CN1313327A - Polypeptide-human junctional adhesion molecule 12 and polynucleotide for coding it - Google Patents

Polypeptide-human junctional adhesion molecule 12 and polynucleotide for coding it Download PDF

Info

Publication number
CN1313327A
CN1313327A CN 00114911 CN00114911A CN1313327A CN 1313327 A CN1313327 A CN 1313327A CN 00114911 CN00114911 CN 00114911 CN 00114911 A CN00114911 A CN 00114911A CN 1313327 A CN1313327 A CN 1313327A
Authority
CN
China
Prior art keywords
polynucleotide
polypeptide
adhesion molecule
people
junctional adhesion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 00114911
Other languages
Chinese (zh)
Inventor
毛裕民
谢毅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Biowindow Gene Development Inc
Original Assignee
Shanghai Biowindow Gene Development Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc filed Critical Shanghai Biowindow Gene Development Inc
Priority to CN 00114911 priority Critical patent/CN1313327A/en
Priority to AU42224/01A priority patent/AU4222401A/en
Priority to PCT/CN2001/000167 priority patent/WO2001068873A1/en
Publication of CN1313327A publication Critical patent/CN1313327A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Abstract

A new polypeptide-human junctional adhesion molecule 12, the polynucleotide for coding it, the process for preparing said polypeptide by DNA recombination, the application of said polypeptide in treating diseases such as cancer, HIV infection, etc. the antagonist of said polypeptide and its medical function, and the application of said polynucleotide are disclosed.

Description

The polynucleotide of a kind of new polypeptide--people's junctional adhesion molecule 12 and this peptide species of coding
The invention belongs to biological technical field, specifically, the invention describes a kind of new polypeptide--people's junctional adhesion molecule 12, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.
Inflammation chemokine such as TNF-α, IFN-γ etc. promote the expression of cell adhesion molecule such as ICAM-1, VCAM-1 etc. in the chrotoplast in vivo, and promote white corpuscle transmembrane transport in vivo.Yet as TNF-α, when IFN-γ participates in this process simultaneously, leukocytic transmembrane transport reduces abnormality in the body.This phenomenon has obtained confirmation in the iuntercellular of thrombocyte endotheliocyte adhesion molecule 1 (PECAM-1) connects.PECAM-1 is a member in the Ig gene superfamily, is that the transhipment of organism words spoken by an actor from offstage cell transmembrane is necessary.The minimizing of organism inner cell adhesion molecule plays important regulation [Newman P.J., 1997, J Clin.Invest., 99:3] in white corpuscle transmembrane transport process.
White corpuscle is a class nuclear hemocyte, and organism is under different time and different body function state, and the number of white corpuscle in blood also has variation in a big way.When body has inflammatory reaction, the number of WBC showed increased.This is the autoimmune a kind of mode of organism, and when having chemotaxis things such as bacteriotoxin, bacterium or human body cell degraded product in the organism, intravital white corpuscle can increase sharply, and engulfs these materials.Hence one can see that, and leukocytic transmembrane transport plays a part very important in organism autoimmunization, removing inflammatory reaction process.And cell adhesion molecule plays crucial regulating effect in leukocytic transmembrane transport process, and this proteic sudden change or abnormal expression will cause the unusual of white corpuscle transmembrane transport, thereby influences the carrying out of a series of associated self-immunprocesses.
1999, people such as Harunobu obtained the gene of two homologous coding junctional adhesion molecules from ox and philtrum clone.These two cell adhesion molecule are the newcomers in the Ig gene superfamily, and similar to the member of known this gene family, also play important regulatory role in white corpuscle transmembrane transport process.If add pro-inflammatory cytokine TNF-α, IFN-γ in vivo simultaneously, to cause the redistribution of junctional adhesion molecule at cell surface, the redistribution of this adhesion molecule plays very important regulatory role in inflammatory reaction white corpuscle transmembrane transport process, to cause the abnormality of white corpuscle transmembrane transport amount to reduce, thereby influence a series of relevant immunoreactive [Harunobu Ozaki that carry out, Kenji Ishii et al., 1999, The Journal ofImmunology, 163:553-557].
As from the foregoing, people's junctional adhesion molecule plays important regulatory role in organism inflammatory reaction process, and it regulates the carrying out of organism autoimmune response by leukocytic transhipment in the regulation and control related tissue cell.This proteic sudden change or abnormal expression will cause the unusual of body words spoken by an actor from offstage cell transmembrane transhipment, thereby influence the generation of a series of associated inflammatory reactions.This albumen is usually closely related with the generation of the tumour of related tissue and cancer, inflammation that some are relevant in vivo.
Associated protein: 0729C02 people's junctional adhesion molecule 12
Analysis by gene chip is found, in the Ecv304 cell strain of the Ecv304 of thymus gland, testis, muscle, spleen, lung, skin, Tiroidina, liver, PMA+ cell strain, PMA-, not hungry L02 cell strain, L02 cell strain and prostata tissue that arsenic stimulates 1 hour, polypeptide expression spectrum of the present invention is very approximate with the express spectra of people's junctional adhesion molecule, so the two function also may be similar.The present invention is named as people's junctional adhesion molecule 12.
Because people's junctional adhesion molecule 12 albumen plays an important role in regulating body critical functions such as cell fission and fetal development as mentioned above, and believe and relate to a large amount of albumen in these regulate processes, thereby need to identify people's junctional adhesion molecule 12 albumen of more these processes of participation in this area always, particularly identify this proteic aminoacid sequence.The separation of new person's junctional adhesion molecule 12 protein coding gene also provides the foundation for determining the effect of this albumen under healthy and morbid state.This albumen may constitute the basis of 1 sick diagnosis of exploitation disease and/or curative, and it is very important therefore separating its coding DNA.
An object of the present invention is to provide isolating new polypeptide--people's junctional adhesion molecule 12 with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of this polypeptide of coding.
Another object of the present invention provides the recombinant vectors of the polynucleotide that contain coding people junctional adhesion molecule 12.
Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain coding people junctional adhesion molecule 12.
Another object of the present invention provides the method for producing people's junctional adhesion molecule 12.
Another object of the present invention provides at polypeptide of the present invention--the antibody of people's junctional adhesion molecule 12.
Another object of the present invention has provided at polypeptide of the present invention--the simulated compound of people's junctional adhesion molecule 12, antagonist, agonist, inhibitor.
Another object of the present invention provides the method for the diagnoses and treatment disease relevant unusually with people's junctional adhesion molecule 12.
The present invention relates to a kind of isolated polypeptide, this polypeptide is the people source, and it comprises: polypeptide or its examples of conservative variations, bioactive fragment or derivative with SEQ ID No.2 aminoacid sequence.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
The invention still further relates to a kind of isolating polynucleotide, it comprises a kind of nucleotide sequence or its variant that is selected from down group:
(a) coding has the polynucleotide of the polypeptide of SEQ ID No.2 aminoacid sequence;
(b) with polynucleotide (a) complementary polynucleotide;
(c) with (a) or polynucleotide sequence (b) have the polynucleotide of at least 70% homogeny.
More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 325-660 position among the SEQ ID NO:1; (b) has the sequence of 1-1996 position among the SEQ ID NO:1.
The present invention relates to a kind of carrier that contains polynucleotide of the present invention, particularly expression vector in addition; The host cell that this carrier of a kind of usefulness is genetically engineered comprises the host cell of conversion, transduction or transfection; A kind of method for preparing polypeptide of the present invention of cultivating described host cell and reclaiming expression product that comprises.
The invention still further relates to a kind of can with polypeptid specificity bonded antibody of the present invention.
The invention still further relates to a kind of simulation, activation, antagonism of screening or suppress the method for the compound of people's junctional adhesion molecule 12 protein-active, it comprises and utilizes polypeptide of the present invention.The invention still further relates to the compound that obtains with this method.
The invention still further relates to a kind of vitro detection and express the relevant disease or the method for disease susceptibility with people's junctional adhesion molecule 12 abnormal protein, comprise the sudden change in polypeptide described in the detection of biological sample or its coded polynucleotide sequence, perhaps the amount or the biological activity of polypeptide of the present invention in the detection of biological sample.
The present invention also relates to a kind of pharmaceutical composition, it contains polypeptide of the present invention or its stand-in, activator, antagonist or inhibitor and pharmaceutically acceptable carrier.
The invention still further relates to polypeptide of the present invention and/or polynucleotide and be used for the treatment of malignant tumour in preparation, hemopathy, grow disorders, HIV infection and immunological disease and all kinds of inflammation or other are because the purposes of the medicine of people's junctional adhesion molecule 12 disease that abnormal expression causes.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
The following term of using in this specification sheets and claims has following implication unless stated otherwise:
" nucleotide sequence " is meant oligonucleotide, Nucleotide or polynucleotide and fragment or part, also can refer to genome or synthetic DNA or RNA, and they can be strand or two strands, represent sense strand or antisense strand.Similarly, term " aminoacid sequence " is meant oligopeptides, peptide, polypeptide or protein sequence and fragment or part.When " aminoacid sequence " among the present invention related to a kind of aminoacid sequence of naturally occurring protein molecule, this " polypeptide " or " protein " did not mean that aminoacid sequence are restricted to the complete natural amino acid relevant with described protein molecule.
Protein or polynucleotide " variant " are meant a kind of polynucleotide sequence that has the aminoacid sequence of one or more amino acid or Nucleotide change or encode it.Described change can comprise disappearance, insertion or the replacement of amino acid in aminoacid sequence or the nucleotide sequence or Nucleotide.Variant can have " conservative property " and change, and wherein the amino acid of Ti Huaning has structure or the chemical property similar with original acid, as replacing Isoleucine with leucine.Variant also can have non-conservation and change, as replacing glycine with tryptophane.
" disappearance " is meant the disappearance of in aminoacid sequence or nucleotide sequence one or more amino acid or Nucleotide.
" insertion " or " interpolation " is meant that the change in aminoacid sequence or nucleotide sequence causes comparing the increase of one or more amino acid or Nucleotide with naturally occurring molecule." replacement " is meant by different amino acid or Nucleotide and replaces one or more amino acid or Nucleotide.
" biological activity " is meant the protein of structure, regulation and control or biochemical function with natural molecule.Similarly, term " immunologic competence " be meant natural, reorganization or synthetic protein and fragment thereof in suitable animal or cell, induce specific immune response and with specific antibody bonded ability.
" agonist " is meant when combining with people's junctional adhesion molecule 12, thereby a kind of this protein that causes changes the molecule of regulating this protein active.Agonist can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of people's junctional adhesion molecule 12.
" antagonist " or " inhibition " is meant when combining with people's junctional adhesion molecule 12, a kind of sealing or the biologic activity of mediator's junctional adhesion molecule 12 or the molecule of immunologic competence.Antagonist and inhibition can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of people's junctional adhesion molecule 12.
" adjusting " is meant that the function of people's junctional adhesion molecule 12 changes, and comprises the change of any other biological property, function or the immune property of the change of the rising of protein active or reduction, binding characteristic and people's junctional adhesion molecule 12.
" pure basically " is meant and is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying people junctional adhesion molecule 12 of standard.Basically pure people's junctional adhesion molecule 12 can produce single master tape on the irreducibility polyacrylamide gel.The purity available amino end acid sequence of people's junctional adhesion molecule 12 polypeptide is analyzed.
" complementary " or " complementation " is meant under salt concn that allows and temperature condition by the natural combination of the polynucleotide of base pairing.For example, sequence " C-T-G-A " can combine with complementary sequence " G-A-C-T ".Complementation between two single chain molecules can be part or whole.Complementary degree between the nucleic acid chains has a significant effect for efficient of hybridizing between the nucleic acid chains and intensity.
" homology " is meant the complementary degree, can be portion homologous or complete homology." portion homologous " is meant a kind of part complementary sequence, and it can partly suppress the hybridization of complete complementary sequence and target nucleic acid at least.The inhibition of this hybridization can detect by hybridizing (Southern trace or Northern trace etc.) under the condition that reduces in the severity degree.Basically homologous sequence or hybridization probe can compete and suppress complete homologous sequence and target sequence the condition that reduces of severity degree under combine.This does not mean the conditions permit non-specific binding that the severity degree reduces because the conditional request two sequences that the severity degree reduces mutual be combined into specificity or selectivity interacts.
" homogeny percentage " be meant two or more amino acid or nucleotide sequence relatively in the same or analogous percentage of sequence.The available electron method is measured the homogeny percentage, as passing through MEGALIGN program (Lasergenesoftware package, DNASTAR, Inc., Madison Wis.).The MEGALIGN program can compare two or more sequences (Higgins, D.G. and P.M.Sharp (1988) Gene 73:237-244) according to diverse ways such as Cluster method.The Cluster method is organized the series arrangement cluster by checking the distance between all pairings with each.Then with each bunch with in pairs or become set of dispense.Homogeny percentage between two aminoacid sequences such as sequence A and the sequence B calculates by following formula: the residue number of mating between sequence A and the sequence B
Figure A0011491100081
100
Interval residue number in the residue number-sequence B of interval in the residue number-sequence A of sequence A
Also can be by the Cluster method or with the homogeny percentage (Hein J., (1990) Methods in emzumology 183:625-645) between known method in this area such as the Jotun Hein mensuration nucleotide sequence.
" similarity " is meant the degree that the identical or conservative property of corresponding position amino-acid residue when arranging contrast between the aminoacid sequence replaces.For example be used for amino acid that conservative property replaces, electronegative amino acid can comprise aspartic acid and L-glutamic acid; Positively charged amino acid can comprise Methionin and arginine; Having uncharged head group has similar hydrophilic amino acid can comprise leucine, Isoleucine and Xie Ansuan; Glycine and L-Ala; L-asparagine and glutamine; Serine and Threonine; Phenylalanine and tyrosine.
" antisense " is meant and specific DNA or RNA sequence complementary nucleotide sequence." antisense strand " is meant and " sense strand " complementary nucleic acid chains.
" derivative " is meant HFP or encodes its chemical modification object of nucleic acid.This chemical modification object can be with alkyl, acyl group or the amino hydrogen atom of replacing.The nucleic acid derivative codified keeps the polypeptide of the main biological characteristics of natural molecule.
" antibody " is meant complete antibody molecule and fragment thereof, as Fa, F (ab ') 2And Fv, its energy specificity is in conjunction with the antigenic determinant of people's junctional adhesion molecule 12.
" humanized antibody " is meant that the aminoacid sequence in non-antigen binding domain territory is replaced and becomes more similar to people's antibody, but still keep original in active antibody.
" isolating " speech refers to material is shifted out among its original environment (for example, if spontaneous its natural surroundings that just refers to).Such as it is exactly not to be separated that spontaneous polynucleotide or polypeptide are present in the Live Animals, but same polynucleotide or polypeptide with some or all in natural system with it the material of coexistence separately be exactly isolating.Such polynucleotide may be the parts of a certain carrier, the part that also possible such polynucleotide or polypeptide are a certain composition.Since carrier or composition are not the compositions of its natural surroundings, they remain isolating.
As used herein, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating people's junctional adhesion molecule 12 " is meant that people's junctional adhesion molecule 12 is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying people junctional adhesion molecule 12 of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of people's junctional adhesion molecule 12 polypeptide can be used amino acid sequence analysis.
The invention provides a kind of new polypeptide--people's junctional adhesion molecule 12, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of people's junctional adhesion molecule 12.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of people's junctional adhesion molecule 12 of the present invention or active polypeptide basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) is a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, 00 derivative and analogue are considered within those skilled in the art's ken.
The invention provides isolating nucleic acid (polynucleotide), substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 1996 bases, its open reading frame 325-660 111 amino acid of having encoded.Find relatively that according to gene chip expression spectral this polypeptide has similar express spectra to people's junctional adhesion molecule, deducibility goes out this people's junctional adhesion molecule 12 and has the similar function of people's junctional adhesion molecule.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, " nucleic acid fragment " length contain 10 Nucleotide at least, better be 20-30 Nucleotide at least, be more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding people junctional adhesion molecule 12.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
The special polynucleotide sequence of coding people junctional adhesion molecule 12 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.
Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.
In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.
Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration people junctional adhesion molecule 12; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.
In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.
In (4) kind method, detect the protein product of people's junctional adhesion molecule 12 genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with the carrier of the present invention or the junctional adhesion molecule 12 encoding sequence of directly choosing, and the method that produces polypeptide of the present invention through recombinant technology.
Among the present invention, the polynucleotide sequence of coding people junctional adhesion molecule 12 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.
Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains coding people junctional adhesion molecule 12 and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, aLaboratory Manual.cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The P of lambda particles phage LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.
Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.
Among the present invention, the polynucleotide of coding people junctional adhesion molecule 12 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.
Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results 2Method is handled, and used step is well-known in this area.Alternative is to use MgCl 2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.
By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce people's junctional adhesion molecule 12 (Sciernce, 1984 of reorganization; 224:1431).In general following steps are arranged:
(1). with the polynucleotide (or varient) of everybody junctional adhesion molecule 12 of coding of the present invention, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;
(2). in suitable medium, cultivate host cell;
(3). separation, protein purification from substratum or cell.
In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat malignant tumour, adrenal gland defect, tetter, all kinds of inflammation, HIV infection and immunological disease etc.
Inflammation chemokine such as TNF-α, IFN-γ etc. promote the expression of cell adhesion molecule such as ICAM-1, VCAM-1 etc. in human endothelial cells, and promote white corpuscle transmembrane transport in vivo.Yet as TNF-α, when IFN-γ participates in this process simultaneously, leukocytic transmembrane transport reduces abnormality in the body, in connecting as the iuntercellular at thrombocyte endotheliocyte adhesion molecule 1 (PECAM-1).PECAM-1 is a member in the Ig gene superfamily, is that the transhipment of organism words spoken by an actor from offstage cell transmembrane is necessary.The minimizing of organism inner cell adhesion molecule plays important regulation in white corpuscle transmembrane transport process.And leukocytic transmembrane transport is very important for playing a part in body autoimmunization, the removing inflammatory reaction process.Proteic sudden change of cell adhesion molecule or abnormal expression will cause the unusual of white corpuscle transmembrane transport, thereby influence the carrying out of a series of associated self-immunprocesses.
Polypeptide expression spectrum of the present invention is consistent with the express spectra of people's junctional adhesion molecule, and both have similar biological function.Its main in vivo adjusting inflammatory reaction and functions of immune system of participating in, its abnormal expression usually and function of immune system is unusual, inflammatory process unusual, the generation of tumour is closely related, and produce relevant disease.
This shows that the abnormal expression of people's junctional adhesion molecule 12 of the present invention will produce various diseases especially immunological disease, inflammation, various tumour, fetal development disorders, dysplasia disease, these diseases include but not limited to:
Immunological disease: rheumatoid arthritis, chronic active hepatitis infects back myocarditis, systemic lupus erythematous, scleroderma, myasthenia gravis, Green-barre syndrome, autoimmune hemolytic anemia, common variable immunodeficient disease, primary bone-marrow-derived lymphocyte immunodeficient disease, primary T lymphocyte immunity defective disease, the sick Wiskott-Aldrich syndrome of severe combined immunodeficiency, companion's ataxia telangiectasia, primary phagocyte immuno-dificiency disease disease, primary defect of complement system disease, acquired immune deficiency syndrome (AIDS), bronchial asthma, Asprin asthma, rhinallergosis, diffuse interstitial pulmonary fibrosis, urticaria, atopic dermatitis
Inflammation: sarcoidosis, rheumatoid arthritis osteoarthritis, adult respiratory distress syndrome, dermatomyositis, urticaria, atopic dermatitis, polymyositis, Addison's disease, Graves' disease, intestines are answered acute syndromes, chronic rhinitis, atrophic gastritis, chronic gastritis, multiple sclerosis, Green-barre syndrome, intracranial granuloma, multiple scleroderma, pancreatitis, cholecystitis, glomerulonephritis, myocarditis, myocardosis, atherosclerosis, stomach ulcer, hyperplasia of prostate, trachelitis, various infective inflammations such as viral infection, bacterial infection, mycoplasma infection, choamydiae infection, spirochaete infection, fungi infestation
The tumour of various tissues: cancer of the stomach, liver cancer, lung cancer, the esophageal carcinoma, mammary cancer, leukemia, lymphoma, thyroid tumor, hysteromyoma, neurocytoma, astrocytoma, ependymoma, glioma, neurofibroma, colorectal carcinoma, melanoma, bladder cancer, uterus carcinoma, carcinoma of endometrium, colorectal carcinoma, thymus neoplasms, nasopharyngeal carcinoma, laryngocarcinoma, tracheal neoplasm, fibroma, fibrosarcoma, lipoma, liposarcoma
Fetal development disorders: congenital miscarriage, cleft palate, deficiency of skeletal limb, limbs dysdifferentiation, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
The dysplasia disease: mental retardation, cerebral dysgenesis, skin, fat and amyoplasia disease, B﹠J dysplasia disease, various metabolic defects, cretinism, nanism, emerging comprehensive this in storehouse levied the slow disease of sexual development
The abnormal expression of people's junctional adhesion molecule 12 of the present invention also will produce some heredity, blood disease etc.
The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat various diseases especially immunological disease, inflammation, various tumour, fetal development disorders, dysplasia disease, some heredity, blood disease etc.
The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) people junctional adhesion molecule 12.Agonist improves people's junctional adhesion molecule 12 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can in the presence of medicine, the film preparation of mammalian cell or expressing human junctional adhesion molecule 12 be cultivated with people's junctional adhesion molecule 12 of mark.Measure the medicine raising then or check this interactional ability.
The antagonist of people's junctional adhesion molecule 12 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of people's junctional adhesion molecule 12 can combine and eliminate its function with people's junctional adhesion molecule 12, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.
In screening during as the compound of antagonist, people's junctional adhesion molecule 12 can be added during bioanalysis measures, determine to interactional influence between people's junctional adhesion molecule 12 and its acceptor whether compound is antagonist by measuring compound.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with people's junctional adhesion molecule 12 bonded peptide molecule obtains.During screening, generally tackle people's junctional adhesion molecule 12 molecule and carry out mark.
The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at people's junctional adhesion molecule 12 antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.
Can the choose method of junctional adhesion molecule 12 direct injection immune animal (as rabbit, mouse, rat etc.) of the production of polyclonal antibody obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of the monoclonal antibody of preparation people junctional adhesion molecule 12 include but not limited to hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.4946778) also can be used for producing the single-chain antibody of anti-people's junctional adhesion molecule 12.
The antibody of anti-people's junctional adhesion molecule 12 can be used in the immunohistochemistry technology, detects the people's junctional adhesion molecule 12 in the biopsy specimen.
With the also available labelled with radioisotope of people's junctional adhesion molecule 12 bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people's junctional adhesion molecule 12 high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing people's junctional adhesion molecule 12 positive cells.
The disease that antibody among the present invention can be used for treating or prevention is relevant with people's junctional adhesion molecule 12.The antibody that gives suitable dosage can stimulate or block the generation or the activity of people's junctional adhesion molecule 12.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people junctional adhesion molecule 12 level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people's junctional adhesion molecule 12 level that is detected in the test can be with laying down a definition the importance of people's junctional adhesion molecule 12 in various diseases and be used to the disease of diagnosing people's junctional adhesion molecule 12 to work.
Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.
The polynucleotide of coding people junctional adhesion molecule 12 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of people's junctional adhesion molecule 12 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for people's junctional adhesion molecule 12 of expressing variation, to suppress endogenic people's junctional adhesion molecule 12 activity.For example, a kind of people's junctional adhesion molecule 12 of variation can be the people's junctional adhesion molecule 12 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of expression of people's junctional adhesion molecule 12 or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding people junctional adhesion molecule 12 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding people junctional adhesion molecule 12 is found in existing document (Sambrook, et al.).The polynucleotide of reorganization coding people junctional adhesion molecule 12 can be packaged in the liposome and be transferred in the cell in addition.
Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Suppress the oligonucleotide (comprising sense-rna and DNA) of people's junctional adhesion molecule 12 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
The polynucleotide of coding people junctional adhesion molecule 12 can be used for the diagnosis with the relative disease of people's junctional adhesion molecule 12.The unconventionality expression of the expression that the polynucleotide of coding people junctional adhesion molecule 12 can be used for detecting people's junctional adhesion molecule 12 people's junctional adhesion molecule 12 whether or under morbid state.As the dna sequence dna of the people's junctional adhesion molecule 12 of encoding can be used for biopsy specimen is hybridized to judge the expression situation of people's junctional adhesion molecule 12.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.The special primer of personnel selection junctional adhesion molecule 12 carries out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect people's junctional adhesion molecule 12.
The sudden change that detects people's junctional adhesion molecule 12 gene also can be used for the disease of diagnosing people's junctional adhesion molecule 12 relevant.The form of people's junctional adhesion molecule 12 sudden change comprises that the point mutation compared with normal wild type people junctional adhesion molecule 12 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.
In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).
The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.
Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.
The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.
Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.People's junctional adhesion molecule 12 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to people's junctional adhesion molecule 12 of patient will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is the gene chip expression spectral comparison diagram of inventor's junctional adhesion molecule 12 and people's junctional adhesion molecule.Last figure is the express spectra folding side figure of people's junctional adhesion molecule 12, and the below sequence is the express spectra folding side figure of people's junctional adhesion molecule.
Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating people's junctional adhesion molecule 12.12KDa is proteinic molecular weight.The arrow indication is isolated protein band.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Embodiment 1: the clone of people's junctional adhesion molecule 12
Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure all clones' 5 ' and 3 ' terminal sequence with Dyeterminate cycle reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0325e11 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0325e11 clone is 1996bp (shown in Seq ID NO:1), from 325bp to 660bp the open reading frame (ORF) of a 336bp, the new protein (shown in SeqID NO:2) of encoding arranged.We are with this clone's called after pBS-0325e11, and the name of encoded protein matter is people's junctional adhesion molecule 12.Embodiment 2: with the gene of RT-PCR method clones coding people junctional adhesion molecule 12
Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:
Primer1:5’GGAGATCCTGCATACAGACTCAGT-3’(SEQ?ID?NO:3)
Primer2:5’-GTTGAACGTTTATTGAGCTCTAAC-3’(SEQ?ID?NO:4)
Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;
Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.
The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/L Tris-Cl, (pH8.5), 1.5mmol/L MgCl 2, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-1996bp shown in the SEQ ID NO:1 are identical.Embodiment 3:Northern blotting analyst junctional adhesion molecule 12 expression of gene:
Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- 32P dATP prepares by random priming 32The dna probe of P-mark.Used dna probe is people's junctional adhesion molecule 12 coding region sequence (325bp to 660bp) of pcr amplification shown in Figure 1.Probe (about 2 * 10 with the 32P-mark 6Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH 2PO 4(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.Embodiment 4: the vivoexpression of recombinant human junctional adhesion molecule 12, separation and purifying
According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:
Primer3:5’-CATGCTAGCATGTACATGCAGGCAACCTTTTTA-3’(Seq?ID?No:5)
Primer4:5’-CATGGATCCTTAGATTCCCAATCCTTTATTCAT-3’(Seq?ID?No:6)
5 ' end of these two sections primers contains Nhe I and BamH I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, Nhe I and BamH I restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0325e11 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0325e11 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with Nhe I and BamH I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0325e11) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0325e11) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product), has obtained the target protein people junctional adhesion molecule 12 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 12KDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 5 anti-people's junctional adhesion molecule 12 production of antibodies
Synthesize the specific polypeptide of following people's junctional adhesion molecule 12 with Peptide synthesizer (PE company product):
NH2-Met-Tyr-Met-Gln-Ala-Thr-Phe-Leu-Asn-Gln-Ile-Ile-Ile-Tyr-Leu-COOH(SEQ?ID?NO:7)。Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with people's junctional adhesion molecule 12 specifically.Embodiment 6: polynucleotide passage of the present invention is as the application of hybridization probe
Picking out suitable oligonucleotide fragment from polynucleotide of the present invention is of use in many ways as hybridization probe, as can whether containing polynucleotide sequence of the present invention and detect the homologous polynucleotide sequence to identify it with the healthy tissues of different sources or the genome or the hybridization of cDNA library of pathological tissue with this probe, whether further also available this probe in detecting polynucleotide sequence of the present invention or the expression of its homologous polynucleotide sequence in healthy tissues or pathological tissue cell be unusual.
The purpose of present embodiment is to pick out suitable oligonucleotide fragment as hybridization probe from polynucleotide SEQ ID NO:1 of the present invention, and identifies in some tissues whether contain polynucleotide sequence of the present invention or its homologous polynucleotide sequence with the filter hybridization method.The filter hybridization method comprises dot blotting, Southern blotting, Northern blotting and copy method etc., and they all are that polynucleotide sample to be measured is fixed on use essentially identical step crossover in back on the filter membrane.These identical steps are: the filter membrane of having fixed sample at first carries out prehybridization with the hybridization buffer that does not contain probe, so that nonspecific combining site suppressed by vector of sample and synthetic polymer institute are saturated on the filter membrane.Prehybridization solution is contained the hybridization buffer replacement of label probe then, and insulation makes probe and target nucleic acid hybridization.After the hybridization step, the probe in the hybridization is not removed by a series of film steps of washing.Present embodiment utilizes the film condition of washing (as than low salt concn and higher temperature) of higher-strength, so that hybrid context reduces and only keep the signal of high specificity.The probe that present embodiment is selected for use comprises two classes: first kind probe be fully with the identical or complementary oligonucleotide fragment of polynucleotide SEQ ID NO:1 of the present invention; The second class probe is part and the identical or complementary oligonucleotide fragment of polynucleotide SEQ ID NO:1 of the present invention.Present embodiment selects for use dot blotting that sample is fixed on the filter membrane, higher-strength wash under the film condition, the hybridization specificity of first kind probe and sample is the strongest and kept.One, probe selects for use
From polynucleotide SEQ ID NO:1 of the present invention, select oligonucleotide fragment as hybridization probe, the several aspects that should follow following principle and need to consider:
1, the probe size preferable range is a 18-50 Nucleotide;
2, GC content is 30%-70%, and surpassing then, non-specific hybridization increases;
3, probe interior should not have complementary region;
4, what meet above condition can be used as the primary election probe, further do the computer sequential analysis then, comprise this primary election probe is carried out homology relatively with its source sequence area (being SEQ ID NO:1) and other known genome sequence and complementary district thereof respectively, if with the homology in non-target molecule zone greater than 85% or there are 15 continuous bases of surpassing identical, then this primary election probe is general just should not use;
5, whether the primary election probe finally is chosen to be the probe of actual application value also should further be determined by experiment.Select and synthetic following two probes after finishing the analysis of above each side:
Probe 1 (probe1) belongs to first kind probe, and complete homology of gene fragment or the complementation (41Nt) of SEQ ID NO:1:
5’-TGTACATGCAGGCAACCTTTTTAAATCAAATTATAATTTAT-3’(SEQ?ID?NO:8)
Probe 2 (probe2) belongs to the second class probe, is equivalent to gene fragment or its complementary segmental replacement mutant nucleotide sequence (41Nt) of SEQ ID NO:1:
5’-TGTACATGCAGGCAACCTTTCTAAATCAAATTATAATTTAT-3’(SEQ?ID?NO:9)
Other unlisted common agents and the compound method thereof relevant with following concrete experimental procedure please refer to document: DNA PROBES G.H.Keller; M.M.Manak; Stockton Press, 1989 (USA) and molecular cloning laboratory manual books more commonly used are as works such as " molecular cloning experiment guide " (second edition in 1998) [U.S.] Sa nurse Brooker, Science Press.
Specimen preparation: 1, from fresh or frozen tissue, extract DNA
Step: 1) the fresh or fresh normal liver tissue that thaws is put into the plate that is immersed on ice and fills phosphate buffered saline buffer (PBS).With scissors or scalpel tissue is cut into small pieces.Should keep organizing moistening in the operation.2) with 1000g centrifugal chopper tissue 10 minutes.3) with cooled homogenate damping fluid (0.25mol/L sucrose; 25mmol/LTris-HCl, pH7.5; 25mmol/LNaCl; 25mmol/L MgCl 2) precipitation that suspends (approximately 10ml/g).4) 4 ℃ with electric homogenizer homogenate tissue suspension at full speed, until tissue by broken fully.5) 1000g is centrifugal 10 minutes.6) with re-suspended cell precipitation (the initial tissue sample of every 0.1g adds 1-5ml), centrifugal 10 minutes again with 1000g.7) with the resuspended precipitation of lysis buffer (the initial tissue sample of every 0.1g adds 1ml), connect following phenol extraction process then.2, the phenol extraction process of DNA
Step: 1) wash cell, centrifugal 10 minutes of 1000g with the cold PBS of 1-10ml.2) with the sedimentary cell (1 * 10 of cold cell pyrolysis liquid resuspension 8The minimum of applications 100ul lysis buffer of cell/ml).3) adding SDS is 1% to final concentration, if before re-suspended cell SDS is directly joined in the cell precipitation, cell may form big agglomerate and be difficult to fragmentation, and the overall yield that reduces.This point is in extracting＞10 7Especially severe during cell.4) add Proteinase K to final concentration 200ug/ml.5) 50 ℃ of insulation reaction 1 hour or 37 ℃ gently jolting spend the night.6) use equal-volume phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting, in little centrifuge tube centrifugal 10 minutes.Two corresponding clear separation, otherwise carry out centrifugal again.7) water is transferred to new pipe.8) use the equal-volume chloroform: primary isoamyl alcohol (24: 1) extracting, centrifugal 10 minutes.9) water that will contain DNA is transferred to new pipe.Carry out purifying and the ethanol sedimentation of DNA then.3, the purifying of DNA and ethanol sedimentation
Step: 1) 1/10 volume 2mol/L sodium-acetate and 2 times of cold 100% ethanol of volume are added in the dna solution mixing.-20 ℃ of placements 1 hour or to spending the night.2) centrifugal 10 minutes.3) careful sucking-off or pour out ethanol.4) with 70% cold ethanol 500ul washing precipitation, centrifugal 5 minutes.5) careful sucking-off or pour out ethanol.With the cold washing with alcohol precipitation of 500ul, centrifugal 5 minutes.6) careful sucking-off or pour out ethanol is inverted on thieving paper then residual ethanol is flow to end.Dry air 10-15 minute, so that the volatilization of surperficial ethanol.Note not making the precipitation complete drying, otherwise dissolve again than difficulty.7) with small volume TE or the resuspended DNA precipitation of water.The low speed vortex vibrates or uses the dropper pressure-vaccum, increases TE gradually simultaneously, is mixed to DNA and fully dissolves, every 1-5 * 10 6Cell extracted approximately adds 1ul.
Below the 8-13 step only be used for must removing when depolluting, otherwise can directly carry out the 14th step.8) RNA enzyme A is added in the dna solution, final concentration is 100ug/ml, and 37 ℃ are incubated 30 minutes.9) add SDS and Proteinase K, final concentration is respectively 0.5% and 100ug/ml.37 ℃ are incubated 30 minutes.10) use isopyknic phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extractive reaction liquid, centrifugal 10 minutes.11) carefully shift out water, use isopyknic chloroform: primary isoamyl alcohol (24: 1) extracting again, centrifugal 10 minutes.12) carefully shift out water, add 1/10 volume 2mol/L sodium-acetate and the cold ethanol of 2.5 volumes, mixing put-20 ℃ 1 hour.13) with 70% ethanol and 100% washing with alcohol precipitation, dry air, resuspended nucleic acid, process is with the 3-6 step.14) measure A 260And A 280To detect purity and the productive rate of DNA.15) deposit in-20 ℃ after the packing.The preparation of sample film:
1) get 4 * 2 suitably nitrocellulose filters (NC film) of size, mark point sample position and sample number thereon gently with pencil, each probe needs two NC films, so that wash film with high strength condition and strength condition respectively in the experimental procedure of back.
2) draw and contrast respectively 15 microlitres, put on the sample film, dry at room temperature.
3) place infiltration that 0.1mol/LNaOH is arranged, last 5 minute of filter paper (twice) of 1.5mol/LNaCl, drying to place to soak into has 0.5mol/L Tris-HCl (pH7.0), last 5 minute of filter paper (twice) of 3mol/LNaCl, dries.
4) be sandwiched in the clean filter paper, wrap, 60-80 ℃ of vacuum-drying 2 hours with aluminium foil.
The mark of probe
1) 3 μ l Probe (0.10D/10 μ l) add 2 μ l Kinase damping fluids, 8-10uCi γ- 32P-dATP+2UKinase is to add to final volume 20 μ l.
2) 37 ℃ are incubated 2 hours.
3) add the tetrabromophenol sulfonphthalein indicator (BPB) of 1/5 volume.
4) cross Sephadex G-50 post.
5) to having 32Before washing out, P-Probe begins to collect first peak (available Monitor monitoring).
6) 5/pipe, collect the 10-15 pipe.
7) monitor isotopic weight with liquid glimmer instrument
8) merge and to be required preparation behind the collection liquid of first peak 32P-Probe (second peak for free γ- 32P-dATP).
Prehybridization
The sample film is placed plastics bag, and adding 3-10mg prehybridization solution (10 * Denhardt ' s; 6 * SSC, 0.1mg/mlCT DNA (calf thymus DNA).), seal sack after, 68 ℃ of water-baths were shaken 2 hours.
Hybridization
Plastics bag is cut off one jiao, adds the probe prepare, seal sack after, 42 ℃ of water-baths are shaken and are spent the night.
Wash film: high strength is washed film:
1) good sample film has been hybridized in taking-up.
2) 2 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃.
3) 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃.
4) 0.1 * SSC among the 0.1%SDS, washes 30 minutes (2 times) for 55 ℃, and room temperature is dried.Low strength is washed film:
1) good sample film has been hybridized in taking-up.
2) 2 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 37 ℃.
3) 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 37 ℃.
4) 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃, and room temperature is dried.
X-light autography:
-70 ℃, X-light autography (the compressing tablet time decides according to hybridization spot radioactivity is strong and weak).
Experimental result:
Adopt low strength to wash the hybrid experiment that the film condition is carried out, more than two strong and weak not obviously differences of probe hybridization spot radioactivity; And adopting high strength to wash the hybrid experiment that the film condition is carried out, the hybridization spot radioactive intensity of probe 1 obviously is better than the radioactive intensity of another probe hybridization spot.Thereby available probe 1 is qualitative and analyze existence and the differential expression of polynucleotide of the present invention in different tissues quantitatively.Embodiment 7 DNA Microarray
Gene chip or gene micromatrix (DNA Microarray) are that present many National Laboratories and big drugmaker are all in the new technology of setting about developing and developing, it is meant and is arranged in a large amount of target fragments on the carriers such as glass, silicon in an orderly manner, to high-density, carry out the comparison and the analysis of data then with fluoroscopic examination and computer software, to reach purpose quick, efficient, that bioinformation is analyzed on high-throughput ground.Polynucleotide of the present invention can be used as target DNA and are used for biochip technology and are used for high-throughput and study new gene function; Seek and the new gene of the screening tissue specificity new gene of disease-related such as tumour particularly; The diagnosis of disease is as heredopathia.The existing in the literature multiple report of its concrete grammar step is as consulting document DeRisi, J.L., Lyer, V.﹠amp; Brown, P.O. (1997) Science278,680-686. and document Helle, R.A., Schema, M., Chai, A., Shalom, D., (1997) PNAS 94:2150-2155. () point sample
Various full-length cDNA amounts to 4000 polynucleotide sequences as target DNA, comprising polynucleotide of the present invention.They are increased by PCR respectively, behind the purifying gained amplified production its concentration is transferred to about 500ng/ul, (available from U.S. Cartesian company) puts on glass medium with Cartesian 7500 point sample instruments, and distance between points is 280 μ m.Slide behind the point sample is carried out hydration, drying, places UV-crosslinked instrument crosslinked, and the wash-out after drying is fixed on DNA and is prepared into chip on the sheet glass.The existing in the literature multiple report of its concrete grammar step, the point sample post-processing step of present embodiment is:
1. hydration 4 hours in the wet environment;
2.0.2%SDS washed 1 minute;
3.ddH 2The O washed twice, each 1 minute;
4.NaBH 4Sealed 5 minutes;
5.95 in ℃ water 2 minutes;
6.0.2%SDS washed 1 minute;
7.ddH 2Twice of O flushing;
8. airing, 25 ℃ to be stored in the dark place standby.(2) probe mark
With the single stage method total mRNA of extracting from human body mixed structure and body particular organization (or through stimulated cells strain) respectively, and with Oligotex mRNA Midi Kit (available from QiaGen company) purified mRNA, by reverse transcription respectively with fluorescent reagent Cy3dUTP (5-Amino-propargyl-2 '-deoxyuridine 5 '-triphatecoupled to y3 fluorescent dye, available from Amersham Phamacia Biotech company) mRNA of mark human body mixed structure, with fluorescent reagent Cy5dUTP (5-Amino-propargyl-2 '-deoxyuridine5 '-triphate coupled to Cy5 fluorescent dye, available from Amersham Phamacia Biotech company) mRNA of mark body particular organization (or through stimulated cells strain), prepare probe after purified.Concrete steps reference and method are seen: Schena, M., Shalon, D., Heller, R. (1996) Proc.Natl.Acad.Sci.USA.Vol.93:10614-10619.Schena, M., Shalon, Dari., Davis, R.W. (1995) Science.270. (20): 467-480. (three) hybridization
Respectively will be from the probe of above two kinds of tissues with chip at UniHyb TMHybridized 16 hours in HybridizationSolution (available from the TeleChem company) hybridization solution, room temperature washings (1 * SSC, 0.2%SDS) the washing back is scanned with ScanArray 3000 scanners (available from U.S. General Scanning company), the image of scanning carries out data analysis with Imagene software (U.S. Biodi scovery company) to be handled, and calculates the Cy3/Cy5 ratio of each point.
Be respectively the Ecv304 cell strain of thymus gland, testis, muscle, spleen, lung, skin, Tiroidina, liver, PMA+, the Ecv304 cell strain of PMA-, not hungry L02 cell strain, L02 cell strain and the prostata tissue that arsenic stimulates 1 hour with upper machine body particular organization (or through stimulated cells strain).Draw folding side figure according to these 13 Cy3/Cy5 ratios.(Fig. 1).People's junctional adhesion molecule 12 of the present invention as seen from the figure is very similar with people's junctional adhesion molecule express spectra.
Sequence table (1) general information: (ⅱ) denomination of invention: people's junctional adhesion molecule 12 and encoding sequence thereof (ⅲ) sequence number: the information of 9 (2) SEQ ID NO:1: (ⅰ) sequence signature:
(A) length: 1996bp
(B) type: nucleic acid
(C) chain: two strands
( D ) ： ( ⅱ ) ：cDNA ( ⅹⅰ ) ：SEQ ID NO:1: 1 GGAGATCCTGCATACAGACTCAGTTGTGGTTCACAAATTGCGTTCCAATAAAAATGAAGA 61 AAGCGCAGAGTTTTAAAAAACAAATATTTTTAGCATAAACTATTGAAAGGGAAGCACTGG121 GGGGACCTCAGCTTCATTTATCAGTCTTTCATCTACTCCTTGCAGCAAGAGCTCATACCC181 TTTCCCTATGTGTTTTTTGTTTATTCATTTATTCATGTATTTGTTTTTTCTGCAGCTTTT241 AAAATATTAAGGGTTGTTTGTAAGATAAGGTTGTTACCAACTTGGGTGGAGGTAGGAGTA301 CGGTTGCTCTTTGTAAAATGGCAAATGTACATGCAGGCAACCTTTTTAAATCAAATTATA361 ATTTATTTAGAAGTACGACATGTCAGCATTATCCGCATTTGCAAAATGGCCTCCCTCTCT421 ACTTATATACTTATTCAGAAAACACATTCAGAATGTGCCAATTGGTCTTTTTTGATATTT481 TTCGCAAGCACAGAGGAAAACCGTATTGGAAAGGGTAAAACAGACCACAGCAGGATTAAA541 AGCTCCTGTCAGAAAATTTCCTCAGAAGGCTTGTATCATTACAAAATGTACCCCTGGAGT601 CTGCATTTTCATATCTTGCTGAAATTCAAGATACACATGAATAAAGGATTGGGAATCTAA661 ATGTAATAAGTAGTAAATTATCAGTTCATCAGGATCAAAGAGACAAAAGACTGCACTATA721 GAGAAGGCATAGAAGTAACAAGAATGAAGAACTAGATAATTTGCTTTAAATACATATAAG781 TTATTTTACATTTCTTCCATATGAAACCAATTTATTCTGCTGAGTGATTTCACAGATAAA841 GGTGTTACTTACTTGACTTCACCATGACAAGAAAAGGACAAGTTTTTTTAAGCAGCATCT901 TTATGAATTTTTTATCAGTGGCAGATATTTTAATGGGCTGCATTTTTACAAATTCCTGAT 961 ATATTCTGGAGACCTGTGGTACATTTTTGCTACTCTGGAGATATAAATTAAATTAGCATG1021 ATGTATTGCCAAGGACCAGCACGTGGATTGTCTACATTGTGATCCATGAGGCACTGAGAG1081 GACTCGGCCCTCAGATACAACTCCCCTGGGTAGATGCCCAGGCAGAACCCAGCAAATGTA1141 TATGCATCTCTGGGCTCTGAGGACAAAATGCCTTGAGAGTAAAGGGCACTTTCAGGGCTG1201 CCCTGAGGAGGTGCTTTCTGGACATTCTAGGAACTCTGAGCAGGAGCATGGCTCCCATAC1261 TGTTTTTCCTTAGGGCCTGTTTTGAATAATAGTGTTTTTCTGAATATATAACCAAGCATT1321 TTCTCTGGACTGGAAGCCACATTTGATCCCTGGTTCTCAGAAATCTGGGTTTGGTGGTTC1381 TGTCTTTATAGATACTTGTACACATCACAAAATCACCAAATTTGGGGAAATGCCAACCAT1441 ACTTTGAGAGAATAAATATGAGCAGTTGTGCCTACTTGCATAGGGGAGCCTGTGTAAAAA1501 GTCAGTGATTCCGTAGGCTCTTTTCCTGCACTAACCAGTGCAGTTAATACCTCACTTTCA1561 TGAACAGCAAACTCATGGCAACATTAAGTGAATCATGGCCGGGCGCAGTGGCTCACGCCT1621 GTAATCCCAGTACTTTGGGAGGCCAAGGCGGGTGGATCACCTGAGGTCAGGAGTTCAAGA1681 CGGGCCTGGCCAACATAGTGAAACCCCATCTCTACTAAAAAATACAAAAAATTAGCCGGG1741 CGTGGTGGCAGACGCCTGTAATCTCAGCTGCTCGGGAGGCTGAGGCAGGAGAATTGCTTG1801 AACCCGGGGAGTGGAGGTTGCAGTGAGCCAAGATTGTGCCACTGCACTCCAGCCTGGGTG1861 ACAGAGTGAGACTCTGTCTTTAAAAAAAAAAAAAGATTCATGTCCTTAGATTAGATTGTA1921 AGCCCACTGGGCAGGTACTGTGTCTAATGTTTTGTGTGGCACCTGTCACATTGTTAGAGC1981 TCAATAAACGTTCAAC ( 3 ) SEQ ID NO:2： ( ⅱ ) ：
(A) length: 111 amino acid
(B) type: amino acid
(D) topological structure: linear (ⅱ) molecule type: polypeptide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO:2:1 Met Tyr Met Gln Ala Thr Phe Leu Asn Gln Ile Ile Ile Tyr Leu16 Glu Val Arg His Val Ser Ile Ile Arg Ile Cys Lys Met Ala Ser31 Leu Ser Thr Tyr Ile Leu Ile Gln Lys Thr His Ser Glu Cys Ala46 Asn Trp Ser Phe Leu Ile Phe Phe Ala Ser Thr Glu Glu Asn Arg61 Ile Gly Lys Gly Lys Thr Asp His Ser Arg Ile Lys Ser Ser Cys76 Gln Lys Ile Ser Ser Glu Gly Leu Tyr His Tyr Lys Met Tyr Pro 91 Trp Ser Leu His Phe His Ile Leu Leu Lys Phe Lys Ile His Met106 Asn Lys Gly Leu Gly Ile (4) SEQ ID NO:3
(A) length: 24 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO:3:GGAGATCCTGCATACAGACTCAGT 24 (5) SEQ ID NO:4
(A) length: 24 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO:4:GTTGAACGTTTATTGAGCTCTAAC 24 (6) SEQ ID NO:5
(A) length: 33 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO:5:CATGCTAGCATGTACATGCAGGCAACCTTTTTA 33 (7) SEQ ID NO:6
(A) length: 33 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: the information of SEQ ID NO:6:CATGGATCCTTAGATTCCCAATCCTTTATTCAT 33 (8) SEQ ID NO:7: (ⅰ) sequence signature:
(A) length: 15 amino acid
(B) type: amino acid
(D) topological framework: linear (ⅱ) molecule type: polypeptide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO:7:Met-Tyr-Met-Gln-Ala-Thr-Phe-Leu-Asn-Gln-Ile-Ile-Ile-Tyr-Leu 15 (9) SEQ ID NO:8
(A) length: 41 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO:8:TGTACATGCAGGCAACCTTTTTAAATCAAATTATAATTTAT 41 (10) SEQ ID NO:9
(A) length: 41 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: SEQ ID NO:9:TGTACATGCAGGCAACCTTTCTAAATCAAATTATAATTTAT 41

Claims (18)

1, a kind of isolated polypeptide-people's junctional adhesion molecule 12 is characterized in that it includes: the polypeptide of the aminoacid sequence shown in the SEQ ID NO:2 or active fragments, analogue or the derivative of its polypeptide.
2, polypeptide as claimed in claim 1, the aminoacid sequence that it is characterized in that described polypeptide, analogue or derivative has the homogeny with the aminoacid sequence at least 95% shown in the SEQ ID NO:2.
3, polypeptide as claimed in claim 2 is characterized in that it comprises the polypeptide with the aminoacid sequence shown in the SEQ ID NO:2.
4, a kind of isolating polynucleotide, it is characterized in that described polynucleotide comprise be selected from down the group in a kind of:
(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2 or its fragment, analogue, derivative;
(b) with polynucleotide (a) complementary polynucleotide; Or
(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.
5, polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise the polynucleotide that coding has aminoacid sequence shown in the SEQ ID NO:2.
6, polynucleotide as claimed in claim 4, the sequence that it is characterized in that described polynucleotide include the sequence of 1-1996 position among the sequence of 325-660 position among the SEQ ID NO:1 or the SEQ ID NO:1.
7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that it is the recombinant vectors that is formed by the described polynucleotide of arbitrary claim among the claim 4-6 and plasmid, virus or vehicle expression vector establishment.
8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell:
(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or
(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.
9, a kind of preparation method with the active polypeptide of people's junctional adhesion molecule 12 is characterized in that described method comprises:
(a) under expressing human junctional adhesion molecule 12 condition, cultivate the described through engineering approaches host cell of claim 8;
(b) from culture, isolate and have the active polypeptide of people's junctional adhesion molecule 12.
10, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with people's junctional adhesion molecule 12 specificity bonded antibody.
11, the compound of an analoglike or adjusting polypeptide active or expression is characterized in that they are simulation, promotion, antagonism or the active compound that suppresses people's junctional adhesion molecule 12.
12, compound as claimed in claim 11 is characterized in that it is the polynucleotide sequence shown in the SEQ ID NO:1 or its segmental antisense sequences.
13, the described application of compound of a kind of claim 11, it is characterized in that described compound be used for mediator's junctional adhesion molecule 12 in vivo, the method for external activity.
14, a kind of disease relevant or method of disease susceptibility of detecting with the described polypeptide of arbitrary claim among the claim 1-3, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide, perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.
15, as the application of polypeptide as described in the arbitrary claim among the claim 1-3, it is characterized in that it is applied to screen the stand-in of people's junctional adhesion molecule 12, agonist, antagonist or inhibitor; Perhaps be used for the peptide finger print identification.
16, as the application of the described nucleic acid molecule of arbitrary claim among the claim 4-6, it is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps be used for hybridization, perhaps be used to make gene chip or microarray as probe.
17,, it is characterized in that forming pharmaceutical composition with safe and effective dosage and pharmaceutically acceptable carrier as diagnosis or the treatment disease relevant unusually with people's junctional adhesion molecule 12 with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor as the described polypeptide of arbitrary claim, polynucleotide or application of compound in claim 1-6 and 11.
18, the described polypeptide of arbitrary claim, polynucleotide or the application of compound among the claim 1-6 and 11, it is characterized in that being used for the treatment of as malignant tumour with described polypeptide, polynucleotide or compound, hemopathy, the medicine of HIV infection and immunological disease and all kinds of inflammation.
CN 00114911 2000-03-15 2000-03-15 Polypeptide-human junctional adhesion molecule 12 and polynucleotide for coding it Pending CN1313327A (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN 00114911 CN1313327A (en) 2000-03-15 2000-03-15 Polypeptide-human junctional adhesion molecule 12 and polynucleotide for coding it
AU42224/01A AU4222401A (en) 2000-03-15 2001-02-26 Novel polypeptide---a human linker adhesion molecule 12 and polynucleotide encoding it
PCT/CN2001/000167 WO2001068873A1 (en) 2000-03-15 2001-02-26 Novel polypeptide---a human linker adhesion molecule 12 and polynucleotide encoding it

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 00114911 CN1313327A (en) 2000-03-15 2000-03-15 Polypeptide-human junctional adhesion molecule 12 and polynucleotide for coding it

Publications (1)

Publication Number Publication Date
CN1313327A true CN1313327A (en) 2001-09-19

Family

ID=4584386

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 00114911 Pending CN1313327A (en) 2000-03-15 2000-03-15 Polypeptide-human junctional adhesion molecule 12 and polynucleotide for coding it

Country Status (3)

Country Link
CN (1) CN1313327A (en)
AU (1) AU4222401A (en)
WO (1) WO2001068873A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060171885A1 (en) * 2002-11-25 2006-08-03 Giselle Janssen Skin or hair binding peptides

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1068225A2 (en) * 1998-04-07 2001-01-17 Roche Diagnostics GmbH New compounds for dna-transfection
EP1131097A1 (en) * 1998-11-17 2001-09-12 Fred Hutchinson Cancer Research Center Anti-icam-r antibody-induced apoptosis

Also Published As

Publication number Publication date
WO2001068873A1 (en) 2001-09-20
AU4222401A (en) 2001-09-24

Similar Documents

Publication Publication Date Title
CN1313324A (en) Polypeptide-human hypoxia induction factor Lalpha subunit 13 and polynucleotide for coding it
CN1313328A (en) Polypeptide-human primary cadherin 14 and polynucleotide for coding it
CN1314476A (en) New polypeptide-human phosphatidylinositol 3 (PtdIns 3)-kinase 36 and polynucleotide for coding such polypeptide
CN1345935A (en) Novel polypeptide-human histone deacetylated enzyme 12.98 and polynucleotide for encoding said polypeptide
CN1313327A (en) Polypeptide-human junctional adhesion molecule 12 and polynucleotide for coding it
CN1351058A (en) Polypeptide-human RNA splicing factor htra2-beta protein 9.24 and polynucleotide for coding it
CN1314367A (en) New polypeptide-human mitochondrion ATP ase coupling factor 6-10 and polynucleotide for coding such polypeptide
CN1313329A (en) Polypeptide-human excitatory amino acid rotor 16 and polynucleotide for coding it
CN1311251A (en) New polypeptide-human cell periodic modulation factor and polynucleotide for coding such polypeptide
CN1313292A (en) Polypeptide-amyloid precusor protein bindin 13 and polynucleotide for coding it
CN1355205A (en) Polypeptide-human transcription regulaton factor 11.44 and polynuceotide for coding it
CN1363591A (en) Polypeptide-human cytochrome core protein-15.29 and polynucleotide for coding it
CN1313299A (en) Polypeptide-human excitatory amino acid transporter 17 and polynucleotide for coding it
CN1352277A (en) New polypeptide-human P70 ribosome S6 kinase 10.34 and polynucleotide for encoding such polypeptide
CN1311225A (en) New polypeptide-human GM2 activating protein 14 and polynucleotide for coding said polypeptide
CN1352019A (en) New polypeptide-CAK1 antigen 9.46 and polynucleotide for encoding such polypeptide
CN1312267A (en) Human NF-E2 correlation factor 14 as one new polypeptide and polynucleotides encoding this polypeptide
CN1363600A (en) Polypeptide-human interleukin enhancing binding factor 1-10.01 and polynucleotide for coding it
CN1358750A (en) Novel polypeptide-human tumor related nucleoprotein 39.16 and polynucleotide for encoding said polypeptide
CN1351018A (en) Polypeptide-SR protein RNPS 143.1 and polynucleotide for coding it
CN1352048A (en) New polypeptide-human shearing protein 9.9 and polynucleotide for encoding such polypeptide
CN1312263A (en) Human interleukin intensifying binding factor 1-12 as one new polypeptide and polynucleotide encoding this polypeptide
CN1363588A (en) Polypeptide-human cell cycle control gene 27.11 and polynucleotide for coding it
CN1352141A (en) New polypeptide-human membrane-vesicle transport protein 21.23 and polynucleotide for encoding such polypeptide
CN1351049A (en) Polypeptide-humn RNA splicing factor htra2-beta protein 43.23 and polynucleotide for coding it

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication