film of cell nucleus, the injection of sperm head has activated injected egg mother cell effectively and has reached full growth, and finishes up to growth.The embryo who is growing can transfer in surrogate mother's acceptor and grow by the program that the people that this field is familiar with know.The head of sperm can maybe can strengthen a kind of reagent that its activates egg mother cell with heating be handled, and in this case, egg mother cell is responsive to activator and is easy to induced development after the microinjection.Sperm can derive from amphibian, fish, birds (as tame chicken, turkey, goose or the like) or mammal such as primate, sheep, ox, pig, bear, goat, pig, dog, horse, mouse or the like.

Method of the present invention also allow to inject move pipe the tip diameter in a big scope.Transgenic method does not in the past allow the DNA of a big fragment to import (for example, when using viral vectors) or can allow the DNA of so big fragment to import yet, but sizable technical difficulty is all arranged.For example preceding cell nucleus microinjection is inapplicable for full-bodied artificial chromosome preparation.It is difficult injecting with suction pipe perfect in workmanship (tip diameter 1-2 μ m), and dna molecular usually is sheared, and leads to the failure.And so narrow tip can become more viscous after using several times, the processing difficulty that will become.By contrast, the used common diameter＞5 μ m of tip that move pipe that the method for this invention is described, big relatively tip diameter (ⅰ) makes that the processing of viscosity dna solution is much easier, partly cause is that the viscosity of those pins is little, (ⅱ) produced the shearing force of less magnitude simultaneously, the damage that big dna molecular causes shearing force is responsive.

The further advantage of this inventive method is that it does not require that those materials are injected into accurate position in the egg cell, and this point is different from the pronucleus microinjection.This advantage especially contains abundant lipid for those egg mother cell cytoplasm and observe unclear source of species particularly suitable under light microscope, have the species of commercial value or the egg mother cell of kind just to belong to this type as many, therefore the method for this invention do not require the tip of microinjection and during the microinjection the cytoplasm of the egg mother cell that will accurately the understand relation on having living space.

The method of this invention also allows do not injecting the injection of changeing basic gene nucleic acid under the nuclear situation altogether.In one embodiment, metastatic gene nucleic acid at first mixes with the composition that those can stablize nucleic acid, and these compositions comprise composition as the basic protein that derives from sperm (for example nucleoprotamine, perinuclear composition or the like).In this case, injection is to enter a nucleolate cell.Such cell has been explained somatic or other the egg mother cell institute illustration of metaphase in cell division II of a stoning of cell nucleus shift-in of cell by metaphase in cell division II egg mother cell (available in this case embryo be gynecogenic) or by nuclear transplantation.Nuclear transplantation is at Wakayama, T., Perry, A.C.F., Johnson, K., Zuccotti, M.﹠amp; Yanagimachi introduces among the R.Nature 394,369 (1998).In report, the embryo obtains by vegetative propagation.Egg mother cell is according to known method, with some as Sr ²⁺, ethanol or the such stimulus of electric pulse carry out artificial stimulation, and germinate, but be not limited only to these methods.III. the cell that allows to obtain is grown

Move on under the suitable condition of culture or move on in suitable surrogate mother's body in vitro recombination through the cell of microinjection, can both grow.In some cases, we wish that cultured cell goes to develop into an embryo.In the further embodiment of this invention, it can check that those are cultured in external embryo, and the growth of these fetuses just can be described and the expression of metastatic gene just can be determined like this.Therefore, if contain a metastatic gene among the genetically modified embryo, and being expressed in of this metastatic gene can be detected under the situation of not killing the embryo, and so, the method for this invention allows that transgenic embryo is carried out selectivity and shifts.The example that a GFP green fluorescent protein is arranged here, being expressed among the early stage embryo of it is driven, and just the actin promoter with CME-IE enhancer/chicken is associated in together.Its expression mainly just can be easy to detect by observe the embryo under long wave (480nm) uviol lamp.These infringements farthest reduce to be exposed to the latent lesion of long wave ultraviolet, because can damage embryo's subsequently growth to the embryo.

The method of embryo culture and transfer is known for the people who is familiar with this field.After subsequently selection or non-selected embryo (just not necessarily based on the expression of metastatic gene) transfer in surrogate mother's body, begin to become pregnant, until last transgenic progeny birth of living.Metastatic gene is incorporated into offspring's evaluation, mainly genomic DNA is carried out physical analysis and finishes, and used method is to comprise Southem hybridization and the such well-known process for being familiar with this people from field of polymerase chain reaction (PCR).The expression of transgenosis in the offspring can be distinguished out, or be hybridized such analytical method of utilizing mRNA by the histogenic immunity analysis or with phase Northem as a characteristic attribute (phenotype ground).The expression of GFP green fluorescent protein in the transgenosis pup is easy to be found out by the fur of checking new birth offspring under long wave ultraviolet.Example

Following Example is intended to the method for this invention of illustrations under the situation of this scope of invention without limits.Reagent

Used compound if not otherwise stated all available from Sigma chemistry Co., Ltd (StLouis, MO).Animal

Egg mother cell contributor (B6D2F1), sperm donors (B6D2F1), surrogate mother (foster mother) raise (ICR) and carry out under the guidance of University of Hawaii's experimental animal service department.These surrogate mothers (foster mother) be by experimental resources the National Research Council laboratory animal love and use that the committee members of institute prepare (DHEWpublication no.[NIH] 80-23, revision in 1985, the handling procedure of animal have obtained the examination and the agreement of the University of Hawaii's animal love and the committee of application.The preparation of egg mother cell

Dispensing 5IU people's human chorionic gonadtropin (hCG) back is 14.5-16 hour in peritonaeum, just can collect the egg mother cell of maturation from the oviduct of female B6D2F1 mouse (5IU) of pregnant mare serum guiding, superovulation, 4-10 age in week.A large amount of cells of accumulation can be by (the CZB buffer solution contains 20mM HEPES, PH7.4 in CZB-H; Chatot, C.L., Lewis, J.L; Torres I.﹠amp; Ziomek, C.A.Biology ofReprochuction 42,432[1990]) handle immediately, at room temperature put dispersion in 5-10 minute, in CZB-H, contain 0.1% (w/v) bull testis hyaluronidase (300U/mg, ICN Biochemicals, Costa Mesa, CA).The egg mother cell that does not accumulate is washed in (CZB-H) four times and is transferred to one and drops in 37 ℃, 5% (v/v is in air) CO ₂Among the CZB under the mineral oil of middle balance, (Squibb ﹠amp; Sons, Princeton, NJ).Ovum of mouse and embryo's operation:

The piezoelectricity of sperm head activates microinjection and enters the ovum of mouse once at (Kimura Y.﹠amp; Yanagimachi narrated among the R.Biology of Reproduction 52,709 (1995).Usually 18-19 hour is done behind human chorionic gonadtropin (hCG) dispensing in injection.Entry needle needle point diameter is 5 μ m normally.The solution (containing single sperm head usually) of experiment usefulness is excluded at small amounts of mercury and is sucked into suction pipe after entering the experimental solutions drop.Guaranteed like this to be full of suction pipe, and therefore do not needed further dilution in the front on mercury border experimental solutions.The archiblast that the corresponding thing of each nearly 1pl of microinjection is fertilized by shift-in.Injected egg mother cell is moving on to 37 ℃, 5% (in the v/v air) CO ₂Before the CZB below the mineral oil of middle balance, in operation medium (CZB-H), keep about 2-10 minute.Keep suitable when time in operation is cultivated, egg mother cell carries out the artificial activation by incubation immediately after injection, and incubation is at 37 ℃, 5% (v/v is in air) CO ₂Do not contain Ca below the mineral oil of balance ²⁺And contain 6.7mM SrCl ₂CZB in about 45-60 minute.After this, ovum washes in fresh CZB roughly, is moved to then among the fresh CZB and continues incubation.The embryo is in CZB in external cultivation, needs 4 days.Bicellular embryo (after cultivating about 1 day) or mulberry body/blastocyst (cultivating after 2.5-3.5 days) are transplanted in the ICR/CD1 mouse oviduct of false pregnancy albino, and this mouse is in the male wister rat mating of the same strain of that night of microinjection and a vasectomy.By the mouse that is born at manipulation in vitro the such feature of the eyes of black and colored fur has just been arranged like this.

Example 1

The preparation and the microinjection of spermoblast nuclear

As previously mentioned, separation and the cultivation that is used to carry out the B6D2F1 mouse cell II metaphase egg cell of microinjection is necessary.Sperm is to be collected into from the B6D2F1 male wister rat of maturation in the 400 μ l CZB medium.(composition is (NIM): 125mM KCl, 2.6mM NaCL, 7.8mM Na in 0-1 ℃ cell nucleus separation and Culture ₂HPO ₄, 1.4mM KH ₂PO ₄, 3.0mM EDTA; PH7.45) utilize triton X-100 extracting to carry out the separation of sperm, accurately downcut the epididymis of two afterbodys.Filter the sperm suspensions that those were handled, constant volume is 900 μ l to final volume.The piezoelectricity of egg mother cell activates microinjection and at 37 ℃, 5% (in the v/v air) CO ₂Embryo's cultivation was described in detail elsewhere among the CZB below the mineral oil of middle balance.For microinjection, sperm head is sucked into a suction pipe, and the element of that suction pipe and a Piezoelectric Driving suction pipe links to each other, and sperm of per injection enters egg mother cell.The egg mother cell of very fast cracking is lost after injection.In due course, to the sperm stage casing, sperm has produced by the displacement of afterbody to head by a single piezoelectricity impulse action.Therefore this program that is shifted itself has been destroyed cell membrane, has represented used " fresh " sperm and the difference of the sperm of the work that can improve transgene efficiency by the inseminatio externalis acquisition in the report in the past here.We estimate that the sperm of the nearly 1pl of per injection is transferred in suction pipe.

Example 2

Make the cell nucleus of sperm be exposed to green fluorescent protein by mixing

Or in the beta galactosidase transfer nucleic acid: the generation of transgenic embryo

Here usefulness is the big SalG I-BamH I segment of pCX-EGFP plasmid, and it has kept the gene of GFP green fluorescent protein, is united by actin enhancer-promotor of a strong CMV-IE/ chicken and drive to express.(Niwa, H., Yamamura, K.﹠amp; Miyazaki, J.Gene 108,193[1991]), but lack Eukaryotic duplicate field (Zhang, G.Vamessa, G.﹠amp; Kain, S.R.Biochemical and Biophysical ResearchCommunication 227,707[1996]; Takada, T.Iida, K.Awaji, T.Itoh, K.Takahashi, R.Shibui, A.Sugano, S.﹠amp; Tsujimoto, G.Nature Biotechnology 15,458[1997]).The cell nucleus of sperm or further do not prepare (" fresh ") and and the pCX-EGFP segment mix, or they have carried out after three of destroying in the cell membrane program, ability and pCX-EGFP mix, these three programs are respectively: multigelation (Wakayama, T., Whittingham, D.G.﹠amp; Yanagimachi, R.Journal of Fertility andReproduction 112,11[1998]), freeze drying (Wakayama, T.﹠amp; Yanagimachi, R.NatureBiotechnology l6,639[1998]) or the TritonX-100 extracting.For utilizing the TritonX-100 extracting, on ice, 100 μ l 0.5% (v/v at NIM, separate nucleic acid medium) Triton X-100 was added in the sperm suspensions of 900 μ l in NIM (separate nucleic acid medium) (seeing example 1), by ground and mixed 30 seconds.20,000g, centrifugal 1 minute, cell is precipitated to become granule, and 2 ℃, abundant resuspension deposit seed in the NIM (separate nucleic acid medium) of 2 μ l ice precooling, 2 ℃, 20, precipitate 2 minutes more again under the 000g.This final deposit seed is at 400 μ l, among CZB or the NIM by resuspension.Before microinjection, the dna segment of 1 μ l and 9 μ l sperm suspensions (are contained 2-5 * 10 with suction pipe ⁵Individual sperm) mix in CZB or NIM, the ultimate density that makes dna fragmentation is 7ng/ μ l.The mixture of DNA/ sperm was cultivated 1 minute in room temperature (about 25 ℃) or on ice.Polyvinylpyrrolidone (PVP, mean molecule quantity MR 360,000) solution is mixed to about the ultimate density 10% (v/v) of PVP then, it is placed on carries out microinjection on the microstat.All injections all are to mix in 1 hour or the mixing of sperm-Triton X-100 is done in CZB-H in room temperature in 1 hour at sperm-DNA.

After microinjection 3-3.5 days, check the expression of GFP green fluorescence egg among the embryo with the epifluorescence microscope of the ultraviolet source of being with FITC filter (480nm).So just can be to (non--GFP-express) of non-fluorescence, hypofluorescence with the hyperfluorescence embryo and inlay embryo's (cell that contains fluorescence and non-fluorescence) and identify clearly, correspondingly make and judge record.Be used to illustration and explain a different metastatic gene nucleic acid of the similar experiment of this inventive method.The fragment that contains LacZ among the purifying pxCANLacZ is carried out linearisation by SalG I or Xho I and the digestion of SalG I, then with sperm respectively with 4.5 and the concentration of 9ng/ul mix, as previously described, carry out microinjection.Two LacZ (β-gala enzyme glycoside enzyme gene) fragment all obtains similar result.PxCANLacZ xho I-SalG I fragment lacks an Eukaryotic duplicate field.Contained a cell nucleus framing signal by the coded beta galactosidase of pxCANLacZ.After embryo's preliminary treatment 3 days, at room temperature, at PBS (phosphate buffer, PH7.6) fix 5 minutes in, just can carry out the evaluation of pxCANLacZ beta galactosidase expression, wherein the PBS prescription is: 1% (v/v) formaldehyde, 0.2% (v/v) glutaraldehyde, 5mg/ml bovine serum albumin (BSA).Fixing embryo is thoroughly cleaned in the PBS buffer solution that contains BSA (5mg/ml), then at 37 ℃, is containing 5mg/mlBSA, the 4mM potassium ferricyanide, 4mM potassium ferrocyanide, 2mM MgCl ₂With dye among the PBS of 1mg/ml 5-bromo-4-chloro-3-indoles-β-D-galactose (x-gal).The embryo can check and judges record by light microscope.

Result has in the following Table 1 shown that the method for this invention has produced genetically modified embryo with high efficient, when pXC-EGTP dna fragmentation concentration is 500pg/ μ l, but when not being 50pg/ μ l, this method just can produce can be observed the embryo that expresses of metastatic gene.This shows that this method is responsive for the average dna concentration that is equivalent to the few like this molecule of about per injection 15-150.

The egg mother cell of table one metaphase in cell division II and the coding reporter gene DNA of external source and sperm head

Microinjection produces embryo's the culture in vitro and the expression production of metastatic gene altogether

In the time of three days mulberry body-blastocyst and fluorescence (GFP) or

The total fragment of the LacZ of dyeing ⁺Sperm is handled ⁺ ₊Egg mother cell quantity m-b (%) ^*-§+/-§+ ^*§ pCX-EGFP does not have (fresh) 162 134 (83) ^a100 13 21apCX-EGFP Triton X-100 270 212 (79) ^a75 37 100bpCX-EGFP freeze thawing 313 155 (50) ^b28 31 96bpCX-EGFP freeze dryings 278 154 (55) ^b20 23 111bpx-CANLacZ freeze thawing 151 110 (73) ^a7 45 58bpx-CANLacZ freeze dryings 136 106 (78) ^a8 32 66bpCX-EGFP washed 153 114, (75) ° of 43 4 67 ° pCX-EGFP do not wash 117 83, (71) ° 17 3 63 ° of pCX-EGFP freeze thawing 71 56, (79) 56 0 0pCX-EGFP freeze thawing 51 35, (69) 35 0 0pCX-EGFP independent-49 48, (98) 48 00

^*When being illustrated in the numerical value that indicates a, b in the same row and being compared, they have notable difference (P＜0.05), and the numerical value that indicates c does not have significant difference in same row.

+ expression exogenous dna fragment pCX-EGFP-BamHI-SalGI or pxCANLacZ-SalGI, SalGI-XhoI, or Xho I fragment when DNA concentration is 5-10ng/l and sperm head mix, except last triplex row (seeing routine X), foreign DNA is all mixing the back injection with sample of sperm, as described in example 2.

⁺ ₊Sperm is handled as described in example 1.Clean with the preparation of not cleaning sample and as described in example 4, finish, as negative control, all experiments comprise that all mixture that the prepared product of the suitable sperm that a five equilibrium is fresh and NIM or CZB mix separately carries out injection on the same day, does not observe " positive of mistake " and expresses.Every pair of continuous injection be spaced apart 30-90 minute, the preparation of sperm head adopts as the described freeze-thaw method of routine X (the freeze thawing sperm in advance and DNA mix, carry out on the same day positive control and inject (ovum) blastomere of generation fluorescence in 75% embryo altogether.)。The injection of metastatic gene DNA is carried out after parthenogenesis activates separately, as described in routine X.The § metastatic gene is expressed :-negative nothing is expressed; + the positive has expression; +/-, m-b contain+and-cell (chimera).

Example 3

In an operation, carry out double base gene GFP green fluorescent protein and beta galactosidase embryo's preparation

(" single-shot double transgenesis " transgenic method)

Shown in example 1, singles' two transgenic methods (single-shot double transgenesis) are used for producing the embryo of two metastatic genes of coexpression and change subsequently thereof after single microinjection.Sperm head is injected altogether with the dna solution that contains 2.5ng/ μ l pCX-EGFP SalGI-BamHI fragment and 2.5ng/ μ l pCX-LacZ SalGI-PstI fragment.PCX-LacZ is the EGFP gene derivative of beta-galactosidase gene after replacing that be encoded among the pCX-EGFP.In ensuing culture in vitro, the embryo at first is recorded and observes the GFP expression, is the coding beta-galactosidase expression of gene then, as described in example 1, example 2 difference.For photography, before fixing and dyeing went to observe the LacZ expression, the embryo should be fixed between microscopical slides and the cover glass, and such image of seeing has just shown the expression of growth and GFP fluorescin.

Example 4

Behind flushing metastatic gene nucleic acid-cell nucleus mixture, GFP green fluorescent protein metastatic gene embryo's generation

In each flushing experiment, sperm suspensions mixed with pCX-EGFP DNA and incubation is divided into the equal portions of two 5 μ l immediately after 1 minute.The fresh CZB of the usefulness 50 μ l ice precooling that equal portions wherein (sperm that washed) are fully mixed or NIM dilute and wash.Then, two equal portions are at 2 ℃, and 20, centrifugal formation deposit seed is 2 minutes under the condition of 000g.The supernatant of the aliquot of that part sperm of being washed is carefully removed, and CZB or the NTM fresh with 5 μ l replace; The supernatant of second equal portions be used to suspend again its deposit seed (this sample is not rinsed like this).Result in the table 1 shows that significantly cell nucleus and nucleic acid are in the ability of external combination before microinjection.

Example 5

Generation and the confirmation of GFP green fluorescent protein metastatic gene pup, and the confirmation of their transgenosis characteristics

Determine whether the gene integration of metastatic gene dna structure, can in the offspring who lives, be proved.Being subjected to three kinds of heads that destroy a kind of ruinate sperm in the cell membrane program is injected altogether with pCX-EGFP DNA, the embryo who obtains is externally being reached about 3.5 days by cultivation (reach mulberry body-blastocyst period), and the embryo then is transplanted to nonselective surrogate mother and goes up (promptly not based on luciferase expression).The phenotype analytical of integrating for metastatic gene is undertaken by under long wave ultraviolet the offspring being observed.The offspring that very most of (17-21%) arranged is genetically modified, because the expression (below table 2) of observable GFP green fluorescent protein is arranged on their skin; This efficient does not depend on the method that cell membrane destroys when being used to prepare sperm.The head of the sperm that the full percentage of zygote and other three groups of cell membranes destroy each (12-14%) is comparable.

(green) pup genetically modified on table two phenotype and their compatriot's growth sperm is handled ^*Egg mother cell quantity transforms

The sum of pup ⁺(green) pup ^§Freeze drying 116 67 (4) 14 3 ^aFreeze thawing 97 53 (3) 12 2 ^aFreeze drying 218 150 (9) 31 6 ^a

^*Every row has write down the embryo that produces and the growth of pup from the egg mother cell that head and pCX-EGFP plasmid fragment of the sperm of striping are injected altogether.

^aExpression numerical value does not have significant difference.

: mulberry body-blastocyst.In the quantity as the surrogate mother of an acceptor in the embryo shifts of the numeric representation in the bracket.

§ Tg expresses, ⁺, the positive pup of GFP gene is expressed on dystopy ground on their skin.

In further experiment, the sperm head of a striping is exposed to pCX-LacZ (seeing example 3) according to the method for example 2 and carries out microinjection, and pup that a sweet enzyme of single beta galactose (LacZ) is expressed afterwards has been born.According to the method for example 2, the expression of the sweet enzyme of beta galactose (LacZ) can confirm (acquisition in back 3 days of being born) by living tissue fixing and a tail point of X-gal dyeing.This is not limited to the type of a metastatic gene with regard to the method that has proved this invention, and has shown the application power of this method to various metastatic genes.

From the biological tissue of the tail point of the pup of the same brood of the pup of the green of the random choose in age in 3-6 week and their non-green, carry out the extraction of genome DNA.The photograph of afterbody is to carry out at a fluorescent and stereo microscopically of being furnished with the 480/40nm optical filtering.In Southem analyzes, the pCX-EGFP fragment probe hybridization of the 733bp that 10 μ g genomic DNAs digest with EcoR I digestion back with the EcoR I in each sample.Oligomerization nucleic acid primer is used in each reaction and 1 μ g genomic DNA carries out the PCR reaction, and to detect the GFP gene, the primer of forward reaction is: TTGAATTCGCCACCATGGTGAGC, reverse primer is: TTGAATTCTACTTGTACAGCTCGTCC.Response parameter is 95 ℃, 9 minutes (circulation); 94 ℃, 45 seconds, 60 ℃, 30 seconds, 72 ℃, 45 seconds (40 circulations).The product of electrophoretic separation can be observed by EB (ethidium bromide) dyeing.

Genomic physical analysis shows to the tail point by Southem hybridization and PCR (polymerase chain reaction (PCR)), the person's of foundation strain of all demonstration green fluorescences (first generation transgenic animal just), all have metastatic gene, comprise that an initial phenotypic evaluation is negative, but the inspection of its living tissue tail point shows have GFP to express.Under three kinds of situations, metastatic gene should identify by PCR, can detected green fluorescence because do not have among the person of foundation, promptly, cause not seeing the expression in the supposition owing on the locus that metastatic gene is integrated, exist the element of cis activity partly.Southem the analysis showed that the copy number scope of metastatic gene in the person of foundation is from≤1-＞50; The pattern that metastatic gene is integrated after the same cell nucleus microinjection of this result is similar.The efficient that the record of genomic pCX-EGFP DNA physical features and GFP express has shown that all metastatic gene DNA does not reset on a large scale when integrating.

(8 female, and 4 male for the person of foundation of 12 expression of random choose GFP; Derive from table 2 and similar series) and not genetically modified animal hybridize.Except one female, remaining has all produced the offspring.In these 11 persons of foundation that produce offsprings, there is the pup of 8 generations that the ectopic expression of GFP green fluorescent protein is arranged on their skin, ratio is 27-50% (average out to 40%).。In most of the cases, the hereditary pattern of the metastatic gene Mendel that meets unit point GFP gene to plant be that heredity is transmitted.

Example 6

Detect transgenosis with the Cre-lox system

Owing to there is no need the continuous in life metastatic gene of transgenosis individuality is expressed, we wish to estimate the embryo who is used for the metastatic gene integration by the method generation of this invention.This can realize with a carrier that contains (IRES) metastatic gene of internal ribosome entry site.By microinjection generation embryo's method, as described in example 1.The structure of DNA includes the GFP gene, and it is positioned at side, lox site, is united to drive by actin enhancer-promotor of a strong CMV-IE/ chicken and expresses, as described in example 2.It is adjacent that this enhancer-promotor and being enough to drives second element that the sequencing of any given metastatic gene expresses.It is adjacent that framework is read in the open opening of reading a framework and a specific metastatic gene of GFP, and the centre is separated by an IRES (internal ribosome entry site).The sperm of a metastatic gene DNA structure and a striping mixes and common injection enters in the egg mother cell of metaphase in cell division II, this egg mother cell derives from the strain system as the express recombinant enzyme Cre under the control of goosrcoid gene promoter, this promotor worked in primitive gut (embryo) the formation stage of growing, and therefore will excise actin enhancer-promoter element of CMV-IE/ chicken during this stage.The embryo reaches 3.5 days (to mulberry body-blastocyst stage) in culture in vitro and selectively is transplanted in surrogate mother's body (fluorescence is just arranged) and reaches full growth.

The microinjection of example 7 metastatic gene DNA under the situation that does not have spermoblast nuclear shows that the cell nucleus composition of sperm is with heavy

The form of group gene is kept metastatic gene DNA

Whether the nucleic acid integration can appear at (just after the microinjection) in the egg mother cell in order to detect, and we have injected the head and the pCX-EGFP DNA of sperm continuously, but does not mix (table 1) before injection.We can not observe the expression of external source metastatic gene DNA (GFP) all the time, even be (head of freeze thawing sperm and pCX-EGFP inject altogether with table 1 is the same) that fluorescence is arranged the embryo of 75% positive control.

The fresh dilution of the SalG I of plasmid pCX-EGFP-BamH I fragment and the 20%PVP (w/v) of equivalent mix, and the egg mother cell of each injection is approximately 1pl.After at room temperature recovering 5-10 minute, egg mother cell is transferred to and does not contain Ca ²⁺CZB in, in CZB, contain 10mM SrCl ₂With the division of cytoplasm sealer, cytochalasin B (5 μ g/ml), 37 ℃ of incubations 6 hours.(Bos-Mikich,A.,Whittingham,D.G&Jones,K.T.Developmental?Biology?182,172[1997])。They then are moved among the CZB, continue to cultivate under the embryo's of standard culture condition.As described in example 2, after 3.5 days, the embryo just can judge the expression that has or not GFP.With the altogether comparison of injection of head, only be that the GFP metastatic gene injection of equivalent does not hinder gynecogenic good growth (egg mother cell of surviving have 98% grow the one blastocyst stage of mulberry body) after injection with sperm.And neither one demonstrates the expression (table 1) of observable metastatic gene among these resultful embryos.Therefore, under the situation of the head that does not have sperm, almost there are not the expression of metastatic gene or the chromosomal lasting existence of epi-position of transcriptional activity metastatic gene DNA.

After the head-pCX-EGFP of sperm injects altogether, rather than the pCX-EGFP dna single is solely after the injection, and we have observed the chimeric embryo of the schizocyte that contains positive GFP and negative GFP (+/-mulberry body one blastocyst).Like this+/-chimeric frequency is delayed up to injection back for the first time S-phase metastatic gene and just integrates when showing being integrated with of DNA.An explanation of this phenomenon is, derives among the material embryo in early days of sperm to have stablized foreign DNA, therefore helps postponing to integrate.Under the situation that lacks such material (for example, in parthenogenesis), foreign gene DNA just had been degraded before integrating.

Claims

1. method of producing transgenic cell comprises following steps:

(a) cell nucleus of exposed cell is in nucleic acid (NA);

(b) collect the cell nucleus that was exposed;

(c) cell nucleus of Bao Luing has at least a part to be inserted into an egg mother cell, and this part comprises and being exposed

Nuclear chromosome, also comprise the part of nucleic acid at least;

(d) growth of permission egg mother cell.

2. method of producing transgenic cell comprises following steps:

(a) expose a cell nucleus in nucleic acid (NA);

(b) collect the cell nucleus that is exposed in the step (a);

(c) cell nucleus that is exposed has at least a part to insert non-nucleus egg mother cell, and this part comprises and being exposed

Nuclear chromosome, also comprise the part of nucleic acid at least;

(d) growth of permission egg mother cell.

3. in the method for claim 1 or 2, cell nucleus extracts from a complete biological cell

4. in the method for claim 1 or 2, cell nucleus extracts from an embryo.

5. in the method for claim 1 or 2, cell nucleus extracts from a fetal cell.

6. in any one method of aforesaid claim, cell nucleus extracts from mammalian cell.

7. in any one method of aforesaid claim, cell nucleus is to adopt the suction pipe of microinjection to collect.

8. in any one method of aforesaid claim, cell nucleus is by with nucleic acid and contain nucleolate all or part of mixing with cells and be exposed to nucleic acid.

9. in any one method of aforesaid claim, cell nucleus enters a complete cell by guiding nucleic acid and is exposed to nucleic acid.

10. in any one method of aforesaid claim, cell nucleus extracts from an individual cells.

11. in any one method of aforementioned claim 1 to 9, cell nucleus is in the gamete precursor.

12. in any one method of aforementioned claim 1 to 9, cell nucleus is in the gamete.

13. in the method for claim 12, gamete comprises an egg mother cell.

14. in the method for claim 12, gamete comprises a sperm.

15. a method of producing transgenic cell comprises following steps: (a) expose a sperm in nucleic acid (NA); (b) collect the sperm be exposed, (c), comprise the chromosome of sperm and comprise that further the part of nucleic acid is inserted in the egg mother cell at least the part of sperm at least; (d) allow egg mother cell to grow.

16. in the method for claim 14 or 15, the cell membrane of sperm is destroyed.

17. in the method for claim 16, the method for destruction comprises freezing.

18. in the method for claim 16, the method for destruction comprises mechanical damage.

19. in the method for claim 16 or 17, the method for destruction comprises and being exposed in the cleaning agent.

20. in the method for claim 19, cleaning agent is a nonionic.

21. in the method for claim 19, cleaning agent is an ionic.

22. in the method for claim 19, cleaning agent is TritonX-100.

23. in any one method of claim 14 to 22, sperm enters the part or all of nucleic acid (NA) that is exposed to that contains nucleolate sperm by guiding nucleic acid.

24. in any one method of claim 14 to 23, sperm is exposed to nucleic acid (NA) by nucleic acid and the part or all of mixing that contains nucleolate sperm.

25. in any one method of claim 14 to 24, sperm is mammiferous sperm.

26. in the method for claim 6 or 25, mammal is by one in the set that comprises primate, sheep, ox, pig, bear, goat, cat, dog, horse and mouse.

27. in the method for claim 9 or 23, the step of guiding can be by realizing such as the such method of lipofection, microinjection, electroporation and transfection.

28. in the method for claim 9 or 23, the step of guiding can be to realize by mixing.

29. in the method for claim 28, what mix usefulness is the tip of a suction pipe.

30. a method of producing transgenic cell comprises following steps:

(a) insert nucleic acid and enter an egg mother cell;

(b) activation embryo's growth;

(c) embryonic development of permission reorganization.

31. in any one method of aforesaid claim, nucleic acid (NA) is DNA (deoxyribonucleic acid) (DNA).

32. in the method for claim 31, DNA contains double-stranded composition.

33. in any one method of claim 31 to 32, DNA is annular.

34. in any one method of claim 31 to 33, DNA is linear.

35. in any one method of claim 31 to 34, DNA contains a reporter gene.

36. in the method for claim 35, a reporter gene coding green fluorescent protein (GFP).

37. in any one method of claim 35 to 36, the promoter element that the expression of coding reporter gene DNA is worked in early days the embryo drives.

38. in any one method of claim 35 to 37, reporter gene is positioned in (IRES) on the carrier that contains an internal ribosome binding site.

39. in claim 38 method, internal ribosome entry site (IRES) carrier comprises a subclone coded sequence.

40. in any one method of claim 35 to 39, reporter gene comprises which promoter element of having carried at lox site flank.

41. in any method of claim 40, that promoter element of lox site flank links to each other with a tissue-specific promotor.

42. in any one method of claim 32 to 41, DNA is the target structure that has with natural complementary gene group sequence homology reorganization ability.

43. in the method for claim 42, target structure contains the one or more change of relative natural gene group sequence.

44. in any one method of claim 32 to 43, DNA is a chromosome.

45. in the method for claim 44, chromosome is an artificial chromosome.

46. in the method for claim 45, artificial chromosome is the artificial chromosome (BAC) of a bacterium.

47. in the method for claim 45, artificial chromosome is the artificial chromosome (YAC) of a yeast.

48. in the method for claim 45, artificial chromosome is a mammiferous artificial chromosome (MAC).

49. in any one method of claim 32 to 48, DNA contains the composition of a strand.

50. in any one method of claim 32 to 49, DNA is by the covalent modification mistake.

51. in the method for claim 50, DNA is comprised a peptide moiety by covalent modification.

52. in any one method of claim 1 to 31, nucleic acid is ribonucleic acid (RNA).

53. in the method for claim 52, RNA (ribonucleic acid) contains a double-stranded composition.

54. in the method for claim 52, RNA (ribonucleic acid) contains a strand composition.

55. in any one method of claim 52 to 54, RNA (ribonucleic acid) is annular.

56. in any one method of claim 52 to 54, RNA (ribonucleic acid) is linear.

57. in any one method of claim 52 to 56, RNA (ribonucleic acid) is crossed by covalent modification.

58. in the method for claim 57, RNA (ribonucleic acid) is crossed by covalent modification and is contained a peptide moiety.

59. in any one method of claim 1 to 31, nucleic acid (NA) is chimeric.

60. in the method for claim 59, chimera contains the DNA-RNA heteroduplex.

61. in the method for claim 60, chimeric DNA-RNA heteroduplex is the chimera that comprises at least one base mismatch.

62. in any one method of aforementioned claim, nucleic acid (NA) comprises the species of a plurality of molecules that do not have covalently bound mistake in advance.

63. in any one method of aforementioned claim, exposed at least 30 seconds for nucleic acid (NA).

64. in any one method of aforementioned claim, nucleic acid (NA) exposes under 0-100 ℃ of condition.

65. in any one method of aforementioned claim, nucleic acid (NA) is exposing on ice.

66. in any one method of aforementioned claim, nucleic acid (NA) exposes under the condition that nucleic acid binding protein exists.

67. in the method for claim 66, nucleic acid (NA) improves reorganization in conjunction with albumen.

68. in the method for claim 67, the protein that can improve reorganization is to extract from the constituent of the recombinase of the site-specific recombinase of following composition, single-stranded DNA binding protein, rna binding protein, reverse transcriptase, topoisomerase, endonuclease and raising homologous recombination.

69. in any one method of aforementioned claim, inserting step is to enter in the cytoplasm of egg mother cell.

70. in any one method of aforementioned claim, inserting step is finished by microinjection.

71. in the method for claim 70, microinjection is that piezoelectricity activates microinjection.

72. in any one method of aforementioned claim, egg mother cell is repressed in II meiosis metaphase (met II).

73. in the method for claim 72, the egg mother cell of metaphase in cell division II is collected after ovulation.

74. in the method for claim 73, ovulation is by manually inducing.

75. in any one method of aforementioned claim, egg mother cell is ripe.

76. in the method for claim 75, immature egg mother cell is in culture in vitro.

77. in the method for claim 75 or 76, produced the egg mother cell of metaphase in cell division II at the immature egg mother cell of culture in vitro.

78. in any one method of aforementioned claim, also be included in during the inserting step or cause the step of egg mother cell activation afterwards.

79. in the method for claim 76, egg mother cell activates in the activator by using one or more electric pulses or being exposed to.

80. in any one method of aforementioned claim, further may further comprise the steps:

(e), allow egg mother cell to grow and form stem cell.

81. in any one method of aforementioned claim, further may further comprise the steps:

(f), allow egg mother cell to grow and form noble cells.

82. in the method for claim 81, further may further comprise the steps:

(g), allow egg mother cell to grow and form the embryo.

83. in the method for claim 82, further may further comprise the steps:

(h), allow embryonic development to finish until last growth.

84. in the method for claim 83, allow embryonic development to comprise until last full step and shift that embryo to one female acting on behalf of on the acceptor, there, embryonic development becomes a fetus that can survive.

85. many transgenic cells that the method by aforementioned claim is produced.

86. produce a kind of transgenic animal by the method for aforementioned claim.

87. in claim 86, animal refers to a mammal.

88. in claim 87, animal is from choosing by comprising the mammiferous set that primate, sheep, ox, pig, bear, goat, cat, dog, horse and mouse or the like are formed.

89. in claim 87, mammal is a mouse.

90. any one method by claim 1 to 84 is produced transgenic animal, at this, transgenic animal contain a site-specific genomic change.