CN1314486A - New polypeptide-human histidinacyl-tRNA sythetase 85 and polynucleotide for coding such polypeptide - Google Patents

Abstract

The present invention discloses a new kind of polypeptide, human histidyl-tRNA sythetase 85, polynucleotides for encoding this polypeptide and by DNA recombination process to produce the polypeptide. The present invention also discloses the method of applying the polypeptide in treating various diseases, such as malignant tumor, development disorder, inflammations, immunological diseases, hemopathy and HIV infection. The present invention also discloses the antagonist resisting the polypeptide and its treatment effect. The present invention also discloses the application of the polynucleotides for encoding human histidyl-tRNA sythetase 85.

Description

The polynucleotide of a kind of new polypeptide--people's Histidyl-tRNA synthetase 85 and this peptide species of coding

The invention belongs to biological technical field, specifically, the invention describes a kind of new polypeptide--people's Histidyl-tRNA synthetase 85, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.

In the translation process of mRNA, tRNA plays the function that the codon of mRNA and corresponding amino acid are mapped.There is no structural dependency between anticodon on the tRNA molecule amino acid corresponding with it; and tRNA itself can not the corresponding amino acid whose load of catalysis, is catalytic by aminoacyl-tRNA synthetase with tRNA with the reaction that corresponding amino acid combines.

The reaction of the synthetic aminoacyl-tRNA of aminoacyl tRNA synthetase was divided into for two steps: amino acid at first activates into aminoacyl adenylate, and afterwards, aminoacyl adenylate generates aminoacyl-tRNA with tRNA again.Aminoacyl-tRNA synthetase is discerned different tRNA by " paracodon " on the tRNA molecule, so that correct amino acid and tRNA are combined.

Each amino acid all corresponding a kind of aminoacyl-tRNA synthetase, therefore, 20 seed amino acids just have 20 kinds of different aminoacyl-tRNA synthetases.But these 20 kinds of aminoacyl-tRNA synthetases are related each other.Different according to structure and sequence, 20 kinds of aminoacyl-tRNA synthetases can be divided into two classes, I class and II class.I zymoid catalysed partial contains the folding skeleton that constitutes of Rossmann, and this is a kind of nucleic acid calmodulin binding domain CaM; II zymoid skeleton then is made of a kind of new antiparallel folding.The II class comprises Histidyl-tRNA synthetase etc.

Aminoacyl-tRNA synthetase provides the available aminoacyl-tRNA of synthetic protein.If certain aminoacyl-tRNA synthetase disappearance can cause corresponding aminoacyl-tRNA correctly not form, cause the early stopping of crossing of synthetic protein process, form the albumen that does not have function.If certain aminoacyl-tRNA synthetase is undergone mutation; discern another kind of amino acid; then the protein of Xing Chenging comprises incorrect aminoacid sequence; if this variation occurs on the amino acid sites crucial concerning this proteinic function; the protein of Xing Chenging can not correctly fold and not have function so; perhaps miopragia or enhancing perhaps changed the substrate of effect and its function changed.Variation on this function usually causes disease.

For example, in people's tumour of 25%-30%, the Ras albumen that notes abnormalities, 12 point mutation that obtain 61 residues at Ras have replaced Xie Ansuan by glycine, the activity that suppresses the GTP enzyme of Ras itself and GAP stimulation, therefore can not be that Ras-GTP is transformed into Ras-GDP, cause Ras to be in active condition for a long time, the signal of granting downstream that does not stop, cause the abnormality proliferation of cell, thereby cause the generation of cancer.The letter sorting of probable protein and the malfunction of parasecretion and membrane receptor etc. are gone back in the sudden change of aminoacyl-tRNA synthetase, cause various endocrinopathys, disease of immune system, neuromuscular system disease etc.

Analysis by gene chip is found, in the Ecv304 cell strain of the Ecv304 of thymus gland, testis, muscle, spleen, lung, skin, Tiroidina, liver, PMA+ cell strain, PMA-, not hungry L02 cell strain, L02 cell strain and prostata tissue that arsenic stimulates 1 hour, polypeptide expression spectrum of the present invention is very approximate with the express spectra of Histidyl-tRNA synthetase, so the two function also may be similar.The present invention is named as people's Histidyl-tRNA synthetase 85.

Because people's Histidyl-tRNA synthetase 85 albumen play an important role in regulating body critical functions such as cell fission and fetal development as mentioned above, and believe and relate to a large amount of albumen in these regulate processes, thereby need to identify people's Histidyl-tRNA synthetase 85 albumen of more these processes of participation in this area always, particularly identify this proteic aminoacid sequence.The separation of new person's Histidyl-tRNA synthetase 85 protein coding genes also provides the foundation for determining the effect of this albumen under healthy and morbid state.This albumen may constitute the basis of 1 sick diagnosis of exploitation disease and/or curative, and it is very important therefore separating its coding DNA.

An object of the present invention is to provide isolating new polypeptide--people's Histidyl-tRNA synthetase 85 with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of this polypeptide of coding.

Another object of the present invention provides the recombinant vectors of the polynucleotide that contain coding people Histidyl-tRNA synthetase 85.

Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain coding people Histidyl-tRNA synthetase 85.

Another object of the present invention provides the method for producing people's Histidyl-tRNA synthetase 85.

Another object of the present invention provides at polypeptide of the present invention--the antibody of people's Histidyl-tRNA synthetase 85.

Another object of the present invention has provided at polypeptide of the present invention--the simulated compound of people's Histidyl-tRNA synthetase 85, antagonist, agonist, inhibitor.

Another object of the present invention provides the method for the unusual relevant disease of diagnoses and treatment and people's Histidyl-tRNA synthetase 85.

The present invention relates to a kind of isolated polypeptide, this polypeptide is the people source, and it comprises: polypeptide or its examples of conservative variations, bioactive fragment or derivative with SEQ ID No.2 aminoacid sequence.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.

The invention still further relates to a kind of isolating polynucleotide, it comprises a kind of nucleotide sequence or its variant that is selected from down group:

(a) coding has the polynucleotide of the polypeptide of SEQ ID No.2 aminoacid sequence;

(b) with polynucleotide (a) complementary polynucleotide;

(c) with (a) or polynucleotide sequence (b) have the polynucleotide of at least 70% homogeny.

More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 157-2484 position among the SEQ ID NO:1; (b) has the sequence of 1-2981 position among the SEQ ID NO:1.

The present invention relates to a kind of carrier that contains polynucleotide of the present invention, particularly expression vector in addition; The host cell that this carrier of a kind of usefulness is genetically engineered comprises the host cell of conversion, transduction or transfection; A kind of method for preparing polypeptide of the present invention of cultivating described host cell and reclaiming expression product that comprises.

The invention still further relates to a kind of can with polypeptid specificity bonded antibody of the present invention.

The invention still further relates to a kind of simulation, activation, antagonism of screening or suppress the method for the compound of people's Histidyl-tRNA synthetase 85 protein-actives, it comprises and utilizes polypeptide of the present invention.The invention still further relates to the compound that obtains with this method.

The invention still further relates to a kind of vitro detection and express the relevant disease or the method for disease susceptibility with people's Histidyl-tRNA synthetase 85 abnormal proteins, comprise the sudden change in polypeptide described in the detection of biological sample or its coded polynucleotide sequence, perhaps the amount or the biological activity of polypeptide of the present invention in the detection of biological sample.

The present invention also relates to a kind of pharmaceutical composition, it contains polypeptide of the present invention or its stand-in, activator, antagonist or inhibitor and pharmaceutically acceptable carrier.

The invention still further relates to polypeptide of the present invention and/or polynucleotide and be used for the treatment of cancer, developmental character disease or immunological disease or other purposes owing to the medicine of people's Histidyl-tRNA synthetase 85 diseases that abnormal expression causes in preparation.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

The following term of using in this specification sheets and claims has following implication unless stated otherwise:

" nucleotide sequence " is meant oligonucleotide, Nucleotide or polynucleotide and fragment or part, also can refer to genome or synthetic DNA or RNA, and they can be strand or two strands, represent sense strand or antisense strand.Similarly, term " aminoacid sequence " is meant oligopeptides, peptide, polypeptide or protein sequence and fragment or part.When " aminoacid sequence " among the present invention related to a kind of aminoacid sequence of naturally occurring protein molecule, this " polypeptide " or " protein " did not mean that aminoacid sequence are restricted to the complete natural amino acid relevant with described protein molecule.

Protein or polynucleotide " variant " are meant a kind of polynucleotide sequence that has the aminoacid sequence of one or more amino acid or Nucleotide change or encode it.Described change can comprise disappearance, insertion or the replacement of amino acid in aminoacid sequence or the nucleotide sequence or Nucleotide.Variant can have " conservative property " and change, and wherein the amino acid of Ti Huaning has structure or the chemical property similar with original acid, as replacing Isoleucine with leucine.Variant also can have non-conservation and change, as replacing glycine with tryptophane.

" disappearance " is meant the disappearance of in aminoacid sequence or nucleotide sequence one or more amino acid or Nucleotide.

" insertion " or " interpolation " is meant that the change in aminoacid sequence or nucleotide sequence causes comparing the increase of one or more amino acid or Nucleotide with naturally occurring molecule." replacement " is meant by different amino acid or Nucleotide and replaces one or more amino acid or Nucleotide.

" biological activity " is meant the protein of structure, regulation and control or biochemical function with natural molecule.Similarly, term " immunologic competence " be meant natural, reorganization or synthetic protein and fragment thereof in suitable animal or cell, induce specific immune response and with specific antibody bonded ability.

" agonist " is meant when combining with people's Histidyl-tRNA synthetase 85, thereby a kind of this protein that causes changes the molecule of regulating this protein active.Agonist can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of people's Histidyl-tRNA synthetase 85.

" antagonist " or " inhibition " is meant when combining with people's Histidyl-tRNA synthetase 85, a kind of sealing or the biologic activity of mediator's Histidyl-tRNA synthetase 85 or the molecule of immunologic competence.Antagonist and inhibition can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of people's Histidyl-tRNA synthetase 85.

" adjusting " is meant that the function of people's Histidyl-tRNA synthetase 85 changes, and comprises the change of any other biological property, function or the immune property of the change of the rising of protein active or reduction, binding characteristic and people's Histidyl-tRNA synthetase 85.

" pure basically " is meant and is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying people Histidyl-tRNA synthetase 85 of standard.Basically pure people's Histidyl-tRNA synthetase 85 can produce single master tape on the irreducibility polyacrylamide gel.The purity available amino end acid sequence of people's Histidyl-tRNA synthetase 85 polypeptide is analyzed.

" complementary " or " complementation " is meant under salt concn that allows and temperature condition by the natural combination of the polynucleotide of base pairing.For example, sequence " C-T-G-A " can combine with complementary sequence " G-A-C-T ".Complementation between two single chain molecules can be part or whole.Complementary degree between the nucleic acid chains has a significant effect for efficient of hybridizing between the nucleic acid chains and intensity.

" homology " is meant the complementary degree, can be portion homologous or complete homology." portion homologous " is meant a kind of part complementary sequence, and it can partly suppress the hybridization of complete complementary sequence and target nucleic acid at least.The inhibition of this hybridization can detect by hybridizing (Southern trace or Northern trace etc.) under the condition that reduces in the severity degree.Basically homologous sequence or hybridization probe can compete and suppress complete homologous sequence and target sequence the condition that reduces of severity degree under combine.This does not mean the conditions permit non-specific binding that the severity degree reduces because the conditional request two sequences that the severity degree reduces mutual be combined into specificity or selectivity interacts.

" homogeny percentage " be meant two or more amino acid or nucleotide sequence relatively in the same or analogous percentage of sequence.The available electron method is measured the homogeny percentage, as passing through MEGALIGN program (Lasergenesoftwa re package, DNASTAR, Inc., Madison Wis.).The MEGALIGN program can compare two or more sequences (Higgins, D.G. and P.M.Sharp (1988) Gene 73:237-244) according to diverse ways such as Cluster method.The Cluster method is organized the series arrangement cluster by checking the distance between all pairings with each.Then with each bunch with in pairs or become set of dispense.Homogeny percentage between two aminoacid sequences such as sequence A and the sequence B calculates by following formula: the residue number of mating between sequence A and the sequence B

100

Interval residue number in the residue number-sequence B of interval in the residue number-sequence A of sequence A

Also can be by the Cluster method or with the homogeny percentage (Hein J., (1990) Methods in emzumology 183:625-645) between known method in this area such as the Jotun Hein mensuration nucleotide sequence.

" similarity " is meant the degree that the identical or conservative property of corresponding position amino-acid residue when arranging contrast between the aminoacid sequence replaces.For example be used for amino acid that conservative property replaces, electronegative amino acid can comprise aspartic acid and L-glutamic acid; Positively charged amino acid can comprise Methionin and arginine; Having uncharged head group has similar hydrophilic amino acid can comprise leucine, Isoleucine and Xie Ansuan; Glycine and L-Ala; L-asparagine and glutamine; Serine and Threonine; Phenylalanine and tyrosine.

" antisense " is meant and specific DNA or RNA sequence complementary nucleotide sequence." antisense strand " is meant and " sense strand " complementary nucleic acid chains.

" derivative " is meant HFP or encodes its chemical modification object of nucleic acid.This chemical modification object can be with alkyl, acyl group or the amino hydrogen atom of replacing.The nucleic acid derivative codified keeps the polypeptide of the main biological characteristics of natural molecule.

" antibody " is meant complete antibody molecule and fragment thereof, as Fa, F (ab ') ₂And Fv, its energy specificity is in conjunction with the antigenic determinant of people's Histidyl-tRNA synthetase 85.

" humanized antibody " is meant that the aminoacid sequence in non-antigen binding domain territory is replaced and becomes more similar to people's antibody, but still keep original in active antibody.

" isolating " speech refers to material is shifted out among its original environment (for example, if spontaneous its natural surroundings that just refers to).Such as it is exactly not to be separated that spontaneous polynucleotide or polypeptide are present in the Live Animals, but same polynucleotide or polypeptide with some or all in natural system with it the material of coexistence separately be exactly isolating.Such polynucleotide may be the parts of a certain carrier, the part that also possible such polynucleotide or polypeptide are a certain composition.Since carrier or composition are not the compositions of its natural surroundings, they remain isolating.

As used herein, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

As used herein, " isolating people's Histidyl-tRNA synthetase 85 " is meant that people's Histidyl-tRNA synthetase 85 is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying people Histidyl-tRNA synthetase 85 of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of people's Histidyl-tRNA synthetase 85 polypeptide can be used amino acid sequence analysis.

The invention provides a kind of new polypeptide--people's Histidyl-tRNA synthetase 85, it is made up of the aminoacid sequence shown in the SEQ IDNO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analogue of people's Histidyl-tRNA synthetase 85.As used herein, term " fragment ", " derivative " and " analogue " are meant biological function or the active polypeptide that keeps people's Histidyl-tRNA synthetase of the present invention 85 identical basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) is a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, 00 derivative and analogue are considered within those skilled in the art's ken.

The invention provides isolating nucleic acid (polynucleotide), substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 2981 bases, its open reading frame 157-2484 775 amino acid of having encoded.Find relatively that according to gene chip expression spectral this polypeptide has similar express spectra to Histidyl-tRNA synthetase, deducibility goes out this people's Histidyl-tRNA synthetase 85 and has the similar function of Histidyl-tRNA synthetase.

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.

The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.

The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, " nucleic acid fragment " length contain 10 Nucleotide at least, better be 20-30 Nucleotide at least, be more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding people Histidyl-tRNA synthetase 85.

Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.

The special polynucleotide sequence of coding people Histidyl-tRNA synthetase 85 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.

Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.

In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration people Histidyl-tRNA synthetase 85; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.

In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect the protein product of people's Histidyl-tRNA synthetase 85 genetic expressions and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with the carrier of the present invention or Histidyl-tRNA synthetase 85 encoding sequences of directly choosing, and the method that produces polypeptide of the present invention through recombinant technology.

Among the present invention, the polynucleotide sequence of coding people Histidyl-tRNA synthetase 85 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.

Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains coding people Histidyl-tRNA synthetase 85 and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, aLaboratory Manual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The P of lambda particles phage _LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, the polynucleotide of coding people Histidyl-tRNA synthetase 85 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Alternative is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce people's Histidyl-tRNA synthetase 85 (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:

(1). with the polynucleotide (or varient) of everybody Histidyl-tRNA synthetase 85 of coding of the present invention, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;

(2). in suitable medium, cultivate host cell;

(3). separation, protein purification from substratum or cell.

In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat malignant tumour, adrenal gland defect, tetter, all kinds of inflammation, HIV infection and immunological disease etc.

In proteic translation process, aminoacyl-tRNA synthetase catalysis tRNA combines with corresponding amino acid.Histidyl-tRNA synthetase catalysis Histidine combines with corresponding tRNA.If it is unusual that Histidine provides in albumen is synthetic, can cause the variation of protein synthesis, and then it is unusual that biological function is taken place, even cause disease.

The sudden change of Histidyl-tRNA synthetase also may make the malfunction of proteinic letter sorting and parasecretion and membrane receptor etc., causes various endocrinopathys, disease of immune system, neuromuscular system disease etc.Polypeptide expression spectrum of the present invention is consistent with the express spectra of people's Histidyl-tRNA synthetase, and both have similar biological function.It participates in proteic translation in cell synthetic, and its abnormal expression can make protein synthesis unusual, and protein function is got muddled, and produce relevant disease.

This shows that the abnormal expression of people's Histidyl-tRNA synthetase 85 of the present invention will produce the especially various tumours of various diseases, fetal development disorders, dysplasia disease, inflammation, immunological disease, these diseases include but not limited to:

The tumour of various tissues: cancer of the stomach, liver cancer, lung cancer, the esophageal carcinoma, mammary cancer, leukemia, lymphoma, thyroid tumor, hysteromyoma, neurocytoma, astrocytoma, ependymoma, glioma, neurofibroma, colorectal carcinoma, melanoma, bladder cancer, uterus carcinoma, carcinoma of endometrium, colorectal carcinoma, thymus neoplasms, nasopharyngeal carcinoma, laryngocarcinoma, tracheal neoplasm, fibroma, fibrosarcoma, lipoma, liposarcoma

Fetal development disorders: congenital miscarriage, cleft palate, deficiency of skeletal limb, limbs dysdifferentiation, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness

The dysplasia disease: mental retardation, cerebral dysgenesis, skin, fat and amyoplasia disease, B﹠J dysplasia disease, various metabolic defects, cretinism, nanism, emerging comprehensive this in storehouse levied the slow disease of sexual development

Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, multiple sclerosis, glomerulonephritis, myocarditis, myocardosis, atherosclerosis, stomach ulcer, trachelitis, various infective inflammations

Immunological disease: systemic lupus erythematous, rheumatoid arthritis, bronchial asthma, urticaria, atopic dermatitis, infect back myocarditis, scleroderma, myasthenia gravis, Green-barre syndrome, common variable immunodeficient disease, primary bone-marrow-derived lymphocyte immunodeficient disease, acquired immune deficiency syndrome (AIDS)

The abnormal expression of people's Histidyl-tRNA synthetase 85 of the present invention also will produce some heredity, blood disease etc.

The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat the especially various tumours of various diseases, fetal development disorders, dysplasia disease, inflammation, immunological disease, some heredity, blood disease etc.

The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) people Histidyl-tRNA synthetase 85.Agonist improves people's Histidyl-tRNA synthetase 85 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can in the presence of medicine, the film preparation of mammalian cell or expressing human Histidyl-tRNA synthetase 85 be cultivated with people's Histidyl-tRNA synthetase 85 of mark.Measure the medicine raising then or check this interactional ability.

The antagonist of people's Histidyl-tRNA synthetase 85 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of people's Histidyl-tRNA synthetase 85 can combine and eliminate its function with people's Histidyl-tRNA synthetase 85, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.

In screening during as the compound of antagonist, people's Histidyl-tRNA synthetase 85 can be added in the bioanalysis mensuration, interactional influence between people's Histidyl-tRNA synthetase 85 and its acceptor be determined whether compound is antagonist by measuring compound.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with people's Histidyl-tRNA synthetase 85 bonded peptide molecules obtains.During screening, generally tackle people's Histidyl-tRNA synthetase 85 molecules and carry out mark.

The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at people's Histidyl-tRNA synthetase 85 antigenic determinants.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

Can the choose method of Histidyl-tRNA synthetase 85 direct injection immune animals (as rabbit, mouse, rat etc.) of the production of polyclonal antibody obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of the monoclonal antibody of preparation people Histidyl-tRNA synthetase 85 include but not limited to hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.4946778) also can be used for producing the single-chain antibody of anti-people's Histidyl-tRNA synthetase 85.

The antibody of anti-people's Histidyl-tRNA synthetase 85 can be used in the immunohistochemistry technology, detects the people's Histidyl-tRNA synthetase 85 in the biopsy specimen.

With the also available labelled with radioisotope of people's Histidyl-tRNA synthetase 85 bonded monoclonal antibodies, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people's Histidyl-tRNA synthetase 85 high-affinities can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing people's Histidyl-tRNA synthetase 85 positive cells.

The disease that antibody among the present invention can be used for treating or prevention and people's Histidyl-tRNA synthetase 85 are relevant.The antibody that gives suitable dosage can stimulate or block the generation or the activity of people's Histidyl-tRNA synthetase 85.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization people Histidyl-tRNA synthetase 85 levels.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.People's Histidyl-tRNA synthetase 85 levels that detected in the test can be with laying down a definition the importance of people's Histidyl-tRNA synthetase 85 in various diseases and be used to the disease of diagnosing people's Histidyl-tRNA synthetase 85 to work.

Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.

The polynucleotide of coding people Histidyl-tRNA synthetase 85 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of people's Histidyl-tRNA synthetase 85 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for people's Histidyl-tRNA synthetase 85 of expressing variation, to suppress endogenic people's Histidyl-tRNA synthetase 85 activity.For example, a kind of people's Histidyl-tRNA synthetase 85 of variation can be the people's Histidyl-tRNA synthetase 85 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of 85 expression of people's Histidyl-tRNA synthetase or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding people Histidyl-tRNA synthetase 85 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding people Histidyl-tRNA synthetase 85 is found in existing document (Sambrook, et al.).The polynucleotide of reorganization coding people Histidyl-tRNA synthetase 85 can be packaged in the liposome and be transferred in the cell in addition.

Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

Suppress the oligonucleotide (comprising sense-rna and DNA) of people's Histidyl-tRNA synthetase 85 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.

The polynucleotide of coding people Histidyl-tRNA synthetase 85 can be used for the diagnosis with the relative disease of people's Histidyl-tRNA synthetase 85.The unconventionality expression of the expression that the polynucleotide of coding people Histidyl-tRNA synthetase 85 can be used for detecting people's Histidyl-tRNA synthetase 85 people's Histidyl-tRNA synthetase 85 whether or under morbid state.As the dna sequence dna of the people's Histidyl-tRNA synthetase 85 of encoding can be used for biopsy specimen is hybridized to judge the expression situation of people's Histidyl-tRNA synthetase 85.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Personnel selection Histidyl-tRNA synthetase 85 special primers carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect people's Histidyl-tRNA synthetase 85.

The sudden change that detects people's Histidyl-tRNA synthetase 85 genes also can be used for diagnosing the relevant disease of people's Histidyl-tRNA synthetase 85.The form of people's Histidyl-tRNA synthetase 85 sudden change comprises that the point mutation compared with normal wild type people Histidyl-tRNA synthetase 85DNA sequence, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.

Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.

The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.

Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.People's Histidyl-tRNA synthetase 85 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to people's Histidyl-tRNA synthetase 85 of patient will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.

Fig. 1 is the gene chip expression spectral comparison diagram of inventor's Histidyl-tRNA synthetase 85 and Histidyl-tRNA synthetase.Last figure is the express spectra folding side figure of people's Histidyl-tRNA synthetase 85, and the below sequence is the express spectra folding side figure of Histidyl-tRNA synthetase.

Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating people's Histidyl-tRNA synthetase 85.85KDa is proteinic molecular weight.The arrow indication is isolated protein band.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Embodiment 1: the clone of people's Histidyl-tRNA synthetase 85

Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure all clones' 5 ' and 3 ' terminal sequence with Dyeterminate cycle reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0558f08 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0558f08 clone is 2981bp (shown in Seq ID NO:1), from 157bp to 2484bp the open reading frame (ORF) of a 2328bp, the new protein (shown in Seq ID NO:2) of encoding arranged.We are with this clone's called after pBS-0558f08, and the name of encoded protein matter is people's Histidyl-tRNA synthetase 85.Embodiment 2: with the gene of RT-PCR method clones coding people Histidyl-tRNA synthetase 85

Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:

Primer1:5’-GATGGACAGAATGATATCTTTTGG-3’(SEQ?ID?NO:3)

Primer2:5’-AATAAAAAGTCCTTTATTTCATAT-3’(SEQ?ID?NO:4)

Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;

Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.

The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/LTris-Cl, (pH8.5), 1.5mmol/L MgCl ₂, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-2981bp shown in the SEQ ID NO:1 are identical.Embodiment 3:Northern blotting analyst Histidyl-tRNA synthetase 85 expression of gene:

Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ gRNA, on 1.2% sepharose that contains 20mM3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²P dATP prepares by random priming ³²The dna probe of P-mark.Used dna probe is people's Histidyl-tRNA synthetase 85 coding region sequences (157bp to 2484bp) of pcr amplification shown in Figure 1.Probe (about 2 * 10 with the 32P-mark ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.Embodiment 4: the vivoexpression of recombinant human Histidyl-tRNA synthetase 85, separation and purifying

According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:

Primer?3:5’-CATGCTAGCATGCTGGACATGTGGATTGGTGAA-3’(Seq?ID?No:5)

Primer?4:5’-CATGGATCCTTAAAGAAATGAAGTGGGAGCTGC-3’(Seq?ID?No:6)

5 ' end of these two sections primers contains Nhe I and BamH I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, Nhe I and BamH I restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0558f08 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0558f08 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with Nhe I and BamH I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0558f08) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0558f08) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product), has obtained the target protein people Histidyl-tRNA synthetase 85 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 85KDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 5 anti-people's Histidyl-tRNA synthetase 85 production of antibodies

Synthesize following people's Histidyl-tRNA synthetase 85 specific polypeptide with Peptide synthesizer (PE company product):

NH2-Met-Leu-Asp-Met-Trp-Ile-Gly-Glu-Thr-Ala-Ile-Pro-Cys-Thr-Pro-COOH(SEQ?ID?NO:7)。Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with people's Histidyl-tRNA synthetase 85 specifically.Embodiment 6: polynucleotide passage of the present invention is as the application of hybridization probe

Picking out suitable oligonucleotide fragment from polynucleotide of the present invention is of use in many ways as hybridization probe, as can whether containing polynucleotide sequence of the present invention and detect the homologous polynucleotide sequence to identify it with the healthy tissues of different sources or the genome or the hybridization of cDNA library of pathological tissue with this probe, whether further also available this probe in detecting polynucleotide sequence of the present invention or the expression of its homologous polynucleotide sequence in healthy tissues or pathological tissue cell be unusual.

The purpose of present embodiment is to pick out suitable oligonucleotide fragment as hybridization probe from polynucleotide SEQ ID NO:1 of the present invention, and identifies in some tissues whether contain polynucleotide sequence of the present invention or its homologous polynucleotide sequence with the filter hybridization method.The filter hybridization method comprises dot blotting, Southern blotting, Northern blotting and copy method etc., and they all are that polynucleotide sample to be measured is fixed on use essentially identical step crossover in back on the filter membrane.These identical steps are: the filter membrane of having fixed sample at first carries out prehybridization with the hybridization buffer that does not contain probe, so that nonspecific combining site suppressed by vector of sample and synthetic polymer institute are saturated on the filter membrane.Prehybridization solution is contained the hybridization buffer replacement of label probe then, and insulation makes probe and target nucleic acid hybridization.After the hybridization step, the probe in the hybridization is not removed by a series of film steps of washing.Present embodiment utilizes the film condition of washing (as than low salt concn and higher temperature) of higher-strength, so that hybrid context reduces and only keep the signal of high specificity.The probe that present embodiment is selected for use comprises two classes: first kind probe be fully with the identical or complementary oligonucleotide fragment of polynucleotide SEQ ID NO:1 of the present invention; The second class probe is part and the identical or complementary oligonucleotide fragment of polynucleotide SEQ ID NO:1 of the present invention.Present embodiment selects for use dot blotting that sample is fixed on the filter membrane, higher-strength wash under the film condition, the hybridization specificity of first kind probe and sample is the strongest and kept.One, probe selects for use

From polynucleotide SEQ ID NO:1 of the present invention, select oligonucleotide fragment as hybridization probe, the several aspects that should follow following principle and need to consider: 1, the probe size preferable range is a 18-50 Nucleotide; 2, GC content is 30%-70%, and surpassing then, non-specific hybridization increases; 3, probe interior should not have complementary region; 4, what meet above condition can be used as the primary election probe, further do the computer sequential analysis then, comprise this primary election probe is carried out homology relatively with its source sequence area (being SEQ ID NO:1) and other known genome sequence and complementary district thereof respectively, if with the homology in non-target molecule zone greater than 85% or there are 15 continuous bases of surpassing identical, then this primary election probe is general just should not use; 5, whether the primary election probe finally is chosen to be the probe of actual application value also should further be determined by experiment.

Select and synthetic following two probes after finishing the analysis of above each side:

Probe 1 (probe1) belongs to first kind probe, with the complete homology of gene fragment or complementation (41Nt): the 5 '-TGCTGGACATGTGGATTGGTGAAACTGCTATTCCTTGTACT-3 ' (SEQ ID NO:8) of SEQ ID NO:1

Probe 2 (probe2) belongs to the second class probe, is equivalent to gene fragment or its complementary segmental replacement mutant nucleotide sequence (41Nt) of SEQ ID NO:1:

5’-TGCTGGACATGTGGATTGGTCAAACTGCTATTCCTTGTACT-3’(SEQ?ID?NO:9)

Other unlisted common agents and the compound method thereof relevant with following concrete experimental procedure please refer to document: DNA PROBES G.H.Keller; M.M.Manak; Stockton Press, 1989 (USA) and molecular cloning laboratory manual books more commonly used are as works such as " molecular cloning experiment guide " (second edition in 1998) [U.S.] Sa nurse Brooker, Science Press.

Specimen preparation: 1, from fresh or frozen tissue, extract DNA

Step: 1) the fresh or fresh normal liver tissue that thaws is put into the plate that is immersed on ice and fills phosphate buffered saline buffer (PBS).With scissors or scalpel tissue is cut into small pieces.Should keep organizing moistening in the operation.2) with 1000g centrifugal chopper tissue 10 minutes.3) with cooled homogenate damping fluid (0.25mol/L sucrose; 25mmol/LTris-HCl, pH7.5; 25mmol/LnaCl; 25mmol/L MgCl ₂) precipitation that suspends (approximately 10ml/g).4) 4 ℃ with electric homogenizer homogenate tissue suspension at full speed, until tissue by broken fully.5) 1000g is centrifugal 10 minutes.6) with re-suspended cell precipitation (the initial tissue sample of every 0.1g adds 1-5ml), centrifugal 10 minutes again with 1000g.7) with the resuspended precipitation of lysis buffer (the initial tissue sample of every 0.1g adds 1ml), connect following phenol extraction process then.2, the phenol extraction process of DNA

Step: 1) wash cell, centrifugal 10 minutes of 1000g with the cold PBS of 1-10ml.2) with the sedimentary cell (1 * 10 of cold cell pyrolysis liquid resuspension ⁸The minimum of applications 100ul lysis buffer of cell/ml).3) adding SDS is 1% to final concentration, if before re-suspended cell SDS is directly joined in the cell precipitation, cell may form big agglomerate and be difficult to fragmentation, and the overall yield that reduces.This point is in extracting＞10 ⁷Especially severe during cell.4) add Proteinase K to final concentration 200ug/ml.5) 50 ℃ of insulation reaction 1 hour or 37 ℃ gently jolting spend the night.6) use equal-volume phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting, in little centrifuge tube centrifugal 10 minutes.Two corresponding clear separation, otherwise carry out centrifugal again.7) water is transferred to new pipe.8) use the equal-volume chloroform: primary isoamyl alcohol (24: 1) extracting, centrifugal 10 minutes.9) water that will contain DNA is transferred to new pipe.Carry out purifying and the ethanol sedimentation of DNA then.3, the purifying of DNA and ethanol sedimentation

Step: 1) 1/10 volume 2mol/L sodium-acetate and 2 times of cold 100% ethanol of volume are added in the dna solution mixing.-20 ℃ of placements 1 hour or to spending the night.2) centrifugal 10 minutes.3) careful sucking-off or pour out ethanol.4) with 70% cold ethanol 500ul washing precipitation, centrifugal 5 minutes.5) careful sucking-off or pour out ethanol.With the cold washing with alcohol precipitation of 500ul, centrifugal 5 minutes.6) careful sucking-off or pour out ethanol is inverted on thieving paper then residual ethanol is flow to end.Dry air 10-15 minute, so that the volatilization of surperficial ethanol.Note not making the precipitation complete drying, otherwise dissolve again than difficulty.7) with small volume TE or the resuspended DNA precipitation of water.The low speed vortex vibrates or uses the dropper pressure-vaccum, increases TE gradually simultaneously, is mixed to DNA and fully dissolves, every 1-5 * 10 ⁶Cell extracted approximately adds 1ul.

Below the 8-13 step only be used for must removing when depolluting, otherwise can directly carry out the 14th step.8) RNA enzyme A is added in the dna solution, final concentration is 100ug/ml, and 37 ℃ are incubated 30 minutes.9) add SDS and Proteinase K, final concentration is respectively 0.5% and 100ug/ml.37 ℃ are incubated 30 minutes.10) use isopyknic phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extractive reaction liquid, centrifugal 10 minutes.11) carefully shift out water, use isopyknic chloroform: primary isoamyl alcohol (24: 1) extracting again, centrifugal 10 minutes.12) carefully shift out water, add 1/10 volume 2mol/L sodium-acetate and the cold ethanol of 2.5 volumes, mixing put-20 ℃ 1 hour.13) with 70% ethanol and 100% washing with alcohol precipitation, dry air, resuspended nucleic acid, process is with the 3-6 step.14) measure A ₂₆₀And A ₂₈₀To detect purity and the productive rate of DNA.15) deposit in-20 ℃ after the packing.The preparation of sample film:

1) get 4 * 2 suitably nitrocellulose filters (NC film) of size, mark point sample position and sample number thereon gently with pencil, each probe needs two NC films, so that wash film with high strength condition and strength condition respectively in the experimental procedure of back.

2) draw and contrast respectively 15 microlitres, put on the sample film, dry at room temperature.

3) place infiltration that 0.1mol/LNaOH is arranged, last 5 minute of filter paper (twice) of 1.5mol/LNaCl, drying to place to soak into has 0.5mol/L Tris-HCl (pH7.0), last 5 minute of filter paper (twice) of 3mol/LNaCl, dries.

4) be sandwiched in the clean filter paper, wrap, 60-80 ℃ of vacuum-drying 2 hours with aluminium foil.

The mark of probe

1) 3 μ 1Probe (0.10D/10 μ l) add 2 μ lKinase damping fluids, 8-10uCi γ- ³²P-dATP+2UKinase is to add to final volume 20 μ l.

2) 37 ℃ are incubated 2 hours.

3) add the tetrabromophenol sulfonphthalein indicator (BPB) of 1/5 volume.

4) cross Sephadex G-50 post.

5) to having ³²Before washing out, P-Probe begins to collect first peak (available Monitor monitoring).

6) 5/pipe, collect the 10-15 pipe.

7) monitor isotopic weight with liquid glimmer instrument

8) merge and to be required preparation behind the collection liquid of first peak ³²P-Probe (second peak for free γ- ³²P-dATP).

Prehybridization

The sample film is placed plastics bag, and adding 3-10mg prehybridization solution (10 * Denhardt ' s; 6 * SSC, 0.1mg/mlCT DNA (calf thymus DNA).), seal sack after, 68 ℃ of water-baths were shaken 2 hours.

Hybridization

Plastics bag is cut off one jiao, adds the probe prepare, seal sack after, 42 ℃ of water-baths are shaken and are spent the night.

Wash film: high strength is washed film:

1) good sample film has been hybridized in taking-up.

2) 2 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃.

3) 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃.

4) 0.1 * SSC among the 0.1%SDS, washes 30 minutes (2 times) for 55 ℃, and room temperature is dried.Low strength is washed film:

1) good sample film has been hybridized in taking-up.

2) 2 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 37 ℃.

3) 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 37 ℃.

4) 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃, and room temperature is dried.

X-light autography:

-70 ℃, X-light autography (the compressing tablet time decides according to hybridization spot radioactivity is strong and weak).

Experimental result:

Adopt low strength to wash the hybrid experiment that the film condition is carried out, more than two strong and weak not obviously differences of probe hybridization spot radioactivity; And adopting high strength to wash the hybrid experiment that the film condition is carried out, the hybridization spot radioactive intensity of probe 1 obviously is better than the radioactive intensity of another probe hybridization spot.Thereby available probe 1 is qualitative and analyze existence and the differential expression of polynucleotide of the present invention in different tissues quantitatively.Embodiment 7 DNA Microarray

Gene chip or gene micromatrix (DNA Microarray) are that present many National Laboratories and big drugmaker are all in the new technology of setting about developing and developing, it is meant and is arranged in a large amount of target fragments on the carriers such as glass, silicon in an orderly manner, to high-density, carry out the comparison and the analysis of data then with fluoroscopic examination and computer software, to reach purpose quick, efficient, that bioinformation is analyzed on high-throughput ground.Polynucleotide of the present invention can be used as target DNA and are used for biochip technology and are used for high-throughput and study new gene function; Seek and the new gene of the screening tissue specificity new gene of disease-related such as tumour particularly; The diagnosis of disease is as heredopathia.The existing in the literature multiple report of its concrete grammar step is as consulting document DeRisi, J.L., Lyer, V.﹠amp; Brown, P.O. (1997) Science278,680-686. and document Helle, R.A., Schema, M., Chai, A., Shalom, D., (1997) PNAS 94:2150-2155. () point sample

Various full-length cDNA amounts to 4000 polynucleotide sequences as target DNA, comprising polynucleotide of the present invention.They are increased by PCR respectively, behind the purifying gained amplified production its concentration is transferred to about 500ng/ul, (available from U.S. Cartesian company) puts on glass medium with Cartesian 7500 point sample instruments, and distance between points is 280 μ m.Slide behind the point sample is carried out hydration, drying, places UV-crosslinked instrument crosslinked, and the wash-out after drying is fixed on DNA and is prepared into chip on the sheet glass.The existing in the literature multiple report of its concrete grammar step, the point sample post-processing step of present embodiment is:

1. hydration 4 hours in the wet environment;

2.0.2%SDS washed 1 minute;

3.ddH ₂The O washed twice, each 1 minute;

4.NaBH ₄Sealed 5 minutes;

5.95 in ℃ water 2 minutes;

6.0.2%SDS washed 1 minute;

7.ddH ₂Twice of O flushing;

8. airing, 25 ℃ to be stored in the dark place standby.(2) probe mark

With the single stage method total mRNA of extracting from human body mixed structure and body particular organization (or through stimulated cells strain) respectively, and with Oligotex mRNA Midi Kit (available from QiaGen company) purified mRNA, by reverse transcription respectively with fluorescent reagent Cy3dUTP (5-Amino-propargyl-2 '-deoxyuridine 5 '-triphatecoupled to Cy3 fluorescent dye, available from Amersham Phamacia Biotech company) mRNA of mark human body mixed structure, with fluorescent reagent Cy5dUTP (5-Amino-propargyl-2 '-deoxyuridine5 '-triphate coupled to Cy5 fluorescent dye, available from Amersham Phamacia Biotech company) mRNA of mark body particular organization (or through stimulated cells strain), prepare probe after purified.Concrete steps reference and method are seen: Schena, M., Shalon, D., Heller, R. (1996) Proc.Natl.Acad.Sci.USA.Vol.93:10614-10619.Schena, M., Shalon, Dari., Davis, R.W. (1995) Science.270. (20): 467-480. (three) hybridization

Respectively will be from the probe of above two kinds of tissues with chip at UniHyb ^TMHybridized 16 hours in HybridizationSolution (available from the TeleChem company) hybridization solution, room temperature washings (1 * SSC, 0.2%SDS) the washing back is scanned with ScanArray 3000 scanners (available from U.S. General Scanning company), the image of scanning carries out data analysis with Imagene software (U.S. Biodiscovery company) to be handled, and calculates the Cy3/Cy5 ratio of each point.

Be respectively the Ecv304 cell strain of thymus gland, testis, muscle, spleen, lung, skin, Tiroidina, liver, PMA+, the Ecv304 cell strain of PMA-, not hungry L02 cell strain, L02 cell strain and the prostata tissue that arsenic stimulates 1 hour with upper machine body particular organization (or through stimulated cells strain).Draw folding side figure according to these 13 Cy3/Cy5 ratios.(Fig. 1).People's Histidyl-tRNA synthetase 85 of the present invention as seen from the figure is very similar with the Histidyl-tRNA synthetase express spectra.

Sequence table (1) general information:

(ⅱ) denomination of invention: people's Histidyl-tRNA synthetase 85 and encoding sequence thereof

(ⅲ) sequence number: the information of 9 (2) SEQ ID NO:1:

(ⅰ) sequence signature:

(A) length: 2981bp

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ⅱ) molecule type: cDNA

( ⅹⅰ ) ：SEQ ID NO:1: 1 GATGGACAGAATGATATCTTTTGGGATCAGAATTCTCCATTGACAAAGCAGTTAGGTAAA 61 GGAAGAAAAAAACAGATTTACACCACAGATAGTGATGAGATTTCACATATTGTTAATCGT121 ATTGCTCCTCAGGATGAAAAACCAACAACAAATTCTATGCTGGACATGTGGATTGGTGAA181 ACTGCTATTCCTTGTACTCCCAGTGTAGCAAAAGGAAAATCAAGAGCAAAAATCAGCTGC241 ACAAAGTTAAAAACACAAAGTCAAGAAGAAGAACTTATGAAACTGGCTAAACAATTTGAT301 AAAAATATGGAAGAGCTAGATGTGATTCAAGAGCAAAACAAGAGGAATTATGATTTTACC361 CAGATGATTTCAGAAACAGAGATTTTAAGTAATTATAAAGATAATATACAGATGTGGTCA421 TTACATAATATAGTTCCCGAAATAGATAATGCTACAAAAAAGCCAATCAAAGGAAACACC481 AAGATATCTGTGGCAAATAATCAAAATAGCAGTCAGAAGCCATTTGACCAAATTGCTGAA541 GCAGCCTTTAATGCTATTTTTGATGGTTCTACTCAGAAATGTAGCGGACAGTTAAGCCAA601 GAACTGCCAGAGGCTTTTTGGAGCACCAGTAATACTACCTTTGTAAAGACAAATGCTTTG661 AAAGAGGAGAAAATCATTACTAATGAAACTCTGGTCATTGAAAAACTGTCAAATAAAACC721 CCACGATCACTTTCTTCTCAAGTAGATACACCCATAATGACAAAATCATGTGTGACTTCC781 TGTACTAAGGAGCCAGAAACTTCTAATAAGTACATTGATGCATTTACTACAAGTGATTTT841 GAGGATGATTGGGAAAACTTACTAGGTAATGAACCTTTTGCTATGCAAAATATCGACATG901 CCTGAACTCTTTCCTTCTAAAACAGCCCATGTTACTGATCAAAAGGAAATTTGTACCTTT 961 AATAGTAAAACTGTTAAAAATACGTCAAGAGCAAATACAAGTCCAGATGCCAGGTTAGGA1021 GATTCAAAAGTATTACAAGATCTTTCTTCAAAGACATATGACAGAGAATTAATAGATGCA1081 GAATATAGATTTTCACCAAATTCAAATAAATCAAACAAATTATCCACTGGAAATAAAATG1141 AAATTTGAGAACTCTTCCAATAAAATTGTTATTCAAGACGAAATTCAAAATTGTATAGTT1201 ACATCTAATCTGACAAAAATAAAGGAAGATATTCTTACTAACTCTACTGAAGCTTCTGAA1261 AGGAAGTCAGCTTTGAACACAAGGTATTCTAATGAACAGAAAAATAAGTGCATTTTAAAT1321 CAGTCTATTAAAGCCCCTGTTAATACTGATCTTTTTGGCTCTGCAAATCTAGGCAGTAAA1381 ACCAGTGTTAGTAACCCAAATCAGACTAGTGCATCAAAAGTAGGTTCTTTCTTTGATGAT1441 TGGAATGATCCCTCATTTGCCAATGAAATTATTAAAGCATGTCATCAATTAGATAATACC1501 TGGGAAGCAGATGATGTAGATGATGATTTGTTGTACCAAGCATGTGATGATATTGAAAGA1561 CTAACTCAGCAACAAGACATTAGAAAGGACAGTAAGACATCAGAAAGTATATGTGAGATC1621 AATAATAATTCCGAACATGGAGCCAAACTAACTCAGCAACAAGACATTAGAAAGGACAGT1681 AAGACATCAGAAAGTATATGTGAGATCAATAATAATTCCAAACATGGAGCCAAAAACATG1741 TTTGCTATATCTAAACAAGGAAGTAATTTGGTACAATCAAAGCATTTGAATCCAGGCAGC1801 ATTTCAGTGCAGACATCTTTGACAAATAGCTCACAAATAGATAAGCCAATGAAGATGGAG1861 AAAGGGGAAATGTATGGAAATTCTCCAAGATTTTTAGGTGCCACAAATTTGACTATGTAT1921 TCTAAGATCTCAAACTGTCAGATAAATAATCTGCATGTGTCTTATACTAACACTGATGTT1981 CCAATACAAGTGAATAGTTCCAAATTGGTTCTTTCAGGAAGTTCAAGTTTGAATGTAACT2041 TCAGATCATATGAATACAGAAATTACTACTTATAAGAAGAAATTGAGTACTAATCAGCCA2101 TGCCATAAGACTGTAACAGATGAAGCTCAGAGCAACCTTAACACAACAGTTGGATTTTCA2161 AAGTTTACATTTACAAGGATGAAAAATTCTCAGATTCTTTCTCAGTTTAATCAAAATTGT2221 ATAACTGGAAGTATGTCTGATACCAAAATTACACAGGGTGTGGAGAAAAAGAAAGGTGTC2281 AACCCATTACTGGAGGAAGCTGTTGGACAGCAATCTTTGGTGAAACTTTCTGAATCTTTG2341 AAACAATCTTCAAAAGAGGAAGAAGAGAAAAATAGAAAGTGTTCTCCTGAAGAAATTCAG2401 AGAAAAAGACAAGAAGCACTGGTTCGGAGAATGGCTAAAGCACGAGCCTCATCTGTAAAT2461 GCAGCTCCCACTTCATTTCTTTAATGAAATATTAGTTGGAAGACTTCACAAAGACTGCTG2521 ATAACTATCTGTGATTGATAGGAAATTTTTTTTCTTGATTTCTCTGTGAGAAATGTAATG2581 CTGACTTTTATAAAGCCTGGACTTCTACTTTATTTAATAAATCAATGTTTGCAATGGTAA2641 ATGAAACATTTCCTTGGACATGTATTTGAAAGTCATTAAATACAAAAGTTTTGGAAATTC2701 AGGAAAGTTAGCAATTATGTACGGATATTATACAGAGGAAAGTAGTTATATTTTTAAATG2761 CTATTATTGCAGAGGATCATCAAAAAAGAGGTAATCTACGTTATTTCCTATTCTAATGTC2821 TTTTCCTAATAAAAAACTTCAACTTTCTAAGTTAGTAGAGACTGTTTTTGTAGTTTTACT2881 TTCATTAACTGTTGCTTAAGGTTTTTATACACTTCCAGATTTTAATTAATACTTTCATAT2941 TTCTAGGAACATGGTTGATATGAAATAAAGGACTTTTTATT

(3) information of SEQ ID NO:2:

(ⅰ) sequence signature:

(A) length: 775 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ⅱ) molecule type: polypeptide

( ⅹⅰ ) ：SEQ ID NO:2: 1 Met Leu Asp Met Trp Ile Gly Glu Thr Ala Ile Pro Cys Thr Pro 16 Ser Val Ala Lys Gly Lys Ser Arg Ala Lys Ile Ser Cys Thr Lys 31 Leu Lys Thr Gln Ser Gln Glu Glu Glu Leu Met Lys Leu Ala Lys 46 Gln Phe Asp Lys Asn Met Glu Glu Leu Asp Val Ile Gln Glu Gln 61 Asn Lys Arg Asn Tyr Asp Phe Thr Gln Met Ile Ser Glu Thr Glu 76 Ile Leu Ser Asn Tyr Lys Asp Asn Ile Gln Met Trp Ser Leu His 91 Asn Ile Val Pro Glu Ile Asp Asn Ala Thr Lys Lys Pro Ile Lys106 Gly Asn Thr Lys Ile Ser Val Ala Asn Asn Gln Asn Ser Ser Gln121 Lys Pro Phe Asp Gln Ile Ala Glu Ala Ala Phe Asn Ala Ile Phe136 Asp Gly Ser Thr Gln Lys Cys Ser Gly Gln Leu Ser Gln Glu Leu151 Pro Glu Ala Phe Trp Ser Thr Ser Asn Thr Thr Phe Val Lys Thr166 Asn Ala Leu Lys Glu Glu Lys Ile Ile Thr Asn Glu Thr Leu Val181 Ile Glu Lys Leu Ser Asn Lys Thr Pro Arg Ser Leu Ser Ser Gln196 Val Asp Thr Pro Ile Met Thr Lys Ser Cys Val Thr Ser Cys Thr211 Lys Glu Pro Glu Thr Ser Asn Lys Tyr Ile Asp Ala Phe Thr Thr226 Ser Asp Phe Glu Asp Asp Trp Glu Asn Leu Leu Gly Asn Glu Pro241 Phe Ala Met Gln Asn Ile Asp Met Pro Glu Leu Phe Pro Ser Lys256 Thr Ala His Val Thr Asp Gln Lys Glu Ile Cys Thr Phe Asn Ser271 Lys Thr Val Lys Asn Thr Ser Arg Ala Asn Thr Ser Pro Asp Ala286 Arg Leu Gly Asp Ser Lys Val Leu Gln Asp Leu Ser Ser Lys Thr301 Tyr Asp Arg Glu Leu Ile Asp Ala Glu Tyr Arg Phe Ser Pro Asn316 Ser Asn Lys Ser Asn Lys Leu Ser Thr Gly Asn Lys Met Lys Phe331 Glu Asn Ser Ser Asn Lys Ile Val Ile Gln Asp Glu Ile Gln Asn346 Cys Ile Val Thr Ser Asn Leu Thr Lys Ile Lys Glu Asp Ile Leu361 Thr Asn Ser Thr Glu Ala Ser Glu Arg Lys Ser Ala Leu Asn Thr376 Arg Tyr Ser Asn Glu Gln Lys Asn Lys Cys Ile Leu Asn Gln Ser391 Ile Lys Ala Pro Val Asn Thr Asp Leu Phe Gly Ser Ala Asn Leu406 Gly Ser Lys Thr Ser Val Ser Asn Pro Asn Gln Thr Ser Ala Ser421 Lys Val Gly Ser Phe Phe Asp Asp Trp Asn Asp Pro Ser Phe Ala436 Asn Glu Ile Ile Lys Ala Cys His Gln Leu Asp Asn Thr Trp Glu451 Ala Asp Asp Val Asp Asp Asp Leu Leu Tyr Gln Ala Cys Asp Asp466 Ile Glu Arg Leu Thr Gln Gln Gln Asp Ile Arg Lys Asp Ser Lys481 Thr Ser Glu Ser Ile Cys Glu Ile Asn Asn Asn Ser Glu His Gly496 Ala Lys Leu Thr Gln Gln Gln Asp Ile Arg Lys Asp Ser Lys Thr511 Ser Glu Ser Ile Cys Glu Ile Asn Asn Asn Ser Lys His Gly Ala526 Lys Asn Met Phe Ala Ile Ser Lys Gln Gly Ser Asn Leu Val Gln541 Ser Lys His Leu Asn Pro Gly Ser Ile Ser Val Gln Thr Ser Leu556 Thr Asn Ser Ser Gln Ile Asp Lys Pro Met Lys Met Glu Lys Gly571 Glu Met Tyr Gly Asn Ser Pro Arg Phe Leu Gly Ala Thr Asn Leu586 Thr Met Tyr Ser Lys Ile Ser Asn Cys Gln Ile Asn Asn Leu His601 Val Ser Tyr Thr Asn Thr Asp Val Pro Ile Gln Val Asn Ser Ser616 Lys Leu Val Leu Ser Gly Ser Ser Ser Leu Asn Val Thr Ser Asp631 His Met Asn Thr Glu Ile Thr Thr Tyr Lys Lys Lys Leu Ser Thr646 Asn Gln Pro Cys His Lys Thr Val Thr Asp Glu Ala Gln Ser Asn661 Leu Asn Thr Thr Val Gly Phe Ser Lys Phe Thr Phe Thr Arg Met676 Lys Asn Ser Gln Ile Leu Ser Gln Phe Asn Gln Asn Cys Ile Thr691 Gly Ser Met Ser Asp Thr Lys Ile Thr Gln Gly Val Glu Lys Lys706 Lys Gly Val Asn Pro Leu Leu Glu Glu Ala Val Gly Gln Gln Ser721 Leu Val Lys Leu Ser Glu Ser Leu Lys Gln Ser Ser Lys Glu Glu736 Glu Glu Lys Asn Arg Lys Cys Ser Pro Glu Glu Ile Gln Arg Lys751 Arg Gln Glu Ala Leu Val Arg Arg Met Ala Lys Ala Arg Ala Ser766 Ser Val Asn Ala Ala Pro Thr Ser Phe Leu ( 4 ) SEQ ID NO:3

(ⅰ) sequence signature

(A) length: 24 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:3:GATGGACAGAATGATATCTTTTGG 24 (5) SEQ ID NO:4

(ⅰ) sequence signature

(A) length: 24 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:4:AATAAAAAGTCCTTTATTTCATAT 24 (6) SEQ ID NO:5

(ⅰ) sequence signature

(A) length: 33 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:5:CATGCTAGCATGCTGGACATGTGGATTGGTGAA 33 (7) SEQ ID NO:6

(ⅰ) sequence signature

(A) length: 33 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:6:CATGGATCCTTAAAGAAATGAAGTGGGAGCTGC 33 (8) SEQ ID NO:7:

(ⅰ) sequence signature:

(A) length: 15 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ⅱ) molecule type: polypeptide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:7:Met-Leu-Asp-Met-Trp-Ile-Gly-Glu-Thr-Ala-Ile-Pro-Cys-Thr-Pro 15 (9) SEQ ID NO:8

(ⅰ) sequence signature

(A) length: 41 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: the information of SEQ ID NO:8:TGCTGGACATGTGGATTGGTGAAACTGCTATTCCTTGTACT 41 (10) SEQ ID NO:9

(ⅰ) sequence signature

(A) length: 41 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅹ ⅰ) sequence description: SEQ ID NO:9:TGCTGGACATGTGGATTGGTCAAACTGCTATTCCTTGTACT 41

Claims (18)

1, a kind of isolated polypeptide-people's Histidyl-tRNA synthetase 85 is characterized in that it includes: the polypeptide of the aminoacid sequence shown in the SEQ ID NO:2 or active fragments, analogue or the derivative of its polypeptide.

2, polypeptide as claimed in claim 1, the aminoacid sequence that it is characterized in that described polypeptide, analogue or derivative has the homogeny with the aminoacid sequence at least 95% shown in the SEQ ID NO:2.

3, polypeptide as claimed in claim 2 is characterized in that it comprises the polypeptide with the aminoacid sequence shown in the SEQ ID NO:2.

4, a kind of isolating polynucleotide, it is characterized in that described polynucleotide comprise be selected from down the group in a kind of:

(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2 or its fragment, analogue, derivative;

(b) with polynucleotide (a) complementary polynucleotide; Or

(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.

5, polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise the polynucleotide that coding has aminoacid sequence shown in the SEQID NO:2.

6, polynucleotide as claimed in claim 4, the sequence that it is characterized in that described polynucleotide include the sequence of 1-2981 position among the sequence of 157-2484 position among the SEQ IDNO:1 or the SEQ ID NO:1.

7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that it is the recombinant vectors that is formed by the described polynucleotide of arbitrary claim among the claim 4-6 and plasmid, virus or vehicle expression vector establishment.

8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell:

(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or

(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.

9, a kind of preparation method with people's Histidyl-tRNA synthetase 85 active polypeptide is characterized in that described method comprises:

(a) under expressing human Histidyl-tRNA synthetase 85 conditions, cultivate the described through engineering approaches host cell of claim 8;

(b) from culture, isolate and have people's Histidyl-tRNA synthetase 85 active polypeptide.

10, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with people's Histidyl-tRNA synthetase 85 specificity bonded antibody.

11, the compound of an analoglike or adjusting polypeptide active or expression is characterized in that they are simulation, promotion, antagonism or the active compound that suppresses people's Histidyl-tRNA synthetase 85.

12, compound as claimed in claim 11 is characterized in that it is the polynucleotide sequence shown in the SEQ ID NO:1 or its segmental antisense sequences.

13, the described application of compound of a kind of claim 11, it is characterized in that described compound be used for mediator's Histidyl-tRNA synthetase 85 in vivo, the method for external activity.

14, a kind of disease relevant or method of disease susceptibility of detecting with the described polypeptide of arbitrary claim among the claim 1-3, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide, perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.

15, as the application of polypeptide as described in the arbitrary claim among the claim 1-3, it is characterized in that it is applied to screen the stand-in of people's Histidyl-tRNA synthetase 85, agonist, antagonist or inhibitor; Perhaps be used for the peptide finger print identification.

16, as the application of the described nucleic acid molecule of arbitrary claim among the claim 4-6, it is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps be used for hybridization, perhaps be used to make gene chip or microarray as probe.

17,, it is characterized in that forming pharmaceutical composition with safe and effective dosage and pharmaceutically acceptable carrier as the relevant unusually disease of diagnosis or treatment and people's Histidyl-tRNA synthetase 85 with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor as the described polypeptide of arbitrary claim, polynucleotide or application of compound in claim 1-6 and 11.

18, the described polypeptide of arbitrary claim, polynucleotide or the application of compound among the claim 1-6 and 11, it is characterized in that being used for the treatment of as malignant tumour with described polypeptide, polynucleotide or compound, hemopathy, the medicine of HIV infection and immunological disease and all kinds of inflammation.

Images