CN1308678A - Cultivar specificity gene from the rice pathogen i(magnaporthe grisea), and methods of use - Google Patents

Cultivar specificity gene from the rice pathogen i(magnaporthe grisea), and methods of use Download PDF

Info

Publication number
CN1308678A
CN1308678A CN99805473A CN99805473A CN1308678A CN 1308678 A CN1308678 A CN 1308678A CN 99805473 A CN99805473 A CN 99805473A CN 99805473 A CN99805473 A CN 99805473A CN 1308678 A CN1308678 A CN 1308678A
Authority
CN
China
Prior art keywords
seq
nucleic acid
plant
gene
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN99805473A
Other languages
Chinese (zh)
Inventor
S·A·莱翁
M·L·法曼
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wisconsin Alumni Research Foundation
Original Assignee
Wisconsin Alumni Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wisconsin Alumni Research Foundation filed Critical Wisconsin Alumni Research Foundation
Publication of CN1308678A publication Critical patent/CN1308678A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Pretreatment Of Seeds And Plants (AREA)

Abstract

This invention provides a novel avirulence gene from the rice blast pathogen, Magnaporthe grisea. The gene, AVR1-CO39, confers cultivar-specific avirulence to strains of M. grisea that carry the gene. Also disclosed are methods of using the gene and its encoded products for improving resistance of rice to the rice blast pathogen.

Description

Cultivar specific gene and methods for using them from the rice pathogen i(magnaporthe grisea)
Regulation according to 35 U.S.C. § 202 (C), should think that United States Government has the part right to the present invention, study sources of funds of the present invention in USDA, fund 58-3655-3-107 and 58-3655-4-140, and National Institutes of Health, fund GM33716-08S1.
Invention field
The present invention relates to the plant disease-resistant field.Especially, the invention provides the non-toxic gene that derives from rice blast cause of disease i(magnaporthe grisea) (Magnaporthe grisea) of a novelty and use this gene and its coded product to improve the method for paddy rice to the rice blast pathogen resistance.
Background of invention
Paddy rice is the main food of about 2/3rds world population.Plant and consumption in developing country more than 90% paddy rice in the whole world.By the rice blast that the fungi i(magnaporthe grisea) causes, threaten global rice crop.In infected cultivated area, this disease causes the production loss of 10-30%.Rice blast has become the serious day by day problem of paddy fields of southern US.At present, it also becomes the subject matter of California paddy fields.
" gene pairs gene " hypothesis has been explained the relation of very special disease resistance/susceptibility, and this relation often is present between the Cultivar of phytopathy original seed and its host species.Have been found that this hypothesis can be used for the interaction of many host-cause of diseases, comprises the interaction of rice blast fungi i(magnaporthe grisea) and its host paddy rice.Can understand and handle this host and the cause of disease mutual relationship has huge use value, because i(magnaporthe grisea) just can promptly overcome the new disease resistance of paddy rice soon after they disseminate.And the i(magnaporthe grisea) that exists as complicated kind has many sterile and have inferior special a group of different host ranges.Mutual relationship on these different inferior special groups are evolved receives plant breeder's very big concern, because some alternate hosts often are grown near the paddy rice or with the paddy rice crop rotation, and the i(magnaporthe grisea) chorista that infects these alternate hosts also can infect paddy rice sometimes.
Gene pairs gene resistance (being also referred to as super quick resistance (HR) or the special resistance of kind) depends on by this plant invading the activation in the cause of disease specific recognition process.Identified many one plant genes, these Gene Handling the resistance of gene pairs gene.These genes are called as resistance (R) gene.The function of specific R gene depends on the genotype of cause of disease.If its expression causes cause of disease and produces a kind of signal that can stimulate the strong defence of the vegetalitas that has corresponding R gene to reply that this gene just is called the Avr gene so.When in Avr gene in the cause of disease or the plant during corresponding R gene deletion, do not observe this replying.It should be noted that single plant has many R genes, and single cause of disease have many Avr genes.Yet, have only when the Avr gene mates in host-cause of disease interacts with its special R gene, just produce the intensive resistance.In this example, resistance appears in general activation of replying owing to HR, wherein, further invades the living plant tissue in order to prevent cause of disease, and the cell in the next-door neighbour infected area can carry out procedural necrosis.Other features that resistance is replied also comprise the synthetic of antimicrobial metabolite or inhibition cause of disease enzyme, thicken cell walls in the infected area, and the formation of inducing the signal transduction pathway that causes plant whole body acquired resistance (SAR).
The molecular basis of host in i(magnaporthe grisea)-Cultivar specificity and cause of disease variability, adopt identification method, graphing method and in some instances, the method for the special Avr gene of clone begins to illustrate from i(magnaporthe grisea) pathogen separation body.For example, as the non-toxic gene AVR2-YAMO (Cultivar specificity) and PWL2 (the host specificity) (Valent﹠amp of classics; Chumley, rice blast) (this book is by R.Zeigler, S.A.Leong, P.Teng writes), 3.113-3.134 page or leaf, Wallingford:CABInternational, 1994), work by the infection that prevents special Cultivar or host.A kind of 223 amino acid whose albumen that have homology with proteolytic enzyme of AVR2-YAMO coding, and a kind of 145 amino acid whose albumen that are rich in glycine of PWL2 coding.According to these Argine Monohydrochloride sequences of prediction, 2 kinds of albumen all can be secreted.
The phenomenon of AVR2-YAMO and PWL2 homology extensively distributes in paddy rice and other infect the i(magnaporthe grisea) choristas of weeds, and the i(magnaporthe grisea) chorista of therefore confirming not infect paddy rice still carries host or the specific gene of Cultivar at paddy rice.In some cases, shown that the homology of AVR2-YAMO and PWL2 has function, and shown host identical or Cultivar specificity with AVR2-YAMO or PWL2.
Potential the example of the Avr gene of using value is arranged is Cultivar specific gene AVRl-CO39 as another, it determines the nontoxicity at rice cultivar CO39, this gene is identified (Valent et al., Genetics 127:87-101,1991) (Smith﹠amp and on the position of the i(magnaporthe grisea) karyomit(e) 1 of mapping; Leong, Theor.Appl.Gent.88:901-908,1994).A part that contains the AVRl-CO39 gene on the karyomit(e) 1, be separated and be cloned into (Leong et al. in the cosmid vector, the 846-852 page or leaf, Rice Genetice III, Proceeding of the Third Annual RiceGenetics Svmposium, G.S.Khush writes, Island Harbor Press, Manila, 1996); But, this gene itself is not identified and is determined certain characteristic up to now.
From the clone Cultivar of i(magnaporthe grisea) and the validity of host specificity gene, and, provide the useful tool of this area operation and enhancing pathogen resistance finally from the corresponding R gene of paddy rice.Correspondingly, an object of the present invention is to provide a kind of i(magnaporthe grisea) Cultivar specific gene AVR1-CO39 of new clone and its functional analogue of carrying out above-mentioned application.
The present invention's general introduction
According to an aspect of the present invention, provide a kind of isolating nucleic acid, AVR1-CO39, it is from i(magnaporthe grisea) and give rice cultivar CO39 to containing the special nontoxicity of Mycophyta cause of disease of this nucleic acid.Described nucleic acid preferably comprises part or all of Sequence Identification number 1, or can with part or all of Sequence Identification number 1 or its complement hybridization.
According to a further aspect in the invention, provide a kind of by part or all of claim 1 an isolating nucleic acid encoded polypeptide.Preferably, these polypeptide be selected from respectively with Sequence Identification numbers 2,3,4,5,6,7 and 8 accordingly by ORFS 1,2,3,4,5,6 and 7 encoded polypeptides, most preferably by the ORF3 encoded polypeptides.
According to a further aspect in the invention, provide a kind of genetically modified growing nonparasitically upon another plant in the bacterium of plant, the AVR1-CO39 gene of this bacterial expression part, described gene are given rice cultivar CO39 the special nontoxicity at the microorganism of expressing this gene effectively.Preferably, genetically modified growing nonparasitically upon another plant in ORF3 or the functional equivalent of the bacterial expression serial ID No.1 of plant.
According to a further aspect in the invention, provide a kind of method that strengthens rice cultivar CO39 plant at the resistance scope of pathogenic micro-organism.This method comprises with a kind of grows nonparasitically upon another plant in the bacterial treatment plant of plant, the AVR1-CO39 gene of this bacterial expression part, and this part can stimulate the special R expression of gene of CO39 effectively in plant materials.
According to a further aspect in the invention, provide second kind of method that strengthens rice cultivar CO39 plant at the resistance scope of pathogenic micro-organism.This method comprises with a kind of protein extract handles plant, and this extract comprises by expressing the polypeptide that AVR1-CO39 produced, and used amount can be effectively in the special R expression of gene of plant materials internal stimulus CO39.
These and other feature and advantage of the present invention will be described in the content of following proposition and embodiment in more detail.The present invention describes in detail
I. definition
The various terms relevant with biological molecule of the present invention above using, also use in whole specification sheets and claim.Term " substantially the same ", " percentage similarity " and " percentage consistence " be the specific definition of face as follows.
About nucleic acid of the present invention, use term " isolating nucleic acid " sometimes.When being used for DNA, this term refers to isolating a kind of dna molecular from such sequence, its closely adjacent with this sequence (in 5 ＇ and 3 ＇ direction) in the genome of the natural appearance of this biology, and this dna molecular derives from this biology.For example, described " isolating nucleic acid " can comprise following dna molecular, and this DNA is inserted in the carrier such as plasmid or virus vector, perhaps is incorporated in prokaryotic organism or the Eukaryotic genomic dna." isolated nucleic acid molecule " also can comprise the cDNA molecule.
About RNA molecule of the present invention, term " isolating nucleic acid " originally refers to a kind of by the coded RNA molecule of the DNA isolation molecule of above-mentioned definition.In addition, this term can refer to a large amount of isolating RNA molecules from various RNA molecules, it is relevant with these RNA molecules to when native state (, in cell or tissue), and there be (term " pure basically " definition of face as follows) in this molecule with the form of " pure basically " as a result.
About albumen, use term " isolating albumen " or " albumen of separation and purifying " at this sometimes.Originally this term refers to the albumen by the expressed generation of isolated nucleic acid molecule of the present invention.In addition, this term can refer to a large amount of isolating albumen from other albumen, and it is relevant with these albumen natively, and this albumen exists with the form of " pure basically " as a result.
Term " pure basically " refer to a kind of purpose compound that comprises weight ratio 50-60% at least (as, nucleic acid, oligonucleotide, albumen etc.) prepared product.More preferably, this prepared product comprises the purpose compound of weight ratio 70% at least, and is most preferred for comprising the purpose compound of weight ratio 90-99%.Purity by the method that is suitable for this purpose compound measure (as, chromatography method, agarose or polyacrylamide gel electrophoresis, HPLC analyze, etc.).
About antibody of the present invention, term " immunology is special " refers to this antibody capable and combines with one or more epi-positions of target protein, but nonrecognition and in conjunction with other molecules that contain in the population mixture of antigen biomolecules basically.
About oligonucleotide, term " specific hybridization " refers to 2 combinations between the single stranded nucleic acid molecule with complementary sequence, with the above-mentioned hybridization (being also referred to as " complementary basically " sometimes) that allows to carry out under the general used predetermined condition in this area.Especially, this term refers to the hybridization of the complementary sequence basically that contains in a kind of oligonucleotide and single stranded DNA of the present invention or the RNA molecule, but gets rid of this oligonucleotide and the hybridization that contains the single-chain nucleic acid of incomplementarity sequence basically.
Term " inoculation cause of disease " refers to a kind of cause of disease to be inoculated to plant.
Term " the disease defence is replied " refers to the variation aspect metabolism, biosynthesizing vigor or genetic expression, and these variations can strengthen the ability of duplicating and propagating (that is, resisting this microorganism cause of disease) that plant suppresses the microorganism cause of disease.The example that plant disease defence is replied including, but not limited to, generation has the low-molecular weight compound (referring to phytoalexin) and induced defence (or relevant with defence) expression of gene of antimicrobial acivity, these products for example comprise peroxidase, cell wall protein, proteinase inhibitor, lytic enzyme, produce relevant (PR) albumen and phytoalexin biosynthetic enzyme with pathology, as phenylalanine ammonia base lyase and chalcone synthetase.As if in plant, above-mentioned disease defence is replied and is induced by several signal transduction pathways that relate to the secondary defence signal transmission molecule that produces in the plant materials.In plant, induce factor that disease defence replys including, but not limited to (1) microorganism cause of disease, as fungi, bacterium and virus; (2) microorganism component and other defence are replied and are caused son, as albumen and protein fragments, little peptide, elicitins and harpins, cryptogein and oligosaccharides; (3) the secondary defence signal that is produced by plant transmits molecule, as Whitfield's ointment, H 2O 2, ethene and jasmonate class.
Term " promoter region " refers to the regulatory region of gene 5 ＇ end.
Term " reporter gene " refers to and can be connected with promoter region steering quality and form genetically modified genetic sequence, and the expression of this gene coding region as a result is subjected to the adjusting of this promotor, and can be measured to this genetically modified expression easily.
Term " selectable marker gene " refers to when this kind genetic expression, gives by cell transformed or the selectable phenotype of plant, for example antibiotics resistance.
Term " steerable connection " means that encoding sequence expresses necessary adjusting sequence and place the proper site of dna molecular with respect to encoding sequence, thereby influences the expression of this encoding sequence.This identical definition also be applied to sometimes encoding sequence and transcriptional control element in the expression vector (as, promotor, enhanser and termination element) arrangement in.
Term " DNA construct " refers to and is used to the genetic sequence that transforms plant and produce the filial generation transgenic plant.These constructs can utilize virus or plasmid vector to use to plant.Wait other transmission methods such as the conversion of agrobatcerium T-DNA mediation and the conversion that utilizes biolistic to handle, also be considered to belong within the scope of the present invention.This transfering DNA can be according to the method preparation of standard, as (Frederick M.Ausubel et al. writes John Wiley﹠amp in " molecular biology modernism "; Sons, 1998) those methods of mentioning in the book.
The description of II .AVR1-CO39 and its coded polypeptide
According to the present invention, separated and cloned the virus-free gene of a kind of new i(magnaporthe grisea).This gene is referred to herein as AVR1-CO39, and its function is the special interaction of Cultivar of giving rice cultivar CO39.In embodiment 1, describe the clone in detail from the AVR1-CO39 gene of i(magnaporthe grisea) and analyzed this gene.As if this gene contains 4 and opens frame, and 1 (ORF3) wherein plays most critical giving aspect the special nontoxicity of the Cultivar of the i(magnaporthe grisea) chorista that carries this gene.The homology of bacterial strain 2539 chorista AVR1-CO39 genes is identified in the various arrangements of other i(magnaporthe grisea) choristas.
In the example of AVR1-CO39 of the present invention, the AVR1-CO39 genomic clone from i(magnaporthe grisea) bacterial strain 2539 is described in detail at this, and its nucleotides sequence is listed among the embodiment 1 as Sequence Identification number 1 and is suggested.Sequence Identification number 1 contains 4 and opens frame.It is generally acknowledged, by regulating sequence (embodiment 1) from opening the gene product that frame expresses or having crucial transcribing or translate, one or more these open frame and be responsible for giving Cultivar CO39 nontoxicity.
Although in this description and illustrate an AVR1-CO39 genomic clone from i(magnaporthe grisea) chorista 2539, but should think and the present invention includes nucleic acid and albumen from other i(magnaporthe grisea) choristas, quite similar when these nucleic acid and albumen use, can be by the AVR1-CO39 nucleic acid and the albumen of following purpose of description instead of separate body 2539.These choristas are including, but not limited to the allelic variant and the natural mutation of Sequence Identification number 1, and they might find in the colony of any i(magnaporthe grisea) chorista that provides.On Nucleotide and aminoacid sequence, have some difference because estimate above-mentioned variant, the invention provides the nucleic acid molecule of a kind of isolating AVR1-CO39, the nucleotide sequence that this molecule provides in coding region and Sequence Identification number 1 (and, most preferably, the special coding region that comprises Sequence Identification number 1) has about 60% sequence homology (be preferably 70% and more preferably surpass 80%) at least.What the present invention also provided Sequence Identification number 1 opens frame isolated polypeptide product, this product respectively with Sequence Identification numbers 2,3,4,5,6 or 7 aminoacid sequence has about 60% sequence homology (preferably 70% or 80% or bigger) at least.Owing to may have natural sequence variations in the AVR1-CO39 gene, those skilled in the art estimates to find the nucleotide sequence variation of about 30-40%, but these variations still keep the unique property of AVR1-CO39 gene and coded polypeptide of the present invention.A part of reason of above-mentioned prediction is the successful evolution of the degeneracy of codon and the variation of the conserved amino acid sequence known.Therefore, think that basically above-mentioned variant is identical with another variant, and be also included within the scope of the present invention.
Relevant purpose of the present invention, term " substantially the same " refers to Nucleotide or the aminoacid sequence with sequence variations, and these variations do not influence this proteic character (being its structure and/or biological activity) in fact.As for specific nucleotide sequence, term " substantially the same " can think that referring to the coding region also also refers to responsible conserved sequence of expressing, and refer to the degenerate codon of coding same amino acid at first, perhaps refer in encoded polypeptide and to be responsible for that coding is conservative replaces amino acid whose alternative codon.When relating to aminoacid sequence, term " substantially the same " refers generally to not influence the conservative property replacement and/or the variation of structure or function in the zone of this polypeptide.Term " percentage consistence " and " percentage similarity " also are used for the comparison between the aminoacid sequence of the present invention.Will be understood that these terms are defined, because they (Devereaux et al. nucleic acids research 12:387-397,1984) occur in UWGCG sequential analysis program, this routine analyzer can be buied from Wisconsin university.
Following description proposes to comprise enforcement general procedure of the present invention.As for the concrete material of mentioning, only be for the present invention is described, and can not think to limit the present invention.Unless the elsewhere specifies, can adopt conventional cloning process, as the method that in following book, proposes, Sambrooket al., molecular cloning, cold spring harbor laboratory (1989) (henceforth being " Sambrook etal. ") or Ausubel et al. (writing) molecular biology method, John Wiley﹠amp; Sons (1998) (henceforth being " Ausubel et al. ").A.AVR1-CO39 nucleic acid molecule, encoded polypeptides and the preparation that is specific to the antibody of this polypeptide
1. nucleic acid molecule
AVR1-CO39 nucleic acid molecule of the present invention can make by 2 kinds of usual ways: (1) they can be synthetic from suitable triphosphopyridine nucleotide, perhaps (2) they can from biomaterial, separate acquisition.The used step of 2 kinds of methods is well-known in this area.
Available nucleotide sequence information, the gene element that for example has Sequence Identification number 1 exsomatizes, and might prepare isolating nucleic acid molecule of the present invention by the oligonucleotide synthesis method.The synthetic oligonucleotide can be by the preparation of phosphinylidyne imines method, and this method is employed biosystem 38A syntheticization of DNA or similar equipment adopts.The construct that obtains can be according to method purifying well known in the art, as high performance liquid chromatography (HPLC).Because intrinsic volume restrictions in the present oligonucleotide synthesis method, long double stranded polynucleotide must progressively synthesize.Therefore, for example by several have a suitable complementarity can synthesize the duplex molecule of 1.05 kb than small segment.The complementary fragment of Chan Shenging can be annealed like this, and each fragment has had and is used for and suitable viscosity end that contiguous fragment is connected as a result.Under the dna ligase existence condition, these contiguous fragments couple together the duplex molecule of 1.05 kb of constructed total length by the annealing of sticky end.The synthetic dna molecule of method structure can be cloned and be increased in suitable carriers thus.
Use method well known in the art, also can from suitable biomaterial, separate the AVR1-CO39 gene.In one embodiment, can clone from i(magnaporthe grisea) 2539 bacterial strain cosmid library isolated genes groups.In an other embodiment, separablely comprise the cDNA clone that one or more AVR1-CO39 locus are opened frame.
According to the present invention,, can identify nucleic acid with sequence homology with the part or all of coding region of Sequence Identification number 1 by the hybridization and the cleaning condition of suitable strictness.For example, can hybridize according to the method for Sambrook et al., used hybridization solution contains: 5x SSC, 5x DenhardtShi reagent, 1.0%SDS, the salmon sperm DNA of the sex change fragmentation of 100 μ g/ml, 0.05% trisodium phosphate and up to 50% methane amide.Under 37-42 ℃, carry out 6 hours hybridization at least.After the hybridization, follow these steps to clean Hybond membrane: under (1) room temperature in 2x SSC and 1%SDS 5 minutes; (2) under the room temperature in 2x SSC and 0.1%SDS 15 minutes; Under (3) 37 ℃ in 2x SSC and 0.1%SDS 1 hour 30 minutes; (4) under 45-55 ℃ in 2X SSC and 0.1%SDS 2 hours, changed liquid every 30 minutes.In addition, the modifying method of Amasino hybridizing method (analytical biochemistry 152:304-307) is preferably used for the present invention and description in more detail in embodiment 1.
A common formula that is used to calculate stringent condition need obtain to have the hybridization (Sambrook et al., 1989) between the nucleic acid molecule of distinguished sequence homology:
T m=81.5 ℃+16.6 Log[Na+]+0.41 (%G+C)-0.63 (% methane amide)-
600/#bp (in duplex)
As the explanation of above formula, with [N+]=[0.368] and 50% methane amide, and the average probe volume of 42% GC content and 200 bases, this T mIt is 57 ℃.T in the DNA duplex mValue descends 1-1.5 ℃ along with homology reduction by 1% thereupon.So,, can be observed the target thing bigger than about 75% sequence identity with 42 ℃ hybridization temperature.
Nucleic acid of the present invention can be in office what keep the form of DNA easily in the cloning vector.In a preferred embodiment, the clone is maintained in plasmid clone/expression vector, as pGEM-T (Promega Biotech, Madison, WI) or pBluescript (Stratagene, LaJolla, CA) carrier all can be bred in suitable e. coli host cell for every kind.
AVR1-CO39 nucleic acid molecule of the present invention comprises cDNA, genomic dna, RNA and its fragment, and these molecules can be strand or two strands.Therefore, the invention provides oligonucleotide (justice of DNA or RNA or antisense strand), this sequence energy and at least a sequence hybridization of selecting nucleic acid molecule provided by the present invention such as fragment as cDNA with I.D.No.1 sequence with following sequence.Above-mentioned oligonucleotide is as probe, by detect AVR1-CO39 gene or the mRNA in the specimen of fungi chorista as the pcr amplification method, perhaps before mRNA translates into albumen or in its process, regulate as the positive or negative of AVR1-CO39 genetic expression.
2. albumen
The AVR1-CO39 gene element that the present invention describes exsomatizes and contains 4 and open frame (ORF1-4), and its aminoacid sequence of being derived is represented with sequence I.D.No 2-5 respectively at this.Any these polypeptide can be prepared according to the method for knowing.If original position produces, institute's polypeptide that obtains can be from as purifying the suitable materials such as fungi chorista.
In addition, the availability of the nucleic acid molecule of these polypeptide of encoding makes that using vivoexpression method well known in the art to produce described albumen becomes possibility.For example, can be in a kind of suitable in-vitro transcription carrier cDNA or gene clone, as be suitable for the pSP64 or the pSP65 of in-vitro transcription, in a kind of suitable cell free translation system such as wheat germ or rabbit reticulocyte, carry out acellular translation then.In-vitro transcription and translation system can obtain from commercial channels, as can from Promga Biotech (Madison, Wisconsin) or BRL (Rockville Maryland) obtains.
According to an embodiment preferred, relatively large AVR1-CO39 encoded polypeptides can be expressed generation in suitable prokaryotic organism or eukaryote system.For example, part or all of dna molecular, can be inserted in a kind of plasmid vector that is suitable in bacterial cell (as intestinal bacteria) or yeast cell (as yeast saccharomyces cerevisiae) expressing such as cDNA, perhaps be inserted into and be suitable in the baculovirus vector of expressed in insect cells with sequence I.D.No.1.Above-mentioned carrier contains this DNA expresses necessary regulatory element in host cell, its locator means allows this DNA to express in host cell.The necessary regulatory element of above-mentioned expression comprises promoter sequence, transcriptional initiation sequence and can select enhancer sequence.
The AVR1-CO39 polypeptide that is produced by genetic expression in prokaryotic organism of recombinating or eukaryote system can carry out purifying according to method well known in the art.In a preferred embodiment, the expression/excretory system that adopts commercial sources to obtain, this recombinant protein is expressed thus, is secreted into then outside the host cell, easily purifying from substratum on every side.If need not express/secretion vector, a kind of alternate method comprises by affine this recombinant protein of partition method purifying, for example by with the antibody mediated immunity interaction purifying of this recombinant protein of specific combination.Experienced operators is often used aforesaid method.
By the AVR1-CO39 encoded polypeptides of the present invention of method preparation above-mentioned, can analyze according to standard program.The method of analytic function activity (promptly giving avirulent ability) is described in embodiment 1.
The present invention also provides immunity specifically in conjunction with the antibody of polypeptide of the present invention.Directly, can prepare according to standard method at polyclone or monoclonal antibody by any peptide of the ORFs coding of AVR1-CO39.According to the general method of K hler and Milstein, the operation steps of following standard prepares monoclonal antibody.In a preferred embodiment, prepared various antibody, the various epi-positions of these antibody capables and AVR1-CO39 encoded polypeptides play immune response specifically.
Immunity specifically with one or more by interactional polyclone of AVR1-CO39 encoded polypeptides or monoclonal antibody, can be used for differentiating and the above-mentioned albumen of purifying.For example, can be used for affine separation energy and the interactional specifically albumen of its immunity to antibody.The albumen that also can be used for antibody the blend sample of self-contained albumen of immunoprecipitation and other biological molecule.Other purposes of antibody are described below.
The purposes of the nucleic acid of B.AVR1-CO39, proteins encoded and antibody
The genetic recombination engineering method is used to strengthen the potentiality that agricultural goes up the disease resistance of important plant, has obtained a large amount of concerns in recent years.Many effective meanss are arranged at present, be used for stable gene ground is imported plant and is used for reinforcing gene expression.The invention provides multiple nucleic acid molecule, these molecules are stably imported to recipient plant or import to grow nonparasitically upon another plant in the microorganism of plant after, can strengthen the ability of the opposing cause of disease invasion and attack of plant.AVR1-CO39 proteins encoded of the present invention also directly is used for plant, replys with inducing anti-disease.
1.AVR1-CO39 nucleic acid
According to the present invention, AVR1-CO39 nucleic acid (genomic clone or cDNAs) can be used for various purposes.This DNA, RNA or its fragment can be used as probe, to detect existing and/or the genetic expression of AVR1-CO39 of AVR1-CO39 gene.AVR1-CO39 nucleic acid is included, but are not limited to as the method that probe carries out said determination: (1) in situ hybridization; (2) southern hybridization; (3) northern hybridization; (4) similar amplified reaction such as polymerase chain reaction (PCR).AVR1-CO39 nucleic acid of the present invention also can be used as probe, to identify the homologue from other i(magnaporthe grisea) choristas.As described above, AVR1-CO39 nucleic acid also is advantageously used in and produces a large amount of pure basically AVR1-CO39 albumen or its selected part.
But, perhaps the purposes of the bigger meaning of AVR1-1039 nucleic acid is a resistance spectrum of widening the rice cultivar that carries the CO39 resistant gene, and this resistance is at antigen rather than carry the i(magnaporthe grisea) chorista of AVR1-1029 non-toxic gene.For example, in one embodiment of the invention, be connected with a kind of allogeneic promoter to AVR1-CO39 coding region steering quality, preferably this promotor generally can be by pathogeny evoked (that is, can be excited by the cause of disease of broad range induce) or can be by wound-induced.Above-mentioned promotor includes, but are not limited to:
A) promotor of coding fat oxygenase gene is (preferably from plant, most preferably from paddy rice, for example, Peng et al., journal of biological chemistry 269:3755-3761,1994:Peng et al., Abstract presented at the general meeting ofthe International Program on Rice Biotechnology, Malacca, Malaysia, Sept.15-19,1997);
B) promotor of coding peroxidase gene (preferably from plant, most preferably from paddy rice, for example, Chittoor et al., Mol.Plant-MicrobeInteractions 10:861-871,1997);
C) promotor of coding hydroxymethyl glutaryl base-CoA reductase gene (preferably from plant, most preferably from paddy rice, for example, Nelson et al., Plant Mol.Biol.25:401-412,1994);
D) promotor of coding phenylalanine ammonia base lyase gene is (preferably from paddy rice, for example, Lamb et al., Abstract of the general meeting of theInternational Program on Rice Biotechnology, Malacca, Malaysia, Sept.15-19,1997);
E) promotor of coding for glutathion transferase gene (preferably from plant, most preferably from paddy rice, or in addition, from the PRP1 promotor of potato);
F) from the promotor of pollen-specific gene, as corn Zmg13, shown and in carrying the paddy rice transgenosis pollen of corn gene, expressed (Aldemita et al., Abstractof the general meeting of the International Program on RiceBiotechnology, Malacca, Malaysia, Sept.15-19,1997);
G) promotor of chitinase encoding gene (preferably from plant, most preferably from paddy rice, for example, Zhu﹠amp; Lamb, Mol.Gen.Genet.226:289-296,1991);
H) in the interaction of i(magnaporthe grisea) and paddy rice the promotor of early stage (inoculating in back 5 hours) inductive gene (as, Bhargava﹠amp; Hamer; Abstract B-10,8th International Congress Molecular Plant MicrobeInteractions, Knoxville, TN July 14-19,1996);
I) from the promotor of plant (being preferably paddy rice) virogene, as Hammond-Kosack et al., described in the Mol.Plant-Microbe Interactions 8:181-185 (1994), these genes are included in bacterial plasmid or plant viral vector;
J) from the promotor of the gene that relates to plant (being preferably paddy rice) respiratory burst (as, Groom et al., Plant is (3) J.10: 515-522,1996); With
K) from the promotor of the gene that relates to plant (being preferably paddy rice) cyanin path (as, Reddy, pp341-352 in Rice Genetics III, supra; Reddy, et al..Abstract of the general meetlng of the InternationalProgram on Rice Biotechnology, Malacca, Malaysia, Sept.15-19,1997)。
This mosaic gene is used to transform the rice cultivar that has carried the suitable R gene then.With the pathogenic wound or after exciting, can induce transgenic plant to produce the AVR1-CO39 gene product, excite the defence of R gene to reply thus.In this embodiment, must be noted that and avoid using the promotor that is subjected to necrosis induction, because use above-mentioned promotor can cause constantly lethal super quick the replying of plant (as seeing, Kim et al., institute of NAS reports 91:10445-10449,1994).
In a preferred embodiment, the coding region of AVR1-CO39 (preferably with ORF3 respective coding district) is inserted in the expression vector of a kind of microorganism, and this microorganism grows nonparasitically upon another plant and grows on rice plant.The suspension of above-mentioned recombinant microorganism is sprayed on the rice cultivar that carries suitable R gene.After the cause of disease invasion and attack, the provide protection of 2 kinds of levels may occur: (1) excites plant surface to change by this reorganization gene product that body produces of growing nonparasitically upon another plant, further stop the penetrating of this cause of disease (as, the conidium of this fungi develops into the spore of growing nonparasitically upon another plant, but aplasia becomes peg); Perhaps (2) are brought in the plant tissue of wound site by this reorganization gene product that body produces of growing nonparasitically upon another plant, and it interacts with corresponding R gene product and the disease defence of induced internal is replied there.So this pre-treatment is given the Dui Geshi Magna and protected the plucked instrument bacterium chorista resistance of (with may other pathogenic), normal, these cause of diseases are that tool is toxic to those Cultivars.The present embodiment is described in embodiment 3 in more detail.
As for growing nonparasitically upon another plant in the purposes of the bacterium of plant, should note expression and the transmission system of bacterium and phage,, be particularly useful from the kind that InVitrogen buys as those commercial sources.Bacterial system is expressed albumen a kind of and pilin hybridization, and this foreign protein is exposed to the outside of bacterial body as a result.This phage system also expresses a kind of albumen and foreign protein with the hybridization of shell component and is exposed to the outside.
This AVR1-CO39 gene also can be used as a kind of instrument, identifies and separates its corresponding R gene.Therefore, with the tomato CF-9 gene that separates dark yellow branch spore resistance (Joneset al. is described, science 266:789-793,1994) method is similar, and the R gene corresponding to AVR1-CO39 in the paddy rice can separate by transposon tagging: (1) is transformed into AVR1-CO39 in the responsive rice strain and the constructive expression; (2) this transgenic strain and the resistant strain hybridization of carrying appraisable transposon; (3) carrying the F1 filial generation seedling of constructive expression Avr gene and corresponding R gene should be dead, thereby has and can screen F1 filial generation alive simply; (4) by disturbing AVR1-CO39 transgenosis or corresponding R gene, perhaps by transposon, the F1 filial generation of any work should be survived.So can separate and the relevant transposon of this gene of interference.
2.AVR1-CO39 albumen and antibody
AVR1-CO39 gene product or its fragment of purifying can be used for producing polyclone or monoclonal antibody, these antibody also can be used as responsive detection reagent, detect the existence and the accumulation of AVR1-CO39 polypeptide in microorganism transformed epiphyte body, transgenic plant or other biological material.Immunity can be used for the method for various design detections and quantitative analysis of protein specifically at the polyclone or the monoclonal antibody of AVR1-CO39 polypeptide.Aforesaid method is including, but not limited to (1) flow cytometry; (2) immunochemistry of expressing protein location in cell or tissue; And (3) to from the immunoblotting assay of various cells and tissue extract (as, dot blotting or Western trace).In addition, as mentioned above, can be used for purifying AVR1-CO39 polypeptide (as affinity column purifying, immunoprecipitation) to antibody.
In a preferred embodiment, the AVR1-CO39 polypeptide of purifying (most preferred from ORF3) is used as pre-treatment or co-processing agent, gives the rice cultivar broad-spectrum disease resistance that carries CO39 R gene originality.Therefore, can to express growing nonparasitically upon another plant of AVR1-CO39 similar in the method for microorganism of plant to above-mentioned use, with pathogenic micro-organism wound or wound or inoculation simultaneously subsequently, this polypeptide contacted with the R gene product, thereby excited and defend to reply.The present inventor shows by experiment, and as embodiment 4 was described in detail, present method had feasibility.
Following specific embodiment explanation embodiment of the present invention are provided.In any case can not think that these embodiment limit the scope of the invention.
Embodiment 1
The clone of AVR1-CO39 and analysis
Use carries out chromosome walking method (Leong etal., 1996) then based on the cloning process of collection of illustrative plates, separated the chromosome segment that a supposition contains Cultivar specific gene AVR1-CO39 from i(magnaporthe grisea) bacterial strain 2539.In the present embodiment, we have described discriminating, clone and the analysis of AVR1-CO39 gene.
Method:
Hybridizing method is that the method that Amasino (1986) " quickens nucleic acid hybridization rate, analytical biochemistry 152:304-307 by polyoxyethylene glycol " is slightly made an amendment to hybridizing method.Method according to Amasino prepares hybridization buffer, but does not add PEG and NaCl, and reduces NaHPO 4Concentration: 0.125 M NaHPO 4, 7%SDS, 50% methane amide, 1.0mM EDTA, pH 7.2.Use high stringent condition (42 ℃, 16h).Wash the method for film after the hybridization: wash 1 time with 2XSSC under the room temperature, in 2XSSC, wash altogether 10min 1 time for 65 ℃, in 2XSSC, wash 15min altogether 1 time for 65 ℃, at last in 0.1 X SSC, 0.1%SDS 65 ℃ wash 15min altogether 1 time.The last film condition of washing is stricter than hybridization conditions, the T of setting mValue is 68.So just need be than 95% bigger homology in order to keep crossbred.Describe in the method for (1986) at Amasino, do not use the phosphatic damping fluid in hybridization back.
The chromosome walking strategy is built among clay pMLF1 (Leong et al., the same) and the pMLF2 (An et al., gene 17 6:93-96,1996) by the total genomic dna library of the i(magnaporthe grisea) bacterial strain 2539 of 5,194 clone's compositions.As the template of colony trace and clone's set, wherein electrophoresis and trace are carried out in this being limited property of DNA digestion to these clones one by one.The latter's trace contains the candidate clone set that hybridization is cloned as initial the evaluation.Screen colony trace point then from these clone's set.Carry out following steps, utilize Apa I digestion clay clone, preparation is from the end clone who inserts DNA, and the Apa I can not digest this carrier, then by connecting this plasmid of recirculation.This step produces a kind of two ends and all has the derivative (An etal., 1996 is the same) that inserts segmental DNA.By with Apa I and the digestion of Not I, obtain from segmental 2 ends of the insertion of this carrier.Then, rely on its move in the step in can not with before the characteristic of clay hybridization, identify the end clone who obtains.
Transform virulent strain Guy11 with the clay in the AVR1-CO39 locus: the method for transformation that adopts LEUNGet al. (1990) to describe, importing among the Guy11 from the heredity clay at interval that contains AVR1-CO39.This step is carried out following modification: protoplastis injects (45 ℃) CM+20% sucrose agar that 100ml melts to them behind perfect medium (CM)+sorbyl alcohol incubation.Then, agar is poured in 4 culture dish.When this agar solidifies (1h), cover the 1.5% water agar that contains 800 μ g/ml hygromycin B (final concentration is 300 μ g/ml) above with 15ml.
Opening in the frame of AVR1-CO39 locus cause phase shift mutation the 1.05kb fragment cloning to the pBSKS II +(pBSCO39) in to make 2 initial clones.Then, the 1.05kb fragment cloning of this sudden change to from the pCB1004 hyg of J.Sweigard (Dupont) rIn the carrier.Make plasmid linearization and be transformed in the Guy11 protoplastis with Not I digestion.
By the digestion of following method with reconnect, in ORFs 2 and 3, produce initial phase shift mutation:
Phase shift mutation in ORF2: downcut in the Acc I site of 499 in Nucleotide (nt), cut 2 nt of 3 ＇ overhangs with the T4 archaeal dna polymerase.Reconnect this site then, the result has removed 4 bp or clean frameshit-2.This nucleotide sequence is changed into 5 ＇ CTAGACAGTACCTCTCTGCCA3 ＇ (SEQ ID NO:10) from 5 ＇ CTAGACAGTCTACCTCTCTGCCA, 3 ＇ (SEQ ID NO:9).
At ORFS 2﹠amp; Phase shift mutation in 3: downcut in the pflM I site of 641 of nt, cut 3 nt of 3 ＇ overhangs with the T4 polysaccharase.Contain the Hind III fragment of a klenow filling of streptomycin resistance gene box from pHP45 Ω (Prentki and Kritsch, gene 29:303,1984), be connected on the pflM I fragment of blunt end.Digest then and reconnect this conservative Hind III site.Its net effect is 3 nt that use from 4 nt replacement pflM I sites in the Hind III site.This has produced clean frameshit+1.This nucleotide sequence is changed into 5 ＇ CCAGCAGCCAAAGCTTTGGAAAGATTG3 ＇ (SEQ ID NO:12) from 5 ＇ CCAGCAGCCAATGCTTGGAAAGATTG, 3 ＇ (SEQ IDNO:11).
In Δ Acc I construct, described peptide only keeps 19 amino acid of its original series and has clipped 36 amino acid afterwards.Natural ORF2 peptide is 77 amino acid.In Δ Pf1 construct, except terminal 10 amino acid, this ORF2 peptide sequence is almost without any variation, and the polypeptide that obtains is than 17 amino acid of original length.On the other hand, ORF3 only keeps from 20 amino acid of its N-end and stops behind 31 amino acid.
By " speed become " site-directed mutagenesis method (Stratagene), after ATG, import the primer of an extra G Nucleotide with following design, caused the phase shift mutation in ORF1:
P1:CAACGTACTAGAAATGGAGTAATAAGTACC(SEQ?ID?NO:13)
P2:GGTACTTATTAGTCCATTTCTAGTACGTTG(SEQ?ID?NO:14)
This mutagenesis is eliminated described ORF basically fully.
Cause ATG in the frame opening of AVR1-CO39 locus and suddenly change the 1.05kb fragment cloning that contains AVR1-CO39 in pCB1004, and make following sudden change construct with speed change (quick change) mutagenesis (Stratagene):
Δ ORF1 (ATG → TTT): become mutagenesis by speed, eliminate the initiator codon of ORF1 with primer with sudden change ATG sequence.
Δ ORF3 (ATG → TTT): become mutagenesis by speed, eliminate the initiator codon of ORF3 with primer with sudden change ATG sequence.
Make following clone, but do not detected the allelotrope of sudden change by the transformation assay phenotype yet.
Δ ORF2 (ATG → TTT): become mutagenesis by speed, eliminate the initiator codon of ORF2 with primer with sudden change ATG sequence.
The result:
As above-mentioned; Use cloning process based on collection of illustrative plates; Carry out 20 step chromosome walkings then; From i (magnaporthe grisea) bacterial strain 2539; Separate a kind of gene; this gene is given the interaction special with the Cultivar of rice cultivar CO39.By the subclone method and transform Guy11 ( a kind of bacterial strain that normally CO39 is had virulence ) and become nontoxicity, make the AVR1-CO39 locus go to limit to 1.05kb district.11.05kbSEQ ID NO:1：GATCTGTAAA TTACATATAT TTATTTTGCC GCATTTTGCT AACCGCCTATTCTTTTTAAA ATTTTAACGA TTAAGAACGC AATTCAATTT TGCGTTCTACACAAATTAAC AATTCGTCCA AAAGAGGTAT TTAAGCGAAG ATTTGGCATTTTTTTAATCC ATTTTTAAAA AAATACATCT GCTTTAACCC ACCTTTGCCAAGGGTACCCG GCTAGCATAG CCTTGGTTAC CAAAAACGGC TAAAGCTGTCGATCTATACT ACATTCGGCG CTCTGAACAA CTAAGCAACA GCGAGGAGAT T5CACACCCTAA ATCATGCTGC TAGTAATGCG ATATAATGGC CAAACAACGT ORF1→ACTAGAAATG ACTAATAAGT ACCCAGTCAA GTCAACTTGC TGTAGTATTA ←ORF5 ORF2→TATTTAACGA AGCGTCCATT TACTGCCAGG GCAAGTTTAT CAATGGGACC T1AGTGTTCTCC CTCCTCTGGA CAACTCAGTT CTTTGCAAAC GCTAGACAGTCTACCTCTCT GCCACCATTT TTACTTTTCA AAAATTTACT CCTTGCCGCT T4 ORF3→ACTGAAACTT CTACAATTGA AAGAGCCCAC AATGAAAGTC CAAGCTACATTCGCCACCCT TATCGCCCTT GCGGCTTACT TTCCAGCAGC CAATGCTTGG T2AAAGATTGCA TCATCCAACG TTATAAAGAC GGCGATGTCA ACAACATATATACTGCCAAT AGGAACGAAG AGATAACTAT TGAGGAATAT AAAGTCTTCG ORF6→ ←ORF4TTAATGAGGC CTGCCATCCC TACCCAGTTA TACTTCCCGA CAGATCGGTC T3CTTTCTGGCG ATTTTACATC AGCTTACGCT GACGACGATG AGTCTTGTTG T6 ORF7→ATCAATAAGA GTCCAGGTTG AAAAATTCGC CACCATGGTA ATAGAGGGTTATTTATCTCG GAATAGCAGC CGTGTGTGCA ATTATCACGG CTGTTCCTCTGCGATAGGGA TATTAGAAGC AGGACAAATT TACGGCAATA GCAACCAATTGTCCTTGTCT ATGGATTCGC CCGTCGAATG GAGGCGACGG CGGATCC
Dna sequence analysis has shown that 4 length are 45,77, the 89 and 69 amino acid whose frames (shown in top SEQ ID NO:1, being respectively ORF1, ORF2, ORF3, ORF4) of opening for a short time.Open the frame amino acid sequence coded by these 4 and be expressed as following ID NO.2,3,4 and 5 respectively.Also identified 3 other open frame (ORFS 5,6 and 7 is expressed as following SEQ ID NOS:6,7 and 8 respectively).AVR1-CO39?ORF1?(SEQ?ID?NO:?2)
MTNKYPVKST?CCSIIFNEAS?IYCQGKFING?TSVLPPLDNS
VLCKRAVR1-CO39?ORF2?(SEQ?ID?NO:?3)
MGPVFSLLWT?TQFFANARQS?TSLPPFLLFK?NLLLAATETS
TIERAHNESP?SYIRHPYRPC?GLLSSSQCLE?RLHHPTLAVR1-CO39?ORF3?(SEQ?ID?NO:?4)
MKVQATFATL?IALAAYFPAA?NAWKDCIIQR?YKDGDVNNIY
TANRNEEITI?EEYKVFVNEA?CHPYPVILPD?RSVLSGDFTS
AYADDDESCAVR1-CO39?ORF4?(SEQ?ID?NO:?5)
MAGLINEDFI?FLNSYLFVPI?GSIYVVDIAV?FITLDDAIFP
SIGCWKVSRK?GDKGGECSLD?FHCGLFQLAVR1-CO39?ORF5?(SEQ?ID?NO: 6)
MDASLNIILQ?QVDLTGYLLV?ISSTLFGHYI?ALLAAAVR1-CO39?ORF6?(SEQ?ID?NO: 7)
MRPAIPTQLY?FPTDRSFLAI?LHQLTLTTMS?LVDQAVR1-CO39?ORF7?(SEQ?ID?NO:?8)
(after clone's DNA, continuing)
4 around the ATG of ORF3 in sequence and 5 the conservative bases that find in the fungi translation initiation site are complementary, and contain one at the position 2 terminal and 2 supposition cracking sites that are used to remove signal peptide of hydrophobic amino that are interrupted by Methionin.On another relative chain, identified the 4th and opened frame (ORF4).Yet the sequence around the ATG only contains the sequence that 2 concensus sequences with the fungi translation initiation site are complementary.
In order to estimate the effect of these ORF in giving nontoxicity, in ORF1, ORF2 and ORF3, made rite-directed mutagenesis.The translation initiation codon of each ORF changes TTT into by ATG.In ORF 1 and 3, these sudden changes cause avirulent losing.Phase shift mutation in ORF1 and ORF3 also causes avirulent losing, and the phase shift mutation in ORF 2 does not cause avirulent losing.In sum, these data show ORF1 and the effect of ORF3 in giving rice cultivar CO39 Dui Geshi Magna guarantor plucked instrument bacterium nontoxicity.
The TATA element that lacks any supposition in ATG upstream of shearing site and lasso trick sequence and next-door neighbour ORF1 may show that the sequence that ORF1 and transcripting starting to AVR1-CO39 play a crucial role overlaps.
The distribution of the AVR1-CO39 homologue of embodiment 2 in various i(magnaporthe grisea) choristas
Those hybridization conditions of using as describing in embodiment 1 are surveyed the sample of the i(magnaporthe grisea) form of a large amount of host specifics with the AVR1-CO39 dna fragmentation, to study the distribution of AVR1-CO39 homologue.The result of this research shows, infects the homologue of the most of Avr-CO39 of shortage of chorista of paddy rice Digitaria and wheat.But, the homologue of this gene finds in the chorista that infects Elutine (Setaria) usually.Moreover, the detailed analysis from the locus of paddy rice toxicity chorista Guy 11 is shown, corresponding and contain the DNA incompleteness that has 20 kb at least of the AVR1-CO39 locus of chorista 2539.
Embodiment 3
Bacterium epiphyte body spray water rice plants with the ORF3 that expresses AVR1-CO39 improves the resistance that the Dui Geshi Magna is protected the infection of plucked instrument bacterium
The ORF3 of the AVR1-CO39 that describes in embodiment 1 is transferred in the colibacillary pET expression vector.The suspension that contains transformed into escherichia coli, be sprayed onto on the leaf that carries at the rice plant of the corresponding R gene of AVR1-CO39.Then, these plant are that a kind of plant growing kind to detection has toxic bacterial strain with i(magnaporthe grisea) chorista Guy11 inoculation, Guy11.In contrast, other plant are sprayed with the intestinal bacteria suspension of the plasmid that does not contain ORF3, then with chorista Guy11 inoculation.
With compare with the pretreated inoculation adjoining tree of the intestinal bacteria of the plasmid that lacks ORF3, show as the damaged area and the number of reduction with the pretreated inoculation plant of intestinal bacteria of expression ORF3.These data can be supported the effect of ORF3 in giving Dui Geshi Magna guarantor plucked instrument bacterium nontoxicity.
Embodiment 4
ORF3 encoded protein spray water rice plants with AVR1-CO39 improves the resistance that the Dui Geshi Magna is protected the infection of plucked instrument bacterium
The ORF3 of the AVR1-CO39 that describes in embodiment 1 is transferred in the colibacillary pET expression vector.To toxic influence, these Bacillus coli cells carry and only contain pET carrier (contrast) or pET-ORF3 construct from the colibacillary albumen extract of IPTG inductive in detection.The cell protein extract concentrates by ammonium sulfate precipitation.Unite the inoculation to Cultivar CO39 with toxicity i(magnaporthe grisea) bacterial strain Guy11 and spissated albumen extract, consumption is to contain 5x10 in the 10ml sterilized water 5Individual conidium and 20mg total protein.
Compare with the inoculation adjoining tree that crosses with the albumen co-processing that lacks ORF3, the inoculation plant that crosses with the albumen extract co-processing that contains ORF3 shows as the area and the number of the damage of reduction.These data can be supported the effect of ORF3 in giving Dui Geshi Magna guarantor plucked instrument bacterium nontoxicity process.
Although disclosed embodiment preferred more of the present invention and in addition concrete illustrating, can not think that the present invention is confined to above-mentioned embodiment.Therefore the method that proposes according to following claim can be made various amending methods, and these methods do not depart from scope and spirit of the present invention.
Sequence table＜110〉Sally A.Leong Mark L.Farman
＜120〉from the Cultivar specific gene and methods for using them of rice pathogen i(magnaporthe grisea)
<130>WARF?P98067WO
<150>US60/075,925
<151>1998-02-25
<160>14
<170>FastSEQ?for?Windows?Version?3.0
<210>1
<211>1047
<212>DNA
＜213〉i(magnaporthe grisea)
<400>1gatctgtaaa?ttacatatat?ttattttgcc?gcattttgct?aaccgcctat?tctttttaaa 60attttaacga?ttaagaacgc?aattcaattt?tgcgttctac?acaaattaac?aattcgtcca 120aaagaggtat?ttaagcgaag?atttggcatt?tttttaatcc?atttttaaaa?aaatacatct 180gctttaaccc?acctttgcca?agggtacccg?gctagcatag?ccttggttac?caaaaacggc 240taaagctgtc?gatctatact?acattcggcg?ctctgaacaa?ctaagcaaca?gcgaggagat 300cacaccctaa?atcatgctgc?tagtaatgcg?atataatggc?caaacaacgt?actagaaatg 360actaataagt?acccagtcaa?gtcaacttgc?tgtagtatta?tatttaacga?agcgtccatt 420tactgccagg?gcaagtttat?caatgggacc?agtgttctcc?ctcctctgga?caactcagtt 480ctttgcaaac?gctagacagt?ctacctctct?gccaccattt?ttacttttca?aaaatttact 540ccttgccgct?actgaaactt?ctacaattga?aagagcccac?aatgaaagtc?caagctacat 600tcgccaccct?tatcgccctt?gcggcttact?ttccagcagc?caatgcttgg?aaagattgca 660tcatccaacg?ttataaagac?ggcgatgtca?acaacatata?tactgccaat?aggaacgaag 720agataactat?tgaggaatat?aaagtcttcg?ttaatgaggc?ctgccatccc?tacccagtta 780tacttcccga?cagatcggtc?ctttctggcg?attttacatc?agcttacgct?gacgacgatg 840agtcttgttg?atcaataaga?gtccaggttg?aaaaattcgc?caccatggta?atagagggtt 900atttatctcg?gaatagcagc?cgtgtgtgca?attatcacgg?ctgttcctct?gcgataggga 960tattagaagc?aggacaaatt?tacggcaata?gcaaccaatt?gtccttgtct?atggattcgc 1020ccgtcgaatg?gaggcgacgg?cggatcc 1047
<210>2
<211>45
＜212〉protein
＜213〉i(magnaporthe grisea)
<400>2Met?Thr?Asn?Lys?Tyr?Pro?val?Lys?Ser?Thr?Cys?Cys?Ser?Ile?Ile?Phe?1 5 10 15Asn?Glu?Ala?Ser?Ile?Tyr?Cys?Gln?Gly?Lys?Phe?Ile?Asn?Gly?Thr?Ser
20 25 30Val?Leu?Pro?Pro?Leu?Asp?Asn?Ser?Val?Leu?Cys?Lys?Arg
35 40 45
<210>3
<211>77
＜212〉protein
＜213〉i(magnaporthe grisea)
<400>3Met?Gly?Pro?Val?Phe?Ser?Leu?Leu?Trp?Thr?Thr?Gln?Phe?Phe?Ala?Asn1 5 10 15Ala?Arg?Gln?Ser?Thr?Ser?Leu?Pro?Pro?Phe?Leu?Leu?Phe?Lys?Asn?Leu
20 25 30Leu?Leu?Ala?Ala?Thr?Glu?Thr?Ser?Thr?Ile?Glu?Arg?Ala?His?Asn?Glu
35 40 45Ser?Pro?Ser?Tyr?Ile?Arg?His?Pro?Tyr?Arg?Pro?Cys?Gly?Leu?Leu?Ser
50 55 60Ser?Ser?Gln?Cys?Leu?Glu?Arg?Leu?His?His?Pro?Thr?Leu65 70 75
<210>4
<211>89
＜212〉protein
＜213〉i(magnaporthe grisea)
<400>4Met?Lys?Val?Gln?Ala?Thr?Phe?Ala?Thr?Leu?Ile?Ala?Leu?Ala?Ala?Tyr1 5 10 15Phe?Pro?Ala?Ala?Asn?Ala?Trp?Lys?Asp?Cys?Ile?Ile?Gln?Arg?Tyr?Lys
20 25 30Asp?Gly?Asp?Val?Asn?Asn?Ile?Tyr?Thr?Ala?Asn?Arg?Asn?Glu?Glu?Ile
35 40 45Thr?Ile?Glu?Glu?Tyr?Lys?Val?Phe?Val?Asn?Glu?Ala?Cys?His?Pro?Tyr
50 55 60Pro?Val?Ile?Leu?Pro?Asp?Arg?Ser?Val?Leu?Ser?Gly?Asp?Phe?Thr?Ser65 70 75 80Ala?Tyr?Ala?Asp?Asp?Asp?Glu?Ser?Cys
85
<210>5
<211>68
＜212〉protein
＜213〉i(magnaporthe grisea)
<400>5Met?Ala?Gly?Leu?Ile?Asn?Glu?Asp?Phe?Ile?Phe?Leu?Asn?Ser?Tyr?Leu1 5 10 15Phe?Val?Pro?Ile?Gly?Ser?Ile?Tyr?Val?Val?Asp?Ile?Ala?Val?Phe?Ile
20 25 30Thr?Leu?Asp?Asp?Ala?Ile?Phe?Pro?Ser?Ile?Gly?Cys?Trp?Lys?Val?Ser
35 40 45Arg?Lys?Gly?Asp?Lys?Gly?Gly?Glu?Cys?Ser?Leu?Asp?Phe?His?Cys?Gly
50 55 60Leu?Phe?Gln?Leu65
<210>6
<211>35
＜212〉protein
＜213〉i(magnaporthe grisea)
<400>6Met?Asp?Ala?Ser?Leu?Asn?Ile?Ile?Leu?Gln?Gln?Val?Asp?Leu?Thr?Gly1 5 10 15Tyr?Leu?Leu?Val?Ile?Ser?Ser?Thr?Leu?Phe?Gly?His?Tyr?Ile?Ala?Leu
20 25 30?Leu?Ala?Ala
35
<210>7
<211>34
＜212〉protein
＜213〉i(magnaporthe grisea)
<400>7Met?Arg?Pro?Ala?Ile?Pro?Thr?Gln?Leu?Tyr?Phe?Pro?Thr?Asp?Arg?Ser?1 5 10 15Phe?Leu?Ala?Ile?Leu?His?Gln?Leu?Thr?Leu?Thr?Thr?Met?Ser?Leu?Val
20 25 30Asp?Gln
<210>8
<211>54
＜212〉protein
＜213〉i(magnaporthe grisea)
<400>8Met?Va1?Ile?Glu?Gly?Tyr?Leu?Ser?Arg?Asn?Ser?Ser?Arg?Val?Cys?Asn?1 5 10 15Tyr?His?Gly?Cys?Ser?Ser?Ala?Ile?Gly?Ile?Leu?Glu?Ala?Gly?Gln?Ile
20 25 30Tyr?Gly?Asn?Ser?Asn?Gln?Leu?Ser?Leu?Ser?Met?Asp?Ser?Pro?Val?Glu
35 40 45Trp?Arg?Arg?Arg?Arg?Ile
50
<210>9
<211>23
<212>DNA
＜213〉i(magnaporthe grisea)
<400>9ctagacagtc?tacctctctg?cca
<210>10
<211>21
<212>DNA
<213>Magnaporthe?grisea
<210>10
<211>21
<212>DNA
＜213〉i(magnaporthe grisea)
<400>10ctagacagta?cctctctgcc?a
<210>11
<211>26
<212>DNA
＜213〉i(magnaporthe grisea)
<400>11ccagcagcca?atgcttggaa?agattg
<210>12
<211>27
<212>DNA
＜213〉i(magnaporthe grisea)
<400>12ccagcagcca?aagctttgga?aagattg
<210>13
<211>30
<212>DNA
＜213〉i(magnaporthe grisea)
<400>13caacgtacta?gaaatggagt?aataagtacc
<210>14
<211>30
<212>DNA
＜213〉i(magnaporthe grisea)
<400>14ggtacttatt?agtccatttc?tagtacgttg

Claims (29)

1. one kind from the i(magnaporthe grisea) isolated nucleic acid molecule, and described nucleic acid molecule is given rice cultivar CO39 to containing the special nontoxicity of fungoid pathogenic of this nucleic acid.
2. the nucleic acid molecule of claim 1, this nucleic acid molecule is AVR1-CO39.
3. the nucleic acid molecule of claim 2, the sequence of this nucleic acid molecule comprises part or all of SEQ ID NO:1.
4. the nucleic acid molecule of claim 1, the polypeptide of this nucleic acid molecule encoding are characterised in that and comprise the sequence that is selected from down group: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.
5. the nucleic acid molecule of claim 4, the polypeptide of this nucleic acid molecule encoding comprise the sequence that is selected from down group: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.
6. recombinant DNA molecules comprises the nucleic acid molecule of the claim 1 that manipulative capability ground is connected with the carrier that is used for transformant.
7. recombinant DNA molecules cell transformed with claim 6.
8. the cell of claim 7, this cell is selected from bacterial cell, fungal cell, insect cell and vegetable cell.
9. the cell of claim 8, this cell is a kind of growing nonparasitically upon another plant in the bacterial cell of plant.
10. an Accessory Right requires 8 transformant regenerated transgenic plant.
11. an isolated nucleic acid molecule comprises the sequence that is selected from down group:
A) part or all of SEQ ID NO:1;
B) allelic variant of part or all of SEQ ID NO:1;
C) natural mutation of part or all of SEQ ID NO:1;
D) with the part or all of SEQ ID NO:1 or the sequence of its complement hybridization, the polypeptide of this sequence encoding any polypeptide with SEQ ID NO:1 coding basically is identical;
E) the part or all of sequence of coded polypeptide, polypeptide wherein contain the aminoacid sequence that is selected from down group: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ IDNO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.
12. an oligonucleotide that is about to 10-100 Nucleotide, this oligonucleotide specifically with the part making nucleic acid molecular hybridization of claim 11.
13. a recombinant DNA molecules, the nucleic acid molecule of the claim 11 that is connected with the carrier that is used for transformant with comprising operability.
14. recombinant DNA molecules cell transformed with claim 13.
15. the cell of claim 14, this cell is selected from bacterial cell, yeast cell and vegetable cell.
16. the cell of claim 15, this cell are a kind of growing nonparasitically upon another plant in the bacterial cell of plant.
17. the transgenic plant of the cell regeneration of an Accessory Right requirement 15.
18. polypeptide by the nucleic acid molecule encoding of claim 11.
19. specific antibody of the polypeptide immune to claim 18.
20. one kind by i(magnaporthe grisea) isolated nucleic acid molecule encoded protein, described nucleic acid can be given rice cultivar CO39 to containing the special nontoxicity of fungoid pathogenic of this nucleic acid.
21. the albumen of claim 20, this albumen is by the AVR1-CO39 genes encoding.
22. the albumen of claim 21, this albumen is by the ORF3 coding of AVR1-CO39.
23. the albumen of claim 20, this albumen contain aminoacid sequence SEQID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQID NO:5, SEQ ID NO:6, SEQ ID NO:7 and the SEQ ID NO:8 that is selected from down group.
24. an immunity is specifically at the antibody of the polypeptide of claim 20.
25. express the growing nonparasitically upon another plant in the transgenic bacteria of plant of part A VR1-CO39 gene for one kind, wherein the AVR1-CO39 gene is given rice cultivar CO39 the nontoxicity special to the microorganism of expressing this gene effectively.
26. growing nonparasitically upon another plant in the transgenic bacteria of plant of claim 24, the ORF3 of this bacterial expression SEQ IDNO:1 or function equate body.
Express the polypeptide processing plant that produces 27. a method that strengthens rice cultivar CO39 plant to the resistance scope of pathogenic micro-organism, this method comprise using by AVR1-CO39, used amount excites the special R expression of gene of CO39 in the plant effectively.
28. the method for claim 27, this method comprise with the solution treating plant that contains described polypeptide.
29. the method for claim 27, this method comprise that wherein the polypeptide of AVR1-CO39 genetic expression excites the special R expression of gene of CO39 in the plant effectively with the epiphytic bacterial treatment plant of expressing part A VR1-CO39 gene.
CN99805473A 1998-02-25 1999-02-25 Cultivar specificity gene from the rice pathogen i(magnaporthe grisea), and methods of use Pending CN1308678A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US7592598P 1998-02-25 1998-02-25
US60/075925 1998-02-25

Publications (1)

Publication Number Publication Date
CN1308678A true CN1308678A (en) 2001-08-15

Family

ID=22128797

Family Applications (1)

Application Number Title Priority Date Filing Date
CN99805473A Pending CN1308678A (en) 1998-02-25 1999-02-25 Cultivar specificity gene from the rice pathogen i(magnaporthe grisea), and methods of use

Country Status (10)

Country Link
EP (1) EP1056866A1 (en)
JP (1) JP2002504373A (en)
KR (1) KR20010041277A (en)
CN (1) CN1308678A (en)
AU (1) AU3310599A (en)
CA (1) CA2321950A1 (en)
ID (1) ID27274A (en)
IL (1) IL137881A0 (en)
NO (1) NO20004239L (en)
WO (1) WO1999043824A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2002218017A1 (en) * 2000-10-20 2002-05-06 The United States Of America, As Represented By The Secretary Of Agriculture Plant genes that confer resistance to strains of magnaporthe grisea having avr1 co39 cultivar specificity gene
CN100398556C (en) * 2006-03-16 2008-07-02 华南农业大学 Rice blast fungus non-toxin gene Avr-pii and its application
KR101112656B1 (en) * 2009-04-07 2012-03-14 서울대학교산학협력단 Novel pathogenicity gene in blast fungus to suppress basal defenses of host and uses thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL9000773A (en) * 1990-04-02 1991-11-01 Rijkslandbouwhogeschool PROCESS FOR PROTECTING PLANTS AGAINST PATHOGENS
WO1995031564A2 (en) * 1994-05-11 1995-11-23 John Innes Centre Innovations Limited Method of introducing pathogen resistance in plants
US6100451A (en) * 1995-05-18 2000-08-08 Board Of Trustees Of The University Of Kentucky Pathogen-inducible regulatory element
ES2248810T3 (en) * 1995-06-07 2006-03-16 Cornell Res Foundation Inc RESISTANCE INDUCED BY HYPERSENSIBLE RESPONSE IN PLANTS.
CN1232502A (en) * 1996-03-25 1999-10-20 佛罗里达大学 Antibodies against avirulence/pathogenicity proteins of plant pathogens

Also Published As

Publication number Publication date
JP2002504373A (en) 2002-02-12
IL137881A0 (en) 2001-10-31
ID27274A (en) 2001-03-22
WO1999043824A1 (en) 1999-09-02
NO20004239L (en) 2000-10-19
NO20004239D0 (en) 2000-08-24
KR20010041277A (en) 2001-05-15
EP1056866A1 (en) 2000-12-06
CA2321950A1 (en) 1999-09-02
AU3310599A (en) 1999-09-15

Similar Documents

Publication Publication Date Title
CN1849397A (en) Insecticidal proteins secreted from bacillus thuringiensis and uses therefor
CN1231673A (en) Polynucleotide and its use for modulating a defence response in plants
CN1114694C (en) Procedures and materials for conferring disease resistance in plants
CN1333833A (en) New method of identifying non-host plant disease resistance genes
CN1387572A (en) Plant reglatory sequences for selective control of gene expression
CN1139454A (en) Antimicrobial proteins
CN1134981A (en) Expressive carrier with coded insect-killing protein fusion gene, and transfer gene plant
CN1143978A (en) Antimicrobial proteins from aralia and impatiens
CN1316007A (en) Polynucleotide sequences
CN1429269A (en) Receptors for hypersensitive response elicitors and uses thereof
US9587248B2 (en) Mayetiola destructor susceptibility gene one (Mds-1) and its application in pest management
CN110172465B (en) Application of aspergillus flavus pathogenic gene wprA
CN1234831A (en) Protein kinases and uses thereof
CN1308678A (en) Cultivar specificity gene from the rice pathogen i(magnaporthe grisea), and methods of use
CN1765924A (en) Plant adversity resistance related protein and encoding gene thereof and application
CN1379783A (en) Methods for increasing plant cell proliferation by functionally inhibiting plant cyclin inhibitor gene
CN1280627A (en) Proteinase inhibitor fusion proteins
CN1258317A (en) Process for expression of genes of dengue viruses
CN1335855A (en) Novel protein, gene encoding the same and method of utilization thereof
CN1219586A (en) Two kinds of encoding insecticidal protein gene and bivalent fused expression carrier and their application
CN101062942A (en) Aspergillus fumigatus original active oxygen lethality related protein and its coding gene
CN1084565A (en) Have the active novel protein of Nitrile hydratase and this proteic gene of coding
CN1110559C (en) Gene regulating aureobasidin sensitivity
US6794176B1 (en) Cultivar specificity gene from the rice pathogen Magnaporthe grisea, and methods of use
CN1372436A (en) Seedless fruit production

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication