CN1309738C - Anti IL-8 monoclonal antibody, sequence of its variable region and application - Google Patents

Abstract

The present invention discloses a monoclonal antibody for neutralizing the biological activity of interleukin-8(IL-8), and a variable region sequence thereof. In the monoclonal antibody, IL-8 is taken as immunogens, and mice are taken as immune objects; immune injection is carried out to the mice; the spleens of the immunized mice are used for preparing suspension which generates cell fusion with myeloma cells for obtaining hybridoma cell strains which can express the anti-IL-8 monoclonal antibody, for preparing the anti-IL-8 monoclonal antibody. The present invention simultaneously clones the variable region amino acid sequence of the anti-IL-8 monoclonal antibody. The anti-IL-8 monoclonal antibody can generate specificity combination with IL-8, and therefore, the anti-IL-8 monoclonal antibody can be used for treating diseases relevant to the abnormal or excessive expression and secretion of IL-8 or the expression and the secretion of IL-8 out of control.

Description

Anti-IL-8 monoclonal antibody, its variable region sequences and application thereof

Technical field

The invention belongs to biological technical field, specifically, the invention relates to a kind of have in and the bioactive anti-IL-8 monoclonal antibody of interleukin 8 (IL-8), its variable region sequences and application thereof.

Background technology

Interleukin 8 (IL-8) is a kind of protein molecular that is referred to as chemokine (Chemokine) in the cytokine (Cytokine).In the chemokine extended familys, halfcystine (Cysteine) position of holding according to N in their molecular structures can be divided into C-X-C class chemokine and C-C class chemokine.IL-8 belongs to C-X-C class chemokine, and molecular weight is 8, about 000Da.IL-8 is the strong chemotactic and the incitant of neutrophilic granulocyte, and energy compile powerfully and activate neutrophilic granulocyte, has wide biological activity in many physiology or pathologic process, plays key effect in inflammatory process.IL-8 can be produced by the cell of multiple participation inflammatory reaction and secretion, as scavenger cell, neutrophilic granulocyte, lymphocyte, endotheliocyte, keratinocyte or the like, it acts on multiple inflammatory cells such as endotheliocyte, neutrophilic granulocyte and T lymphocyte then, thereby forms inflammatory reaction.A lot of human diseasess are expressed unusual or excessive, out of control relevant with excretory with the interior IL-8 of body.

Antibody is a kind of protein molecular that is produced by bone-marrow-derived lymphocyte, is made up of with two identical light chains two identical heavy chains.Light chain and heavy chain be each free variable region and constant region composition again.Antibody combines by amino acid sequences with the specificity of corresponding antigens and determines.Monoclonal antibody (McAb monoclonal antibody) technology was firstly appeared in 1975, can obtain to have with corresponding antigens the monoclonal antibody of specific binding activity then through the hybridoma technology screening with the antigen immune mouse.

Summary of the invention

The object of the present invention is to provide a kind of anti-IL-8 monoclonal antibody.

Second purpose of the present invention is to provide the variable region amino acid sequence of anti-IL-8 monoclonal antibody.

The 3rd purpose of the present invention is to provide the application of anti-IL-8 monoclonal antibody.

The present invention is immunogenic with IL-8, with mouse is immune object, by the immunization mouse, get the immune mouse spleen and prepare suspension, and make it to carry out cytogamy and obtain to express the hybridoma cell strain of anti-IL-8 monoclonal antibody to prepare anti-IL-8 monoclonal antibody with the myeloma cell.

The heavy chain of the present invention clone's anti-IL-8 monoclonal antibody and the variable region amino acid sequence of light chain are respectively shown in SEQ IDNo.1 and 2.

Anti-IL-8 monoclonal antibody of the present invention can combine with the IL-8 specificity, therefore can be used for the treatment of with IL-8 to express and unusual or excessive, the out of control diseases associated of excretory.

Experimental results show that; anti-IL-8 monoclonal antibody of the present invention is expressed and unusual or excessive, the out of control diseases associated of excretory for above-mentioned IL-8; as psoriatic, eczema, tumour, SARS (Severe Acute Respiratory Syndrome) (SARS) etc.; all has tangible curative effect; and therefore the specificity height has good application prospects.

Description of drawings

Fig. 1 is 5 ' RACE product electrophorogram, and wherein No. 1 is the light chain result, No. 2 chain results that attach most importance to, and M is DL2000Marker (molecular weight is followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp from top to bottom).

Fig. 2 dyes electrophorogram for anti-IL-8 chimeric antibody silver, and wherein 1 is albumen Marker; 2 is hybridoma antibody; 3 is mosaic type antibody.

Embodiment

Below the invention will be further described by specific embodiment.Should be understood that following examples only to be used to the present invention is described and be not used in the scope of the present invention that limits.

The preparation of embodiment 1 anti-IL-8 monoclonal antibody hybridoma cell

1, immunogenic

The IL-8 of the gene recombination human body cells of monocytic origin that E.Coli expresses is made up of 72 amino acid, and molecular weight is 8.0KDa, and it has stronger biological activity than the IL-8 that is originated by the endotheliocyte of 77 amino acid groups.This gene recombination IL-8 produces (PeproTech Inc.) by U.S. PeproTech company, analyzes and SDS-PAGE silver staining mensuration its purity＞98% through N-terminal.Show that in chemistry trend activity test (Chemotaxis Assay) this gene recombination IL-8 has the effect of intensive chemistry trend to the human body neutrophil.

2, immune animal

The Balb/c mouse is by Charles River Laboratories, and Inc.Canada supplies.All immunity are anosis, the healthy purebred mouse of stdn with the Balb/c mouse, meet U.S. FDA and Canadian HPB required standard.

3, animal immune program

The 1st day: 200 μ l antigenic solutions (20 μ g IL-8/200 μ l PBS) added 200 μ l Fu Shi Freund's complete adjuvants (Sigma company, Catalogue number F5881), are mixed with 400 μ l antigen emulsions, are injected in subcutaneous multiple spot of mouse back and vola.

The 27th day: 200 μ l antigenic solutions (20 μ g IL-8/200 μ l PBS) added the incomplete freund adjuvant of 200 μ l (Sigma company, Catalogue number F5506), did abdominal cavity, vola injection.

The 86th day: injected dose, method were with the 27th day.

The 118th day: injected dose, method were with the 27th day.

The 179th day: 20 μ g/450 μ l PBS antigenic solutions were made abdominal injection.

The 183rd day: take out the immune mouse spleen, preparation spleen cell suspension was made cytogamy and is used.

4, cytogamy:

(1) myeloma cell

The strain of SP2/0-Ag14 murine myeloma cell is from U.S. ATCC (ATCC CRL-1581), and it is synthetic or secrete any mouse immuning ball protein heavy chain and light chain.This cell has resistance to guanozola, in HAT (xanthoglobulin, aminopurine and thymidine) nutrient solution (GIBCO company, Cat.No.21060-017) can't persistent survival in, when SP2/0-Ag14 has been widely used in preparing the hybridoma of secrete monoclonal antibody as the partner of fused cell.

(2) merge

A, get the SP2/0-Ag14 myeloma cell who is in logarithmic phase, (GIBCO company, Cat.No.11875) washed twice are counted standby with serum-free RPMI RPMI-1640.

B, get under the aseptic condition immune mouse spleen cell suspension of preparation,, count standby with serum-free RPMI1640 nutrient solution washed twice.

C, with spleen cell and SP2/0-Ag14 myeloma cell with 5: 1 mixed, centrifugal (1500rpm) 7 minutes abandons most supernatant liquor, then, in 1 minute, slowly add 1ml PEG (PEG4000, M.W.3,000-4,000, GIBCO, BRL Cat.No.14030-019), left standstill 1.5 minutes; In 2.5 minutes, add 5ml serum-free RPMI RPMI-1640 again, left standstill 5 minutes, add the 5ml serum-free medium at last again, centrifugal (1000rpm) 5 minutes, abandoning supernatant, add conventional RPMI-1640 (15% foetal calf serum, FBS GIBCO, BRL Cat.No.16000-044) and be prepared into cell suspension.

D, above-mentioned fused cell suspension is moved in the 96 well culture plate holes, 2 cell suspensions in every hole are put 37 ℃, 5%CO ₂In the incubator; Cultivate after 24 hours, every hole adds the HAT nutrient solution of 2 2x again, continues at 37 ℃, 5%CO ₂Incubator is cultivated.Changed the HAT nutrient solution in three days one time, change into after 7-10 days the HT nutrient solution (GIBCO company, Cat.No.11067-030).Cultivate the supernatant liquor that promptly begins to detect the clone cell hole after 12 days, filter out the clone of anti-IL-8 antibody positive with enzyme linked immunosorbent assay (ELISA method).

(3) cloning of hybridoma

Adopt limiting dilution assay, cell suspension is diluted to 3-10 cell/ml, then cell suspension is moved in 96 orifice plates, every hole adds 2 cell suspensions, puts 37 ℃ of 5%CO ₂Incubator is cultivated, and after this, changes 1/3 fresh training liquid in each hole every 2～3 days.Promptly carry out programmed screening and clone after about 10 days.Through continuous three subclones, each cloning efficiency must be less than 66.7%, and antibody positive rate is 100%, can determine that the cell of being cloned is a mono-clonal.

5, the feature of monoclonal antibody:

The immunoglobulin (Ig) hypotype is identified:

The Mouse Typer Sub-Isotyping Kit (Cat.No.172-2055BIORAD) that adopts U.S. BIORAD company to produce identifies that to hybridoma cell strain its result is: clone 6E6 (claiming I8-60 again) immunoglobulin (Ig) hypotype: IgG1, Kappa.

This cell strain 6E6 (I8-60) deposits in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) on November 18th, 2004, and it is numbered CGMCC No.1249.

The specificity of embodiment 2 anti-IL-8 authentic monoclonal antibodies

Get the anti-IL-8 monoclonal antibody that embodiment 1 obtains, respectively with other cytokines of same concentrations (μ l/ml), chemistry trend factor GM-CSF, TGF-β, MCAF, TNF-α, IL-7, IL-1 β, b-FGF, IL-16, MCP-3, M-CSF, EGF and with the IL-8 structure on homologous cytokine GRO α, PF-4, ENA78, NAP-2, GCP2 carry out cross reaction, the result that its ELISA detects is respectively as shown in Table 1 and Table 2.As seen, monoclonal antibody of the present invention and other cytokines, the chemistry trend factor and with the IL-8 structure on therefore equal no cross reaction of homologous cell, and IL-8 is had the specific reaction of height.

Table 1 ELISA method detects the cross reaction of this antibody to various cytokines/chemistry trend factor

Cytokine	IL-8	GM-CSF	TGF-β	MCAF	TNF-α	IL-7	IL-1β
								O.D. be worth	＞2.0	0.037	0.021	0.023	0.039	0.06	0.029
Cytokine	b-FGF	IL-16	MCP-3	M-CSF	EGF	BSA	HSA
								O.D. be worth	0.027	0.044	0.024	0.044	0.044	0.147	0.129

Table 2 ELISA method detects the cross reaction of this antibody to homologous cytokine on other and the IL-8 structure

Cytokine	IL-8	GRO α	PF-4	ENA78	NAP-2	GCP2
							O.D. be worth	＞2.0	0.097±0.008	0.113±0.04	0.073±0.009	0.031±0.004	0.088±0.007

In the embodiment 3 anti-IL-8 monoclonal antibodies and the ability of IL-8 chemistry chemotactic activity

Use cell tropism assay (Chemotaxis Assay) (Ben-Baruch A, et al.Cytokine.1997Jan; 9 (1): 37-45.), (separate from normal people's peripheral blood Liu WC, et al.Xibao YuFenzi Mianyixue Zazhi 1996 with people's neutrophilic granulocyte; 12:64-66) or 293 cell strains of stably express IL-8 acceptor (Ben-BaruchA, et al.Cytokine.1997 Jan; 9 (1): be indicator cells 37-45.), measure the inhibition ability of this antibody to the chemotaxis of IL-8.

This antibody dilution becomes 50 μ g/ml, 5 μ g/ml, 0.5 μ g/ml, four kinds of concentration of 0.05 μ g/ml, respectively with the IL-8 of 10ng/ml reaction, puts 37 ℃ after 30 minutes, and each is organized sample and injects the lower floor hole that the chemistry trend is measured cell respectively.293 cells (1 * 10 of 50 μ l people neutrophilic granulocytes or stably express IL-8 acceptor ⁶/ ml) be put in the hole, upper strata of cell.Polycarbonate leaching film with 10 μ m apertures between the cell levels separates.Cell is placed 37 ℃, 5%CO ₂Middle incubation took out filter membrane after 5 hours, with Dieff-QuicK dyeing, calculated neutrophilic granulocyte or 293 cell numbers on the film, and the result represents with the mean value of three parallel hole values.

Experiment showed, the concentration ratio of monoclonal antibody and IL-8 in 50: 1 o'clock can be effectively and IL-8 to the chemistry trend effect of 293 cells of neutrophilic granulocyte or stably express IL-8 acceptor.

Table 3

Anti-IL-8 monoclonal anti bulk concentration	IL-8 concentration	Ab∶Ag	Chemistry trend inhibiting rate
				50μg/mL	10ng/ml	5000∶1	118.25％
5μg/mL	500∶1	99.81％
			0.5μg/mL	50∶1		83.90％
0.05μg/mL	5∶1	17.09％

The structure of embodiment 4 mosaic type antibody eukaryon expression plasmids

1, the clone of the variable region sequences of anti-IL-8 monoclonal antibody among the hybridoma cell strain I8-60

Adopt 5 ' RACE (Rapid Amplification of cDNA Ends, rapid amplifying cDNA end) technology, the variable region sequences of cloning function antibody from the hybridoma cell strain I8-60 that secretes anti-people IL-8 mouse monoclonal antibody.Its step can be sketched and be: the gene-specific primer (GSP1) by an antisense synthesizes cDNA first chain, behind the cDNA first chain purifying, (Terminal deoxynucleotidy transferase, TdT) 3 ' end at cDNA adds a synthetic homopolynucleotide anchor series to utilize terminal deoxynucleotidyl transferase.Utilize second nido gene-specific primer (GSP2) and one and the homopolynucleotide tail cDNA that can the annealed anchor primer increases.Concrete experimentation is as follows:

Material:

-hybridoma cell strain 6E6 (I8-60) secretes anti-people IL-8 monoclonal antibody

-coli strain Top10 (Invitrogen company, Cat.No.C4040-03)

-cloning vector pGEM-T-easy (Promega company, Cat.No.A1360)

Design of primers:

According to the characteristics of immunoglobulin gene, gene-specific primer GSP1, the GSP2 of design two cover corresponding Ig of difference and Kappa constant region, primer sequence is as follows:

pRace-H-GSP1：GTCCACCKYGGTSYTGCTGGCYGGGTG

pRace-H-GSP2：GCACACYRCTGGACAGGGATCCAGAGTTCC

pRace-K-GSP1：ACTTGACATTGATGTCTTTG

pRace-K-GSP2：CACGACTGAGGCACCTCCAGATG

Clone's process:

1) first chain is synthetic

With total RNA is template, is primer with GSP1, synthetic cDNA first chain under the effect of ThermoScript II.Concrete steps are:

1. in the Eppendorf tube of a 0.5ml, add following component:

GSP1 2.5pmol

Total RNA 1-5 μ g

Replenishing water to the cumulative volume of handling through DEPC is 15.5 μ l, mixing.

2. 70 ℃ of sex change 10min, ice bath 1min of short durationly adds following component after centrifugal successively:

10x PCRbuffer 2.5μl

25mMgCl ₂ 2.5μl

10mM dNTP mix 1μl

0.1M DTT 2.5μl

3. mixing, of short duration centrifugal rearmounted 42 ℃ of 1min.

4. in reaction system, add 1 μ l SuperScriptTMII RT (Invitrogen company), gently the rearmounted 42 ℃ of reaction 50min of mixing.

5. reverse transcription finishes rearmounted 70 ℃ of 15min with termination reaction.

6. centrifugal 10-20 is placed on 37 ℃ second.

7. add 1 μ l RNase mix, mixing is placed on 37 ℃ of reaction 30min gently.

8. put the reaction tubes taking-up standby on ice.

2) purifying of cDNA

Use the QIAGEN QIAquick PCR of company purification kit.

1. add 5 times of volumes in the PB of reverse transcription system damping fluid in the reverse transcription reaction pipe, mixing.

2. the centrifugal post of QIAquick is placed the 2ml collection tube, sample is added centrifugal post, 13, centrifugal 60 seconds of 000rpm.

3. discard liquid, centrifugal post is put back in the original collection tube, add 0.75ml PE damping fluid in the centrifugal post of QIAquick, 13, centrifugal 60 seconds of 000rpm.

4. discard liquid, the centrifugal post of QIAquick is put back to original collection tube, 13, centrifugal 60 seconds of 000rpm.

5. the centrifugal post of QIAquick is placed a clean 1.5ml centrifuge tube, after QIAquick film central authorities add 30 μ l EE damping fluids, leave standstill 1 minute, 13, centrifugal 1 minute of 000rpm.

3) cDNA tailing

1. in the Eppendorf tube of a 0.5ml, add following component successively:

The water 6.5 μ l that DEPC handles

5×tailing buffer 5.0μl

2mM dCTP 2.5μl

The cDNA 10.0 μ l of purifying

Mixing

2. reaction tubes is put 94 ℃ keep 3min after, ice bath 1min, of short duration centrifugal postposition on ice.

3. add 1 μ l TdT, the rearmounted 37 ℃ of reaction 10min of mixing.

4. reaction tubes is placed 65 ℃ of effect 30min termination reactions, centrifugal be placed on standby on ice.

4)PCR

In the PCR of 0.2ml thin-walled tube, add following component

Aqua sterilisa 31.5 μ l

10×PCR Buffer 5.0μl

25mM MgCl ₂ 3.0μl

10mM dNTP mix 1.0μl

GSP2(10pmol/ul) 2.0μl

AAP(10pmol/ul) 2.0μl

dC-tailed cDNA 5.0μl

Taq enzyme 0.5 μ l

Add up to 50.0 μ l

React in the rearmounted PCR instrument of mixing.

5) PCR product electrophoresis purifying

The PCR product identifies through 1.5% agarose gel electrophoresis, the result as shown in Figure 1: wherein No. 1 is the light chain result, at about 500bp place one specific band is arranged; The chain result that attaches most importance to for No. 2 has a specific band at about 500bp place;

6) the pGEM-T easy test kit of use Promega company arrives pGEM-T easy carrier with the PCR product cloning, transformed into escherichia coli Top10 (Invitrogen company, Cat.No.C4040-03), detailed process is:

A) the PCR product reclaims the band of 500bp through 1.5% agarose gel electrophoresis, and final constant volume is in the aqua sterilisa of 20 μ l volumes;

B) in the Eppendorf tube of a 0.5ml, add following component:

2 * connection damping fluid, 5 μ l

PGEM-T-easy 50ng(1μl)

PCR product 25ng (about 3 μ l)

T4 ligase enzyme 1 μ l

The room temperature connection connected more than 16 hours in 2 hours or 4 ℃ behind the mixing.

C) transformed into escherichia coli competent cell is coated on the LB flat board that contains penbritin and IPTG, X-GAL, cultivates about 12 hours for 37 ℃.

7) measure the base sequence of the PCR product cloned: respectively choose the base sequence that at least 5 plasmids are measured its contained PCR product.

8) according to the corresponding relation of base sequence and amino acid coding, analyze the reading frame of PCR product, determine corresponding amino acid sequences, the sequence of its heavy chain and light chain is respectively shown in SEQ ID No.1 and 2.Verify that according to the characteristics of immunoglobulin gene it is an antibody sequence.

2, the IgG1 of clone's human antibody and the constant region of kappa chain

Design of primers:

With the IgG1 of human antibody in the ncbi database and the constant region sequence of kappa chain is template, designs two pairs of primers, the constant region sequence of clone people respectively endogenous light chain and heavy chain, and primer sequence is as follows:

p-CH-F：CCAAGGGCCCATCGGTCTTC

p-CH-R：GCGCTTAAGTCATTTACCCGGAGACAGG

p-CK-F：GCGTACGGTGGCTGCACCATCTGTCTTCATC

p-CK-R：GCCTCGAGTCATTTACCCGGAGACAGGGAG

After PCR increases the constant region sequence of people's endogenous light chain and heavy chain respectively, use ApaI ﹠amp respectively; PstI, BsiWI ﹠amp; The NotI enzyme is cut, connect into the eukaryon expression plasmid pcDNA3.1 that cuts through the same enzyme enzyme (Invitrogen company, Cat.No.V795-20) in.

3, the structure of expression plasmid

Sequence with 5 ' RACE sequencing result gained is a template, designs two pairs of primers respectively through variable region sequences and the signal peptide sequence amplification of PCR with mouse source functional antibody gene, respectively by NheI ﹠amp; ApaI, EcoRV ﹠amp; Be connected to after the BsiWI enzyme is cut among the pcDNA3.1 that contains above-mentioned human antibody IgG1 and kappa chain constant region that cuts with the same enzyme enzyme, obtain mosaic type antibody eukaryon expression plasmid.

Primer sequence is as follows:

p-VH-F：CGGCTAGCCACCATGGACATGAGGGTGCC

p-VH-R：GCGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCG

p-VK-F：GCGATATCCACCATGGATTTTCAGGTGCAG

p-VK-R：GCGGCGTACGTTTTATTTCCAGCTTGGT

Embodiment 5 mosaic type antibody expressions

With liposome transfection Chinese hamster ovary celI (available from Chinese Academy of Sciences's cell bank), obtain the stable transfected cells strain.Concrete grammar is:

1) transfection kind the day before yesterday 3 * 10 ⁶Cell is in the 10cm flat board, and 10ml fresh medium (DMEM+10%FBS) was changed in transfection in preceding 3 hours;

2) transfection: 10ug heavy chain plasmid and 10ug light chain plasmid are joined in the A pipe that 1.5ml DMEM is housed, gentle mixing, room temperature is placed 5min; Simultaneously, 60ul Lipofectamine2000 is joined in the B pipe that 1.5ml DMEM is housed, gentle mixing, room temperature is placed 5min.A, B two pipe liquid are merged, mixing gently, room temperature is placed 20min.The DNA-Lipofectamin2000 mixture is dropwise joined in the Chinese hamster ovary celI training liquid.37 ℃, CO ₂After cultivating 6hr in the incubator, change training liquid, after continuing to cultivate 48hr,, continue to cultivate after 10-14 days, select mono-clonal cell dilution in 1: 10.

Embodiment 6 mosaic type purifying antibody

Adopt protein A affinity chromatography purifying chimeric antibody.Concrete steps are: (1) cleans protein A affinity column with the water of 3-5 times of column volume.(2) 20mM phosphoric acid buffer, pH7.0 balance protein A affinity column.(3) the monoclonal antibody sample with required purifying pumps into protein A affinity column.(4) use the 20mM phosphoric acid buffer, pH7.0 washes post, to OD280＜0.01.(5) with 0.1M citric acid-sodium citrate damping fluid, the pH3.0 wash-out is collected elution peak, and adds in the Tris-HCl damping fluid of 1M pH9.0 and the antibody-solutions of collecting.(6) use 10mM PBS, the pH7.2 dialysis desalting.Electrophorogram is seen Fig. 3.Chimeric antibody is measured through HPLC behind the purifying, and its purity is 95.89%.

The immunocompetence of embodiment 7 mosaic type antibody is measured

Adopt the Elisa method that the immunocompetence of mosaic type antibody is measured, and compare with mouse source property hybridoma antibody.The result of table 4 shows that the immunocompetence of mosaic type antibody and mouse source property hybridoma antibody do not have significant difference.

Table 4 mosaic type antibody and mouse source property hybridoma antibody Elisa result are relatively

	Mouse anti-IL8Ab			Chimeric anti-IL8Ab
							Concentration (ng/ml)	30	15	3	30	15	3
OD 450	1.091	0.626	0.352	1.898	1.092	0.406
							OD 450	1.269	0.708	0.377	2.001	1.14	0.398
Mean value	1.18	0.667	0.3654	1.9495	1.116	0.402

Elisa plate coated with 1ug/ml IL-8.

second antibody：goat anti-mouse protein L-HRP conjugated

The biological function of embodiment 8 mosaic type antibody is measured

Adopt the experiment of micropore cell chemotactic to detect the inhibition effect of mosaic type antibody to the IL-8 chemotactic activity.The result of table 5 shows that 1ug/ml mosaic type antibody capable obviously suppresses the chemotactic activity of IL-8, and its inhibiting rate and mouse source property hybridoma antibody do not have significant difference.

Table 5 mosaic type antibody and mouse source property hybridoma antibody chemotactic experimental result are relatively

IL-8 antigen concentration (ng/ml)	Antibody	Antibody concentration (ug/ml)	Chemotactic index	Inhibiting rate (%)
					20	mouse anti-IL8	10	1.22	91.10
20	mouse anti-IL8	1	1.46	81.06
					20	mouse anti-IL8	0.1	2.24	48.88
20	chimeric anti-IL8	10	1.60	75.13
					20	chimeric anti-IL8	1	1.48	80.15
20	chimeric anti-IL8	0.1	2.25	48.20

The application of embodiment 9 anti-IL-8 monoclonal antibodies

1) contains the preparation of the cold cream of 0.004% anti-Ro 24-7472/000-8 monoclonal antibody drug

Used matrix is:

Dimethyl silicone oil 20g

Whiteruss 10g

Stearic acid 10g

Hexadecanol 1g

Stearyl alcohol 3g

Glycerine 20g

Ethyl p-hydroxybenzoate 0.1g

Peregal A-20 0.36g

Softener sg 0.84g

Distilled water adds to 100g

At first matrix is mixed, be heated to 80 ℃, continue to stir 0.5 hour, be cooled to 35 ℃ then, draw soup with dropper and in the matrix of continuous stirring, drip, continue to stir 30 minutes, be used for the research of following psoriatic and eczema to evenly making cold cream.

2) the psoriatic clinical study result of treatment

Result according to I, II, III clinical trial phase, spirit with national Bureau of Drugs Supervision medicine assessment centers certification, is group leader unit in 2001.8～2002.8 by Inst. of Dermatology, Chinese Academy of Medical Sciences, with the whole nation 17 tame central hospitals, the cold cream of this anti-IL-8 Monoclonal Antibody treatment psoriasis vulgaris and palmar and plantar pustula psoriasis patient are carried out the IV clinical trial phase.With large sample, multicenter, the long course of treatment, open clinical trial, deeply observe psoriatic curative effect of this cold cream external curing and security.For wide clinical application provides reliable scientific information.

Clinical selected altogether 1431 routine psoriasis vulgaris of IV phase use this cold cream, wipe skin every day outward and decrease 2 times, use for 8 weeks continuously.1365 examples finished for 8 courses of treatment in week; Selected 99 routine palmar and plantar pustula psoriasis, 87 examples finished for 8 courses of treatment in week.Clinical trial this time amounts to MethodsThe cases enrolled 1530 examples altogether, finish 8 the courses of treatment 1452 in week example.

1 year clinical research observation through 18 medical institutions of tame clinical Dermatology Department, the result shows that this cold cream treatment psoriasis vulgaris is after 8 weeks, the symptom of every observation, sign, promptly the target skin decreases diameter, erythema, skin depth infiltration, the scales of skin that peel off, the degree of scratching where it itches integration, significantly reduces (the P value is all less than 0.001).This cold cream has stronger therapeutic action.After treating for 8 weeks, the rate 17.85% that is almost recovered, efficient 61.91%.Clinical data shows by analysis, and this cold cream is to drop shape, coin shape, stigma bulk and mix shape psoriatic lesion shower, and better curative effect is all arranged, and is the best with the drop shape.To the phase of carrying out or stationary phase psoriatic all effective in cure, be good with the phase of carrying out.

Cured person 226 examples in these 8 weeks of cold cream treatment psoriasis vulgaris continue to follow up a case by regular visits to for 8 weeks again, and recurrence rate only is 5.8%.After showing this cold cream treatment, the state of an illness is still stable, is difficult for the knock-on recurrence.

This cold cream treatment palmar and plantar pustula psoriasis is after 8 courses of treatment in week, every clinical observation symptom, sign, be that the target skin decreases diameter, warts quantity, erythema, blister, the scales of skin that peel off, scratches where it itches and the degree integration of pain, descend significantly (the P value is all less than 0.001), the cardinal symptom and the sign of disease had significant curative effect.After 8 week treatments, the palm toe psoriasis pustulosa rate 14.8% that is almost recovered, efficient 60.5%.Therefore, the IV clinical trial phase shows this cold cream treatment palm toe psoriasis pustulosa good effect.

In a word, cold cream treatment psoriatic IV clinical trial phase through this anti-IL-8 Monoclonal Antibody, in conjunction with I, II, III clinical trial phase result, but prove this cold cream external curing various types of carry out the phase or stationary phase psoriasis vulgaris, and external curing palmar and plantar pustula psoriasis.Long-term treatment is not only safe but also effective, and patient's compliance height is difficult for recurrence.Can be extended to wide clinical application.

3) treatment of eczema and research

The cold cream of anti-IL-8 Monoclonal Antibody is to the preliminary treatment result of eczema

Case	Curative effect
			Produce effects	Invalid
	8	5			3

4) result of study of treatment tumour

An obvious characteristic of solid tumor growth is exactly that the strict neovascularity that relies on generates.Folkman infers that at first tumor growth is an angiogenesis-dependent, and growth of tumor requires to be accompanied by the increase of blood supply.IL-8 exists as a kind of short angiogenesis factor in people's nonsmall-cell lung cancer (NSCLC) tissue that a lot of documents have been reported in fresh separated.IL-8 is a kind of effectively short angiogenesis factor as a member of CXC chemokine family.Carrying out animal experiment with IL-8, the tumour of transplanting is being carried out immunohistochemical analysis show that IL-8 is positioned people's tumour cell.Because of mouse can't produce IL-8, and anti-people IL-8 antibody and mouse homology CXC chemokine no cross reaction, like this our result just can prove the SCID mouse tumor reduce cause by anti-people IL-8 antibody.Concerning NSCLC clone, IL-8 is not a kind of autocrine growth factor, and this has confirmed that further the effect of anti-people IL-8 antibody in tumor suppression is by blocking-up vasculogenesis rather than the growth of blocking-up cell.

(1) material:

1, cell strain A549 maintains among the DMEM that contains 10% calf serum.

2, SCID mouse: 8 the week age female mice

3, anti-people IL-8 antibody

(2), method:

I) experiment of SCID mice-transplanted tumor is got and is enlivened propagation phase A549 cell, adjusts cell concn to 4 * 10 ⁷/ ml mixes this A549 cell mixture of every mouse subcutaneous injection 0.1ml with Matrigel (U.S. company BD) in 1: 1 ratio.Inoculate second day mouse is divided into control group and the anti-IL-8 Antybody therapy of 125 μ g group, every group of 4 mouse at random.Treatment plan: abdominal injection 200 μ l physiological saline or anti-people IL-8 antibody, on every Mondays, three, five the laxative.Stop experiment after three weeks.

The ii) separation of mouse tumor tissue, disconnected neck method is put to death mouse, carefully from the subcutaneous taking-up tumor tissues of mouse, weighs, and quick freezing is in negative 70 ℃ of refrigerators.

Iii) the synthetic 5mm diameter tissue piece of getting of RNA extracting and cDNA adopts Trizol reagent (Shen, Shanghai energy betting office) extracted total RNA.The RNA (2 μ g) that obtains presses the synthetic cDNA (reaction volume 20 μ l) of the first chain cDNA synthetic agent box of Revertaid (Lithuania MBI Ferments).

Iv) real-time quantitative PCR detection quantitative PCR detection is carried out on LightCycler type PCR instrument, and reaction volume is 25 μ l, includes cDNA 2 μ l, 5 * Buffer, 5 μ l, 250mM MgCl ₂0.5 μ l, 10mM dNTP 0.75 μ l, Taq HS0.25 μ l, each 0.1 μ l of 100 μ M primers, 50 μ M probes, 0.1 μ l.Reaction conditions is: 50 ℃ of 180s, 95 ℃ of 300s, 95 ℃ of 15s then, 60 ℃ of 60s, 40 circulations.IL-8, VEGF, CD31 and GAPDH mRNA detected result provide after being calculated automatically by computer software according to typical curve, with copy number/reaction expression.Each part cDNA sample standard deviation detects under same reaction conditions, IL-8, and VEGF and CD31 expression values are with (copy number * 10 ³)/GAPDH copy number is represented.

(3) result:

1, the anti-people IL-8 antibody in administration three week back to the influence of the SCID mouse tumor size of different tumor cell inoculations as can be seen from Table 6, after three weeks of administration, the tumour of A549 inoculation obviously reduces, anti-people IL-8 antibody is 75.62% to tumor control rate.

The anti-people IL-8 antibody in table 6 three weeks back is to the influence of the SCID mouse tumor size of tumor cell inoculation

	A549
		Control group	100.9±11.6
The administration group	24.6±12.2

Annotate: unit: milligram

2, CD31 in the different tumor tissues, the real-time quantitative PCR analytical applications quantifying PCR method of IL-8 and VEGF genetic expression has been analyzed IL-8 in the different tumor tissues, VEGF and CD31 expression of gene value, and compare.As can be seen from Table 7, in the formed solid tumor of A549, the amount of IL-8 genetic expression is very high, and after with anti-people IL-8 Antybody therapy, IL-8 expresses obviously and reduces in the A549 tumour.

The situation of genetic expression in the tumour of the different cell inoculations of table 7

		IL-8mRNA	VEGF mRNA	CD31mRNA
					A549	Control group	14942.52±17642.09	171.71±180.77	2122.76±400.22
The administration group	7911.75±5145.22	586.80±469.68	23774.01±27160.58

Annotate: unit: (copy number * 10 ³)/GAPDH copy number

4) result of study of treatment SARS:

1, whether SARS patient is because virus infection causes that the overexpression and the secretion of infection site are the reasons that causes serious inflammatory reaction in the lung tissue to chemokine (inflammatory factor) in vivo in order to inquire into.It is as follows that we carry out the detection by quantitative result by BJ Union Hospital and China-Japan Friendship Hospital to chemokines such as IL-8, MCAF among the SARS patients serum:

Detected result (the unit: pg/ml) of table 8 BJ Union Hospital

Group	Case	Stadium	IL-6	IL-8	MCAF	TNF-α
							The normal people	15	-	0	0	436.19±84.5	0
SARS patient	50	Acute phase	54.44±138.99	98.19±289.29	1329.97±642.51	48.69±144.41
							Decubation	0.158±0.96	0.118±0.834	565.12±179.44	59.34±91.82

Acute phase SARS patient's IL-8, MCAF, IL-6, TNF-α concentration are apparently higher than normal people (P＜0.01), drop to normal people's level (P＞0.05) in decubation IL-8 level, yet, the MCAF level continues to be higher than normal people's level (P＜0.01), illustrates that the variation of IL-8 and MCAF is obvious than IL-6 and TNF-α.

Detected result (the unit: pg/ml) of table 9 China-Japan Friendship Hospital

Group	IL-8	MCAF
			SARS patient	201.3 ± 184.5 (9 examples)	1152.08 ± 448.15 (160 examples)

1, SARS patient's serology detects and shows, the level of IL-8 and MCAF has obvious rising in the patients during acute stage body, and the level of decubation IL-8 drops to normal people's level.This shows that the serious inflammatory reaction that causes after SARS virus infects is relevant with secretion with the chemokine overexpression probably, and the lesion degree that infects lung tissue also may be relevant with the existence of IL-8 and MCAF with possible sequela.

2, in order from histopathology, further to study SARS patient's morbidity, pathology mechanism, analyze postmortem lung tissue sample with immunohistochemical method and be still very necessary.Preliminary detection proves, in SARS patient and ARDS (acute respiratory failure syndromes) patient, certain and the IL-8 of pneumonia reflection, the overexpression of MCAF is relevant with secretion, so, use high anti-IL-8 of neutrality and anti-MCAF monoclonal antibody of tiring, remove the chemokine of overexpression, the strong inflammatory reaction that releasing is caused by them may be very effective, feasible treatment way to treatment SARS patient, the destruction that alleviates SARS patient's lung tissue, reduction SARS mortality in said patients.

Though below just enumerated the example of the anti-IL-8 monoclonal antibody that contains heavy chain shown in SEQ ID NO:1 and 2 and variable region of light chain, but those of ordinary skill in the art openly is used for other molecule with described heavy chain and variable region of light chain by of the present invention, as the fragment Fab of the full molecule of immunoglobulin (Ig), antibody or (Fab ') 2 or single-chain antibody, with the syzygy of other composition etc. be conspicuous, do not need to spend performing creative labour, therefore repeat no more herein.

Sequence table

＜110〉Ye Qingwei

＜120〉anti-IL-8 monoclonal antibody, its variable region sequences and application thereof

<130>041301C

<160>2

<170>PatentIn version 3.1

<210>1

<211>119

<212>PRT

<213>antibody

<220>

<221>VH

<222>(1)..(119)

<223>

<400>1

Gln Val Lys Leu Gln Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Lys Phe Ser Cys Ala Ala Ser Gly Phe Asp Phe Ser Arg Tyr

20 25 30

Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Asn Pro Asp Ser Thr Thr Ile Asn Tyr Thr Pro Ser Leu

50 55 60

Lys Asp Lys Phe Ile Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Lys Val Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg Leu Asp Gly Tyr Tyr Gly Tyr Phe Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Val Thr Val Ser Ser

115

<210>2

<211>112

<212>PRT

<213>antibody

<220>

<221>VK

<222>(1)..(112)

<223>

<400>2

Asp Ile Glu Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Ser Asp Tyr

20 25 30

Gly Leu Ser Phe Met Asn Trp Phe Gln Gln Lys Pro Gly Arg Pro Pro

35 40 45

Lys Leu Leu Ile Tyr Thr Ala Ser Asn Gln Gly Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile His

65 70 75 80

Pro Leu Glu Glu Asn Asp Thr Ala Ile Tyr Phe Cys Gln Gln Ser Lys

85 90 95

Glu Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

100 105 110

Claims (7)

1, a kind of variable region sequences of anti-IL-8 monoclonal antibody is characterized in that, described variable region sequences has the aminoacid sequence of the light chain shown in heavy chain shown in the SEQ IDNo.1 and the SEQ ID No.2.

2, a kind of anti-IL-8 monoclonal antibody is characterized in that, has the variable region amino acid sequence of heavy chain and the light chain shown in the SEQ ID No.2 of SEQ ID No.1 in the structure of described monoclonal antibody.

3, the anti-IL-8 monoclonal antibody of claim 1 is used to prepare that treatment is expressed with IL-8 and excretory is unusual or excessive, the purposes of the medicine of diseases associated out of control.

4, the purposes of the anti-IL-8 monoclonal antibody of claim 3 is characterized in that, described disease is a psoriatic.

5, the purposes of the anti-IL-8 monoclonal antibody of claim 3 is characterized in that, described disease is an eczema.

6, the purposes of the anti-IL-8 monoclonal antibody of claim 3 is characterized in that, described disease is a tumour.

7, the purposes of the anti-IL-8 monoclonal antibody of claim 3 is characterized in that, described disease is SARS.

Images