CN1304425C - Fusion protein containing soluble tumor necrosis factor II type receptor and interleukin I receptor agonist IL1Ra its preparation process and medicine composition - Google Patents

Abstract

The present invention relates to fusion protein containing a soluble tumor necrosis factor II type receptor p75 and interleukin I receptor antagonist (ILIRa), a nucleic acid molecule for coding the fusion protein, a preparation method of the fusion protein of the present invention and a medical composition containing the fusion protein of the present invention.

Description

Contain fusion rotein of soluble tumor necrosis factor II type receptor and interleukin I receptor antagonist IL1Ra and preparation method thereof

Technical field

The present invention relates to contain the fusion rotein of soluble tumor necrosis factor II type receptor and interleukin I receptor antagonist IL1Ra, its preparation method, and pharmaceutical composition.

Background technology

Rheumatoid arthritis (Rheumatoid Arthritis, RA) be a kind of worldwide common disease, be presented as that extremities joint is red, swollen, pain, have a strong impact on patient's quality of life, as not treating, just can cause permanent sequelaes such as ankylosis deformity in general 2 years.Sickness rate that should disease in the U.S. is 1%[1 nearly].Domestic still do not have a reliable morbidity statistics numeral, estimates with the U.S. approachingly, is to have a strong impact on healthy disease, and the loss that society is caused is difficult to estimate.

At present the scheme of clinical treatment RA is a lot, and is first-selected with heavy dose of NSAID (non-steroidal anti-inflammatory drug) may command symptom, and as invalid, then immunosuppressive drug such as clinical first-selected methotrexate is treated.About 1/4th patient falls ill first after treatment in time can no longer be recurred throughout one's life, and about 1/2nd patient symptom after treating is temporarily alleviated, but still can show effect repeatedly, and part finally develops into joint function disturbance; About 1/4th patient is all invalid at present all conventional treatmenies.

The cytokine relevant with the RA inflammation has interleukin 1 (IL-1), tumour necrosis factor (TNF), interleukin 6 (IL-6) etc.In these cytokines, IL-1 is that it can cause serious inflammation to the most influential direct acting material of inflammation.Many inflammation of being brought out by IL-1 can and be eliminated by the prevention of IL-1 receptor antagonist, and IL-1Ra can suppress whole effects of IL-1, and I, II, the clinical study of III phase for the treatment of septic shock with IL-1Ra (commodity are called Antri) obtain curative effect preferably.Give acute rheumatoid arthritis patient subcutaneous injection soluble human reorganization IL-1RI, every day, 125-1000ug/m2 continuous 28 days, had half patient's symptom and Signs obviously to improve approximately.Promote the material that IL-1 discharges, also can cause inflammation indirectly,, suppress the generation of IL-1 or suppress the heavy saccharase of IL-1 (ICE) also to prevent or diminish inflammation therefore by the release of blocking-up IL-1 as lipopolysaccharides and intracellular toxin.

The direct acting medicine of RA is comprised IL-1 receptor antibody, natural polypeptides class IL-1 receptor antagonist, natural organic-compound, and the organic synthesis small molecules.IL-1 receptor antagonist cytokine is complicated natural product, comprises the compound that can produce inflammation and anti-inflammatory action, and the balance of IL-1 and IL-1 receptor antagonist is an accurate regulatory mechanism, and it controls intravital inflammatory response.If inflammation is too serious, the IL-1 receptor antagonist can appropriateness discharge to guarantee the unlikely breaking-up body of inflammation effect.If in the body IL-1 receptor antagonist discharge not enough, the effect that can adopt the method for injection to resist IL-1.Many natural organic-compounds can block the release of the IL-1 that is caused by intracellular toxin, but only have minority to have the effect that can resist IL-1 in the receptor site.

Pathogeny to RA discovers that TNF also plays a part very crucial in the pathology process of this disease, the TNF horizontal abnormality rising [4-7] in patient or the animal model pathology joint cavity.TNF is that the intravital a kind of multifunction immunity of machine is regulated molecule, and it can play a role with the receptors bind on the cytolemma, often causes the death (its title promptly derives from this) of target cell or attracts immune effector cell in partial gathering.Owing to present reason still not fully aware of, its content in joint cavity raises in a large number, the receptors bind of one side and synovium of joint cell causes this cell coup injury, on the other hand, it can convene immune effector cell to assemble so far, secrete more cytokine, produce stronger more persistent autoimmune response.

Antibody molecule fragment and other albumen are merged the fusion rotein that can obtain having the various biological function, it can be divided into two big classes, one class is that the Fv section is combined with other biological activity protein, utilize the specific recognition function of antibody that some biological activity is guided in privileged site, targeted therapy is its main application fields.Another kind of is the antibody fusion protein that contains the Fc section.The Fc section can give immunoadhesin following function: (1) is used for detecting or purifying by combining with anti-Ig or albumin A; (2) the antibody mediated effect function of Fc section mediation is as ADCC, complement-fixing and opsonization etc.; (3) increase the transformation period of this albumen in blood.

There is the people to make up human soluble tumor necrosis factor II receptor (sTNF-RII abroad by genetic engineering means, be called p75 again) with the fusion rotein of people Ig antibody Fc fragment, discover that this fusion rotein has neutralizing effect to TNFa under isolated condition, therefore might succeed in developing the specific medicament of treatment rheumatoid arthritis.

Based on the above, in order to provide treatment RA more effective, more stable fusion rotein class medicine, the present invention has carried out further improvement, adopt the biotechnology means to be connected with IL-1 receptor antagonist IL1Ra the p75 gene, their fusion gene is expressed in appropriate carriers, prepare functional fusion rotein.

Summary of the invention:

1. goal of the invention

This make eye bright is to provide the fusion rotein that contains soluble tumor necrosis factor II type receptor (p75) and interleukin I receptor antagonist IL-1Ra.

The object of the invention also is to provide the nucleic acid molecule of encoding said fusion protein.

The object of the invention also is to provide the method for preparing fusion rotein of the present invention.

The object of the invention also is to provide the pharmaceutical composition that contains fusion rotein of the present invention.

2. technical scheme

In order to realize purpose of the present invention, the invention process following technical scheme.

The invention provides a kind of fusion rotein, comprise human soluble tumor necrosis factor II receptor, human normal immunoglobulin Fc fragment and interleukin I receptor antagonist IL1Ra, its aminoacid sequence comprises SEQ ID NO:1.

The ripe activity form of this fusion rotein contains 619 amino acid altogether, wherein the 1-235 position is the aminoacid sequence (GeneBank NM 001066) of p75, the 236-467 position is the segmental aminoacid sequence of people Fc, and the 468-619 position is the aminoacid sequence (GeneBank X50125) of IL-1Ra.Certainly, also p75 can be connected in the segmental C of Fc end and IL-1Ra is connected in its N end, obtain the fusion rotein shown in the SEQ ID NO:2.

The present invention also provides another kind of fusion rotein, comprises human soluble tumor necrosis factor II receptor, catenation sequence and interleukin I receptor antagonist IL1Ra, and its aminoacid sequence comprises SEQ ID NO:3.

The ripe activity form of this fusion rotein contains 619 amino acid altogether, wherein the 1-152 position is the aminoacid sequence (GeneBank X50125) of IL-1Ra, the 153-167 position is a catenation sequence, and the 168-402 position is the aminoacid sequence (GeneBank NM 001066) of p75.In like manner, also IL-1Ra can be connected in the C end of catenation sequence and, obtain the fusion rotein shown in the SEQ ID NO:4 the N end that p75 is connected in catenation sequence.

When two genes or gene fragment being reassembled into a coding region and constitute the encoding sequence of fusion rotein, often need to add a catenation sequence between two target fragment.The length of catenation sequence is proteic folding and stable extremely important to two.If catenation sequence is too short, may influence the folding of two albumen higher structures, thereby interfere with each other, if catenation sequence is oversize, relate to immunogenic problem again.The rule that should follow during the design catenation sequence comprises: 1) will use its encoded polypeptides can not have the ability that forms secondary structure; 2) its encoded polypeptides can not be by the glycosylation signal; 3) too much hydrophobic amino acid can not be arranged.In view of this, the present invention has designed has elasticity and hydrophobic catenation sequence (Gly4Ser) 3 (SEQ ID NO:9) preferably, and IL-1Ra and soluble tumor necrosis factor receptor p75 are connected to its two ends.The fusion gene cloning that obtains makes it obtain to efficiently express in Chinese hamster ovary celI to carrier for expression of eukaryon.

According to above-described aminoacid sequence, present technique field personnel can make fusion rotein of the present invention with various known method easily.These methods are such as but not limited to the recombinant DNA method, synthetic, wait [referring to Murray KM, Dahl SLAnn; Pharmacother 1997Nov; 31 (11): 1335-8].In addition, the invention provides one of coding fusion rotein nucleic acid molecule of the present invention, comprise the sequence shown in SEQ ID NO:5 or 6.The nucleic acid molecule that the present invention also provides code book to invent another fusion rotein comprises the sequence shown in SEQ ID NO:7 or 8.

Though more than provided the specific dna molecular nucleotide sequence of code book invention fusion rotein, but, coding nucleic acid as herein described comprises thymus nucleic acid (DNA) and Yeast Nucleic Acid (RNA), also comprise the DNA that forms by nucleotide analog or equivalent, the analogue of RNA, strand (sense strand or antisense strand) and double stranded polynucleotide.The homologous sequence that also comprises the above sequence.

The present invention also provides a kind of expression vector, comprises one section and is selected from the expression regulation sequence that the sequence of SEQ ID NO:5 or SEQ ID NO:8 is connected with operability with it.Expression vector can adopt commercially available such as but not limited to: pDR (New England Biolabs product), pUC18 etc. can be used for the carrier that eukaryotic cell system is expressed.Those skilled in the art are not difficult to select suitable expression vector according to host cell.For example, when the present invention selects CHO to be host cell, can determine that pDR is one of its expression vector that is fit to.Nucleic acid sequence encoding of the present invention imported in the selected empty carrier can obtain expression vector of the present invention.One of embodiment of the present invention is the plasmid pDR-(p75Ig-IL1Ra) that contains fusion rotein encoding sequence SEQ ID NO:3 of the present invention, and its enzyme Qie Tezheng sees Fig. 2.

The present invention also provides the host cell of expressing fusion rotein of the present invention, wherein contains encoding sequence SEQ ID NO:3 of the present invention or 4.The eukaryotic cell of described host cell for using always, such as but not limited to CHO, COS cell, 293 cells, RSF cell etc.

The present invention also provides a kind of and prepares the method for fusion rotein of the present invention with recombinant DNA, and its step comprises:

1) provide the nucleotide sequence of encoding fusion protein, described sequence is selected from SEQ ID NO:5 to SEQ IDNO:8;

2) make up suitable expression vector;

3) this expression vector is imported proper host cell;

4) cultivate transformed host cell under conditions suitable for the expression;

5) collect supernatant liquor, and the purified fusion protein product.

According to nucleotide sequence as herein described, present technique field personnel can make coding nucleic acid of the present invention with various known method easily.These methods such as but not limited to: the preparation PCR, DNA synthesizes (J. Sa nurse Brooker, " molecular cloning experiment guide ").

Restriction enzyme mapping according to known unloaded expression vector, those skilled in the art can shear and splicing by Restriction Enzyme according to ordinary method, encoding sequence of the present invention is inserted suitable restriction site, make expression vector of the present invention, and pDR-for example shown in Figure 2 (p75Ig-IL1Ra) and pDR-shown in Figure 3 (the IL1Ra-catenation sequence-p75).

In one of embodiment, can make up nucleic acid sequence encoding of the present invention by overlapping PCR, referring to Fig. 1.Wherein, based on the design of primers of known array, the preparation, and the setting of PCR reaction parameter and control can react with reference to the PCR described in the US6406863.

Described encoding sequence is imported host cell can adopt the multiple known technology of this area, such as but not limited to: calcium phosphate precipitation, protoplastis merges, liposome transfection, electroporation, microinjection, reverse transcription method, phage transduction method, alkalimetal ion method.

About the cultivation and the expression of host cell can be referring to Olander RM Dev Biol Stand 1996; 86:338.

Can collect clear liquid by cell and the residue in the centrifugal removal suspension.Can identify by electrophoresis.

The present invention also provides the pharmaceutical composition that is used for the treatment of RA of the carrier that contains fusion rotein of the present invention and pharmaceutically approve.Except that fusion rotein of the present invention, also can contain conventional excipients in the described pharmaceutical composition, and can be made into various formulations as effective constituent.Associated viscera can be translated referring to " up-to-date drug preparation technique and application " An Shulin, Wang Xianhong etc.

By the above and in conjunction with embodiment hereinafter, those skilled in the art are not difficult to find out above-mentioned and other feature and advantage of the present invention.

Description of drawings

Fig. 1: the cleavage map of the pDR-(p75Ig-IL1Ra) that the present invention makes up.Wherein, HCMV-people cytomegalovirus promotor is main instantaneous early promoter; BGH pA-Trobest poly VITAMIN B4 signal; SV40ori-simian virus 40 early promoters and replication origin; The DHFR-dihydrofolate reductase gene; The replication origin of pUC ori-plasmid; AmpR-beta lactamase gene.

Fig. 2: the pDR-that the present invention makes up (cleavage map of IL1Ra-catenation sequence-p75).

Embodiment

Embodiment 1:p75-Ig-IL1Ra Expression of Fusion Protein

1. make up the plasmid pGEMT-(p75-Ig-IL1Ra) that contains coding nucleic acid SEQ ID NO:1

1.1:pGEMT-p75Ig preparation:

Hold primer P1 (SEQ ID NO:11) according to p75 sequences Design 5 ':

5’CAG aagcttATGttgcccgcccaggtggcatttacaccctac

Wherein, introduce 3 protection base CAG, a HindIII restriction enzyme site aagctt and an initiator codon ATG successively at 5 ' end.

The primer P2 (SEQ IDNO:12) that holds according to 5 of 3 of p75 sequence and Ig sequences Design cross-over connection p75 ' end and Ig Fc ':

5’gtcgcaggacttgggctcgtcgccagtgctcccttc

The polynucleotide passage of design entrusts Shanghai to give birth to worker's biotechnology company limited on behalf of synthetic and carry out the PAGE purifying, reference literature Chrisostomos Prodromou and Laurenee H, and the method for Pearl (1992) is carried out segmental synthetic.

Synthetic good fragment is dissolved in the tri-distilled water of sterilization according to the concentration of 22 μ g/ μ l, is template with the sequence (GeneBank NM_001066) of p75, as primer, in accordance with the following methods carries out PCR with commercially available PCR test kit with P1 and P2:

The composition of reaction system:

Composition	Quantity (μ l)
		10X PCR reaction buffer 25mM Mg 2SO 4Taq enzyme (5U/ μ l) primer (2 μ g/ μ l) template (2ug/ml) sterilization tri-distilled water	10 10 2 each 1 μ l to 100 μ l

Reaction conditions:

Pre-sex change: 94 ℃, 2 minutes;

Major cycle: 94 ℃, 1 minute; 55 ℃, 1 minute; 72 ℃, 3 minutes;

Cycle number: 20

Extend the back: 72 ℃, and 5 minutes.

The PCR process is carried out on PROGENE Genium thermal cycler.

Carry out PCR according to above-mentioned condition.After finishing product electrophoresis on 0.8% sepharose is identified that finding has the band of a molecular weight about 720bp, is reclaimed test kit with the glue of Promega company and reclaim this fragment that the specification sheets of operating according to producer carries out.

Design 3 ' end primer P3 (SEQ ID NO:13) according to the Ig fragments sequence:

5’-cttgccgggggacagggac

With Ig Fc fragments sequence (GeneBank X52015) and more than the 720bp dna fragmentation that makes be template, as primer, carry out PCR as previously mentioned with 5 of p75 ' end primer P1 and the segmental 3 ' end of Ig Fc primer P3 with commercially available PCR test kit.

After finishing product is identified on 0.8% agarose gel electrophoresis that finding has the band of a molecular weight about 1400bp, is reclaimed test kit with the glue of Promega company and reclaim this fragment that the specification sheets of operating according to producer carries out.

The DNA that obtains is cloned on the pGEMT carrier back transformed into escherichia coli and is carried out blue hickie screening according to ordinary method.Cut by enzyme and to identify and a right-on clone of sequence has been confirmed in order-checking, be pGEMT-(p75-Ig).

1.2:pGEMT-IL1Ra preparation:

Sequences Design primer upstream primer (5 ') P4 (SEQ ID NO:14) and downstream primer (3 ' end) P5 (SEQ ID NO:15) according to IL1Ra:

P4：5’CAGcgaccctctgggagaaaatccagcaag

P5：5’CAG gaattcctcgtcctcctggaagtag

Wherein, cag is the protection base, and gaattc is that EcoR I restriction enzyme site primer entrusts Shanghai to give birth to worker's biotechnology company limited on behalf of synthetic and carry out the PAGE purifying.

(GeneBank X50125) is template with the IL1Ra sequence, is primer with P4 and P5, carries out PCR by preceding method and condition.Electrophoresis on sepharose obtains the band that molecular weight is about 460bp, carries out gel and reclaims.

The DNA that obtains is cloned on the pGEMT carrier back transformed into escherichia coli and is carried out blue hickie screening according to ordinary method.Cut the right-on clone of affirmation sequence that identifies and check order by enzyme, be pGEMT-IL1Ra.

1.3:pGEMT-(p75-Ig-IL1Ra) the i.e. acquisition of (SEQ ID NO:1):

The primer P6 (SEQ IDNO:16) that holds according to 3 of 5 of the sequences Design cross-over connection IL1Ra of IL1Ra and Ig ' end and Ig ':

5’gtccctgtcccccggcaagcgaccctctgggagaaaatc

With the pGEMT-p75Ig and the pGEMT-IL1Ra that prepare previously is template, is primer with downstream primer P5 and the cross-over connection primer P6 of IL1Ra, carries out PCR according to previous methods.After finishing product is identified on 0.8% agarose gel electrophoresis that reclaim the band of molecular weight about 475bp, purifying obtains dna fragmentation.With this fragment and pGEMT-p75Ig is template, with P1 and P5 is that primer carries out PCR, and product carries out agarose electrophoresis then, finds to have the band of a molecular weight at 1857bp, glue recovery test kit with Promega company reclaims this fragment, and operation is carried out according to the specification sheets of producer.

The DNA that obtains is cloned on the pGEMT carrier according to ordinary method, and transformed into escherichia coli also carries out blue hickie screening.Cut by enzyme and to identify and a right-on clone of sequence has been confirmed in order-checking, be pGEMT-p75-Ig-IL1Ra (SEQ ID NO:1).

2. the structure of expression vector pDR-(p75-Ig-IL1Ra)

With HindIII and the two enzymic digestions of EcoRI (Promega), the p75-Ig-IL1Ra gene fragment is downcut from pGEMT-(p75Ig-IL1Ra) carrier, be cloned in the pDR carrier (NewEngland Biolabs product) of same two enzymic digestions, obtain pDR-(p75-Ig-IL1Ra).Enzyme is cut and is identified the expression vector that makes up.

3.CHO the transfection of cell

(IL1Ra-catenation sequence-p75) imports CHO-dhfr-cell (buy obtain from Invitrogen or Gibco company) with expression vector pDR-with the liposome transfection method.The transfection reagent box is available from Invitrogene company, and the transfection schedule of operation is carried out according to the specification sheets of producer.Transfection is carried out changing after 24 hours and is selected substratum to screen, and selects substratum to be: 15% foetal calf serum (Gibco)+RPM1640/DEME.In 37 ℃, 5%CO ₂Cultivate in the incubator.Treat that the clone forms the back with dihydrofolate reductase inhibitor methotrexate (MTX) screening of pressurizeing, concentration is from 2 * 10 ^-8Mol/L to 5 * 10 ^-7The pressurization of mol/L gradient is carried out subclone with limiting dilution assay.

4. express

The high-expression clone that screening is obtained is with serum free medium CHO-S-SFM II substratum (GiBco company product) enlarged culturing: pH value is 7.0-7.2; 37 ± 0.1 ℃ of temperature; Glucose concn 1.0～1.5g/L.

Product albumen is a secretor type, remove cell and cell residue with the method for centrifugal collection after, obtain to contain the supernatant of expression product.

The fusion rotein that rProtein A affinity chromatography column separating purification is expressed.The purifying rear fusion protein is carried out the SDS-PAGE gel electrophoresis analysis: will after the 10 μ g of sample on the albumen behind the ion-exchange chromatography purifying carry out SDS-PAGE, dye with Kao Masi light blue G250; On the identical purification of samples behind the capable SDS-PAGE of sample 6 μ g with cma staining, respectively two kinds of painted painted bands are carried out spectroscopic analysis with BECKMAN DU650 spectrophotometer, to determine (the Kao Masi light blue dyeing: 600nm of optimum scanning wavelength; Cma staining: 490nm), carry out glue scanning (every millimeter reading 2 times) then, the scanning peak is carried out automatic area integral, draw the content and the purity at target protein peak through instrument.Experimental result shows that we are not less than 98% by resulting purity of protein.

Embodiment 2:IL1Ra-catenation sequence-p75 Expression of Fusion Protein

1.pGEM-(IL1Ra-catenation sequence-p75) is the preparation of coding nucleic acid SEQ ID NO:3

Referring to Fig. 1 b, the present invention makes up the SEQID NO:3 sequence of coding IL1Ra-catenation sequence-p75 fusion rotein by overlapping PCR.Wherein, solid line is represented the IL1Ra gene, and dotted line is represented the p75Ig gene.Arrow represents that gene duplicates from 5 '-3 ' direction.Primer a and b are used in the PCR1 reaction, are that template generates ab product (IL1Ra) with the pGEMT-IL1Ra carrier.The PCR2 reaction is another PCR reaction, uses primer c and d, is that template generates cd product (p75) with the pGEMT-p75 carrier.5 of Oligo-b ' end is complementary with 5 of oligo-c ' end.Overlapping PCR is promptly obtaining under the segmental situation of ab and cd, uses primer a and d, and it is that template continues the PCR reaction that 5 of Oligo-b ' end becomes strand with the complementary institute of 5 of oligo-c ' end, obtains complete long-chain fusion gene.

According to foregoing IL1Ra and p75 sequence and catenation sequence, design following primer:

Cross-over connection primer P7 (SEQ ID NO:17):

aatgccacctgggcgggcaa GGAGCCGCCGCCGCCGGAGCCGCCGCCGCCGGAGCCG CCGCCGCCctcgtcctcctggaagtag

5 of this primer ' end is overlapping with 5 of p75 ' end, and middle capitalization line part is catenation sequence (45bp), and 3 ' end is overlapping with 3 of IL1Ra ' end.

5 of IL1Ra ' holds primer P8 (SEQ ID NO:18):

P8：5’CAG aagcttATGcgaccctctgggagaaaatccagcaag

Wherein, introduce protection base CAG, HindIII restriction enzyme site successively at 5 ' end Aagctt andAn initiator codon ATG.

3 of p75 ' holds primer P9 (SEQ ID NO:19):

P9：5’CAG gaattcgtcgccagtgctcccttcagc

Wherein, introduce protection base CAG and EcoRI restriction enzyme site successively at 5 ' end Gaattc.

PGEMT-IL1Ra with embodiment 1 preparation is a template, is primer with P7 and P8, carries out PCR by preceding method and condition.Product is electrophoresis on sepharose, obtains the band that molecular weight is about 500p, carries out gel and reclaims the required dna fragmentation of acquisition.Be that template is a primer with P8 and P9 with this product and aforementioned pGEMT-(p75-Ig) then, carry out PCR, product is electrophoresis on sepharose, obtains the band that molecular weight is about 1200bp, carry out gel and reclaim the required dna fragmentation IL1Ra-catenation sequence-p75 of acquisition, i.e. SEQ IDNO:3.

The DNA that obtains is cloned on the pGEMT carrier back transformed into escherichia coli and is carried out blue hickie screening according to ordinary method.

Cut by enzyme and to identify and the right-on clone of sequence pGEM-(IL1Ra-catenation sequence-p75) is confirmed in order-checking.

2. the expression vector pDR-(structure of IL1Ra-catenation sequence-p75)

With HindIII and the two enzymic digestions of EcoRI (Promega), (the IL1Ra-catenation sequence-p75) carrier downcuts from pGEMT-with IL1Ra-catenation sequence-p75 gene fragment, be cloned in the pDR carrier (New England Biolabs product) of same two enzymic digestions, obtain pDR-(IL1Ra-catenation sequence-p75).Enzyme is cut and is identified the expression vector that makes up.

3.CHO the transfection of cell

(IL1Ra-catenation sequence-p75) imports CHO-dhfr-cell (buy obtain from Invitrogen or Gibco company) with expression vector pDR-with the liposome transfection method.The transfection reagent box is available from Invitrogene company, and the transfection schedule of operation is carried out according to the specification sheets of producer.Transfection is carried out changing after 24 hours and is selected substratum to screen, and selects substratum to be: 15% foetal calf serum (Gibco)+RPM1640/DEME.In 37 ℃, 5%CO ₂Cultivate in the incubator.Treat that the clone forms the back with dihydrofolate reductase inhibitor methotrexate (MTX) screening of pressurizeing, concentration is from 2 * 10 ^-8Mol/L to 5 * 10 ^-7The pressurization of mol/L gradient is carried out subclone with limiting dilution assay.

4. express

The high-expression clone that screening is obtained is with serum free medium CHO-S-SFM II substratum (GiBco company product) enlarged culturing.PH value is 7.0-7.2; 37 ± 0.1 ℃ of temperature; Glucose concn 1.0～1.5g/L.

Product albumen is the secretor type product, remove cell and cell residue with the method for centrifugal collection after, obtain to contain the supernatant of expression product.

The fusion rotein that rProtein A affinity chromatography column separating purification is expressed.The purifying rear fusion protein is carried out the SDS-PAGE gel electrophoresis analysis: will after the 10 μ g of sample on the albumen behind the ion-exchange chromatography purifying carry out SDS-PAGE, dye with Kao Masi light blue G250; On the identical purification of samples behind the capable SDS-PAGE of sample 6 μ g with cma staining, respectively two kinds of painted painted bands are carried out spectroscopic analysis with BECKMAN DU650 spectrophotometer, to determine (the Kao Masi light blue dyeing: 600nm of optimum scanning wavelength; Cma staining: 490nm), carry out glue scanning (every millimeter reading 2 times) then, the scanning peak is carried out automatic area integral, draw the content and the purity at target protein peak through instrument.Experimental result shows that we are not less than 98% by resulting purity of protein.

Sequence table

＜110〉Lansheng Shangke Chuangye Investment Co., Ltd., Shanghai

＜120〉contain the fusion rotein of soluble tumor necrosis factor II type receptor and interleukin I receptor antagonist IL1Ra, its preparation method, and pharmaceutical composition

<130>023430

<160>19

<170>PatentIn version 3.0

<210>1

<211>619

<212>PRT

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉p75-Ig-IL1Ra fusion rotein

<400>1

Leu Pro Ala Glu Val Ala Phe Thr Pro Tyr Ala Pro Glu Pro Gly Ser

1 5 10 15

Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln Thr Ala Gln Met Cys Cys

20 25 30

Ser Lys Cys Ser Pro Gly Gln His Ala Lys Val Phe Cys Thr Lys Thr

35 40 45

Ser Asp Thr Val Cys Asp Ser Cys Glu Asp Ser Thr Tyr Thr Gln Leu

50 55 60

Trp Asn Trp Val Pro Glu Cys Leu Ser Cys Gly Ser Arg Cys Ser Ser

65 70 75 80

Asp Gln Val Glu Thr Gln Ala Cys Thr Arg Glu Gln Asn Arg Ile Cys

85 90 95

Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu Ser Lys Gln Glu Gly Cys

100 105 110

Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg Pro Gly Phe Gly Val Ala

115 120 125

Arg Pro Gly Thr Glu Thr Ser Asp Val Val Cys Lys Pro Cys Ala Pro

130 135 140

Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr Asp Ile Cys Arg Pro His

145 150 155 160

Gln Ile Cys Asn Val Val Ala Ile Pro Gly Asn Ala Ser Met Asp Ala

165 170 175

Val Cys Thr Ser Thr Ser Pro Thr Arg Ser Met Ala Pro Gly Ala Val

180 185 190

His Leu Pro Gln Pro Val Ser Thr Arg Ser Gln His Thr Gln Pro Thr

195 200 205

Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser Phe Leu Leu Pro Met Gly

210 215 220

Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly Asp Glu Pro Lys Ser Cys

225 230 235 240

Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly

245 250 255

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met

260 265 270

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His

275 280 285

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val

290 295 300

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr

305 310 315 320

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly

325 330 335

Lys Asp Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Met

340 345 350

Gln Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val

355 360 365

Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser

370 375 380

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Arg His Ile Ala Val Glu

385 390 395 400

Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro

405 410 415

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val

420 425 430

Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met

435 440 445

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser

450 455 460

Pro Gly Lys Arg Pro Ser Gly Arg Lys Ser Ser Lys Met Gln Ala Phe

465 470 475 480

Arg Ile Trp Asp Val Asn Gln Lys Thr Phe Tyr Leu Arg Asn Asn Gln

485 490 495

Leu Val Ala Gly Tyr Leu Gln Gly Pro Asn Val Asn Leu Glu Glu Lys

500 505 510

Ile Asp Val Val Pro Ile Glu Pro His Ala Leu Phe Leu Gly Ile His

515 520 525

Gly Gly Lys Met Cys Leu Ser Cys Val Lys Ser Gly Asp Glu Thr Arg

530 535 540

Leu Gln Leu Glu Ala Val Asn Ile Thr Asp Leu Ser Glu Asn Arg Lys

545 550 555 560

Gln Asp Lys Arg Phe Ala Phe Ile Arg Ser Asp Ser Gly Pro Thr Thr

565 570 575

Ser Phe Glu Ser Ala Ala Cys Pro Gly Trp Phe Leu Cys Thr Ala Met

580 585 590

Glu Ala Asp Gln Pro Val Ser Leu Thr Asn Met Pro Asp Glu Gly Val

595 600 605

Met Val Thr Lys Phe Tyr Phe Gln Glu Asp Glu

610 615

<210>2

<211>619

<212>PRT

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉IL1Ra-Ig-p75 fusion rotein

<400>2

Arg Pro Ser Gly Arg Lys Ser Ser Lys Met Gln Ala Phe Arg Ile Trp

1 5 10 15

Asp Val Asn Gln Lys Thr Phe Tyr Leu Arg Asn Asn Gln Leu Val Ala

20 25 30

Gly Tyr Leu Gln Gly Pro Asn Val Asn Leu Glu Glu Lys Ile Asp Val

35 40 45

Val Pro Ile Glu Pro His Ala Leu Phe Leu Gly Ile His Gly Gly Lys

50 55 60

Met Cys Leu Ser Cys Val Lys Ser Gly Asp Glu Thr Arg Leu Gln Leu

65 70 75 80

Glu Ala Val Asn Ile Thr Asp Leu Ser Glu Asn Arg Lys Gln Asp Lys

85 90 95

Arg Phe Ala Phe Ile Arg Ser Asp Ser Gly Pro Thr Thr Ser Phe Glu

100 105 110

Ser Ala Ala Cys Pro Gly Trp Phe Leu Cys Thr Ala Met Glu Ala Asp

115 120 125

Gln Pro Val Ser Leu Thr Asn Met Pro Asp Glu Gly Val Met Val Thr

130 135 140

Lys Phe Tyr Phe Gln Glu Asp Glu Glu Pro Lys Ser Cys Asp Lys Thr

145 150 155 160

His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser

165 170 175

Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg

180 185 190

Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro

195 200 205

Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala

210 215 220

Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val

225 230 235 240

Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Asp Tyr

245 250 255

Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Met Gln Lys Thr

260 265 270

Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu

275 280 285

Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys

290 295 300

Leu Val Lys Gly Phe Tyr Pro Arg His Ile Ala Val Glu Trp Glu Ser

305 310 315 320

Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp

325 330 335

Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser

340 345 350

Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala

355 360 365

Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

370 375 380

Leu Pro Ala Glu Val Ala Phe Thr Pro Tyr Ala Pro Glu Pro Gly Ser

385 390 395 400

Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln Thr Ala Gln Met Cys Cys

405 410 415

Ser Lys Cys Ser Pro Gly Gln His Ala Lys Val Phe Cys Thr Lys Thr

420 425 430

Ser Asp Thr Val Cys Asp Ser Cys Glu Asp Ser Thr Tyr Thr Gln Leu

435 440 445

Trp Asn Trp Val Pro Glu Cys Leu Ser Cys Gly Ser Arg Cys Ser Ser

450 455 460

Asp Gln Val Glu Thr Gln Ala Cys Thr Arg Glu Gln Asn Arg Ile Cys

465 470 475 480

Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu Ser Lys Gln Glu Gly Cys

485 490 495

Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg Pro Gly Phe Gly Val Ala

500 505 510

Arg Pro Gly Thr Glu Thr Ser Asp Val Val Cys Lys Pro Cys Ala Pro

515 520 525

Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr Asp Ile Cys Arg Pro His

530 535 540

Gln Ile Cys Asn Val Val Ala Ile Pro Gly Asn Ala Ser Met Asp Ala

545 550 555 560

Val Cys Thr Ser Thr Ser Pro Thr Arg Ser Met Ala Pro Gly Ala Val

565 570 575

His Leu Pro Gln Pro Val Ser Thr Arg Ser Gln His Thr Gln Pro Thr

580 585 590

Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser Phe Leu Leu Pro Met Gly

595 600 605

Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly Asp

610 615

<210>3

<211>402

<212>PRT

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉IL1Ra-catenation sequence-p75 fusion rotein

<400>3

Arg Pro Ser Gly Arg Lys Ser Ser Lys Met Gln Ala Phe Arg Ile Trp

1 5 10 15

Asp Val Asn Gln Lys Thr Phe Tyr Leu Arg Asn Asn Gln Leu Val Ala

20 25 30

Gly Tyr Leu Gln Gly Pro Asn Val Asn Leu Glu Glu Lys Ile Asp Val

35 40 45

Val Pro Ile Glu Pro His Ala Leu Phe Leu Gly Ile His Gly Gly Lys

50 55 60

Met Cys Leu Ser Cys Val Lys Ser Gly Asp Glu Thr Arg Leu Gln Leu

65 70 75 80

Glu Ala Val Asn Ile Thr Asp Leu Ser Glu Asn Arg Lys Gln Asp Lys

85 90 95

Arg Phe Ala Phe Ile Arg Ser Asp Ser Gly Pro Thr Thr Ser Phe Glu

100 105 110

Ser Ala Ala Cys Pro Gly Trp Phe Leu Cys Thr Ala Met Glu Ala Asp

115 120 125

Gln Pro Val Ser Leu Thr Asn Met Pro Asp Glu Gly Val Met Val Thr

130 135 140

Lys Phe Tyr Phe Gln Glu Asp Glu Gly Gly Gly Gly Ser Gly Gly Gly

145 150 155 160

Gly Ser Gly Gly Gly Gly Ser Leu Pro Ala Glu Val Ala Phe Thr Pro

165 170 175

Tyr Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp

180 185 190

Gln Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala

195 200 205

Lys Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu

210 215 220

Asp Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser

225 230 235 240

Cys Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr

245 250 255

Arg Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala

260 265 270

Leu Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys

275 280 285

Arg Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val

290 295 300

Val Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser

305 310 315 320

Thr Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro

325 330 335

Gly Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg

340 345 350

Ser Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg

355 360 365

Ser Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr

370 375 380

Ser Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr

385 390 395 400

Gly Asp

<210>4

<211>402

<212>PRT

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉p75-catenation sequence-IL1Ra fusion rotein

<400>4

Leu Pro Ala Glu Val Ala Phe Thr Pro Tyr Ala Pro Glu Pro Gly Ser

1 5 10 15

Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln Thr Ala Gln Met Cys Cys

20 25 30

Ser Lys Cys Ser Pro Gly Gln His Ala Lys Val Phe Cys Thr Lys Thr

35 40 45

Ser Asp Thr Val Cys Asp Ser Cys 6lu Asp Ser Thr Tyr Thr Gln Leu

50 55 60

Trp Asn Trp Val Pro Glu Cys Leu Ser Cys Gly Ser Arg Cys Ser Ser

65 70 75 80

Asp Gln Val Glu Thr Gln Ala Cys Thr Arg Glu Gln Asn Arg Ile Cys

85 90 95

Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu Ser Lys Gln Glu Gly Cys

100 105 110

Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg Pro Gly Phe Gly Val Ala

115 120 125

Arg Pro Gly Thr Glu Thr Ser Asp Val Val Cys Lys Pro Cys Ala Pro

130 135 140

Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr Asp Ile Cys Arg Pro His

145 150 155 160

Gln Ile Cys Asn Val Val Ala Ile Pro Gly Asn Ala Ser Met Asp Ala

165 170 175

Val Cys Thr Ser Thr Ser Pro Thr Arg Ser Met Ala Pro Gly Ala Val

180 185 190

His Leu Pro Gln Pro Val Ser Thr Arg Ser Gln His Thr Gln Pro Thr

195 200 205

Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser Phe Leu Leu Pro Met Gly

210 215 220

Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly Asp Gly Gly Gly Gly Ser

225 230 235 240

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Arg Pro Ser Gly Arg Lys

245 250 255

Ser Ser Lys Met Gln Ala Phe Arg Ile Trp Asp Val Asn Gln Lys Thr

260 265 270

Phe Tyr Leu Arg Asn Asn Gln Leu Val Ala Gly Tyr Leu Gln Gly Pro

275 280 285

Asn Val Asn Leu Glu Glu Lys Ile Asp Val Val Pro Ile Glu Pro His

290 295 300

Ala Leu Phe Leu Gly Ile His Gly Gly Lys Met Cys Leu Ser Cys Val

305 310 315 320

Lys Ser Gly Asp Glu Thr Arg Leu Gln Leu Glu Ala Val Asn Ile Thr

325 330 335

Asp Leu Ser Glu Asn Arg Lys Gln Asp Lys Arg Phe Ala Phe Ile Arg

340 345 350

Ser Asp Ser Gly Pro Thr Thr Ser Phe Glu Ser Ala Ala Cys Pro Gly

355 360 365

Trp Phe Leu Cys Thr Ala Met Glu Ala Asp Gln Pro Val Ser Leu Thr

370 375 380

Asn Met Pro Asp Glu Gly Val Met Val Thr Lys Phe Tyr Phe Gln Glu

385 390 395 400

Asp Glu

<210>5

<211>1857

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉encoding sequence of p75-Ig-IL1Ra fusion rotein

<400>5

ttgcccgccc aggtggcatt tacaccctac gccccggagc ccgggagcac atgccggctc 60

agagaatact atgaccagac agctcagatg tgctgcagca aatgctcgcc gggccaacat 120

gcaaaagtct tctgtaccaa gacctcggac accgtgtgtg actcctgtga ggacagcaca 180

tacacccagc tctggaactg ggttcccgag tgcttgagct gtggctcccg ctgtagctct 240

gaccaggtgg aaactcaagc ctgcactcgg gaacagaacc gcatctgcac ctgcaggccc 300

ggctggtact gcgcgctgag caagcaggag gggtgccggc tgtgcgcgcc gctgcgcaag 360

tgccgcccgg gcttcggcgt ggccagacca ggaactgaaa catcagacgt ggtgtgcaag 420

ccctgtgccc cggggacgtt ctccaacacg acttcatcca cggatatttg caggccccac 480

cagatctgta acgtggtggc catccctggg aatgcaagca tggatgcagt ctgcacgtcc 540

acgtccccca cccggagtat ggccccaggg gcagtacact taccccagcc agtgtccaca 600

cgatcccaac acacgcagcc aactccagaa cccagcactg ctccaagcac ctccttcctg 660

ctcccaatgg gccccagccc cccagctgaa gggagcactg gcgacgagcc caagtcctgc 720

gacaagaccc acacctgccc cccctgcccc gcccccgagc tgctgggcgg cccctccgtg 780

ttcctgttcc cccccaagcc caaggacacc ctgatgatct cccgcacccc cgaggtgacc 840

tgcgtggtgg tggacgtgtc ccacgaggac cccgaggtga agttcaactg gtacgtggac 900

ggcgtggagg tgcacaacgc caagaccaag ccccgcgagg agcagtacaa ctccacctac 960

cgcgtggtgt ccgtgctgac cgtgctgcac caggactggc tgaacggcaa ggactacaag 1020

tgcaaggtgt ccaacaaggc cctgcccgcc cccatgcaga agaccatctc caaggccaag 1080

ggccagcccc gcgagcccca ggtgtacacc ctgcccccct cccgcgacga gctgaccaag 1140

aaccaggtgt ccctgacctg cctggtgaag ggcttctacc cccgccacat cgccgtggag 1200

tgggagtcca acggccagcc cgagaacaac tacaagacca ccccccccgt gctggactcc 1260

gacggctcct tcttcctgta ctccaagctg accgtggaca agtcccgctg gcagcagggc 1320

aacgtgttct cctgctccgt gatgcacgag gccctgcaca accactacac ccagaagtcc 1380

ctgtccctgt cccccggcaa gcgaccctct gggagaaaat ccagcaagat gcaagccttc 1440

agaatctggg atgttaacca gaagaccttc tatctgagga acaaccaact agttgctgga 1500

tacttgcaag gaccaaatgt caatttagaa gaaaagatag atgtggtacc cattgagcct 1560

catgctctgt tcttgggaat ccatggaggg aagatgtgcc tgtcctgtgt caagtctggt 1620

gatgagacca gactccagct ggaggcagtt aacatcactg acctgagcga gaacagaaag 1680

caggacaagc gcttcgcctt catccgctca gacagtggcc ccaccaccag ttttgagtct 1740

gccgcctgcc ccggttggtt cctctgcaca gcgatggaag ctgaccagcc cgtcagcctc 1800

accaatatgc ctgacgaagg cgtcatggtc accaaattct acttccagga ggacgag 1857

<210>6

<211>1857

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉encoding sequence of IL1Ra-Ig-p75 fusion rotein

<400>6

cgaccctctg ggagaaaatc cagcaagatg caagccttca gaatctggga tgttaaccag 60

aagaccttct atctgaggaa caaccaacta gttgctggat acttgcaagg accaaatgtc 120

aatttagaag aaaagataga tgtggtaccc attgagcctc atgctctgtt cttgggaatc 180

catggaggga agatgtgcct gtcctgtgtc aagtctggtg atgagaccag actccagctg 240

gaggcagtta acatcactga cctgagcgag aacagaaagc aggacaagcg cttcgccttc 300

atccgctcag acagtggccc caccaccagt tttgagtctg ccgcctgccc cggttggttc 360

ctctgcacag cgatggaagc tgaccagccc gtcagcctca ccaatatgcc tgacgaaggc 420

gtcatggtca ccaaattcta cttccaggag gacgaggagc ccaagtcctg cgacaagacc 480

cacacctgcc ccccctgccc cgcccccgag ctgctgggcg gcccctccgt gttcctgttc 540

ccccccaagc ccaaggacac cctgatgatc tcccgcaccc ccgaggtgac ctgcgtggtg 600

gtggacgtgt cccacgagga ccccgaggtg aagttcaact ggtacgtgga cggcgtggag 660

gtgcacaacg ccaagaccaa gccccgcgag gagcagtaca actccaccta ccgcgtggtg 720

tccgtgctga ccgtgctgca ccaggactgg ctgaacggca aggactacaa gtgcaaggtg 780

tccaacaagg ccctgcccgc ccccatgcag aagaccatct ccaaggccaa gggccagccc 840

cgcgagcccc aggtgtacac cctgcccccc tcccgcgacg agctgaccaa gaaccaggtg 900

tccctgacct gcctggtgaa gggcttctac ccccgccaca tcgccgtgga gtgggagtcc 960

aacggccagc ccgagaacaa ctacaagacc accccccccg tgctggactc cgacggctcc 1020

ttcttcctgt actccaagct gaccgtggac aagtcccgct ggcagcaggg caacgtgttc 1080

tcctgctccg tgatgcacga ggccctgcac aaccactaca cccagaagtc cctgtccctg 1140

tcccccggca agttgcccgc ccaggtggca tttacaccct acgccccgga gcccgggagc 1200

acatgccggc tcagagaata ctatgaccag acagctcaga tgtgctgcag caaatgctcg 1260

ccgggccaac atgcaaaagt cttctgtacc aagacctcgg acaccgtgtg tgactcctgt 1320

gaggacagca catacaccca gctctggaac tgggttcccg agtgcttgag ctgtggctcc 1380

cgctgtagct ctgaccaggt ggaaactcaa gcctgcactc gggaacagaa ccgcatctgc 1440

acctgcaggc ccggctggta ctgcgcgctg agcaagcagg aggggtgccg gctgtgcgcg 1500

ccgctgcgca agtgccgccc gggcttcggc gtggccagac caggaactga aacatcagac 1560

gtggtgtgca agccctgtgc cccggggacg ttctccaaca cgacttcatc cacggatatt 1620

tgcaggcccc accagatctg taacgtggtg gccatccctg ggaatgcaag catggatgca 1680

gtctgcacgt ccacgtcccc cacccggagt atggccccag gggcagtaca cttaccccag 1740

ccagtgtcca cacgatccca acacacgcag ccaactccag aacccagcac tgctccaagc 1800

acctccttcc tgctcccaat gggccccagc cccccagctg aagggagcac tggcgac 1857

<210>7

<211>1206

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉encoding sequence of IL1Ra-catenation sequence-p75 fusion rotein

<400>7

cgaccctctg ggagaaaatc cagcaagatg caagccttca gaatctggga tgttaaccag 60

aagaccttct atctgaggaa caaccaacta gttgctggat acttgcaagg accaaatgtc 120

aatttagaag aaaagataga tgtggtaccc attgagcctc atgctctgtt cttgggaatc 180

catggaggga agatgtgcct gtcctgtgtc aagtctggtg atgagaccag actccagctg 240

gaggcagtta acatcactga cctgagcgag aacagaaagc aggacaagcg cttcgccttc 300

atccgctcag acagtggccc caccaccagt tttgagtctg ccgcctgccc cggttggttc 360

ctctgcacag cgatggaagc tgaccagccc gtcagcctca ccaatatgcc tgacgaaggc 420

gtcatggtca ccaaattcta cttccaggag gacgagggcg gcggcggctc cggcggcggc 480

ggctccggcg gcggcggctc cttgcccgcc caggtggcat ttacacccta cgccccggag 540

cccgggagca catgccggct cagagaatac tatgaccaga cagctcagat gtgctgcagc 600

aaatgctcgc cgggccaaca tgcaaaagtc ttctgtacca agacctcgga caccgtgtgt 660

gactcctgtg aggacagcac atacacccag ctctggaact gggttcccga gtgcttgagc 720

tgtggctccc gctgtagctc tgaccaggtg gaaactcaag cctgcactcg ggaacagaac 780

cgcatctgca cctgcaggcc cggctggtac tgcgcgctga gcaagcagga ggggtgccgg 840

ctgtgcgcgc cgctgcgcaa gtgccgcccg ggcttcggcg tggccagacc aggaactgaa 900

acatcagacg tggtgtgcaa gccctgtgcc ccggggacgt tctccaacac gacttcatcc 960

acggatattt gcaggcccca ccagatctgt aacgtggtgg ccatccctgg gaatgcaagc 1020

atggatgcag tctgcacgtc cacgtccccc acccggagta tggccccagg ggcagtacac 1080

ttaccccagc cagtgtccac acgatcccaa cacacgcagc caactccaga acccagcact 1140

gctccaagca cctccttcct gctcccaatg ggccccagcc ccccagctga agggagcact 1200

ggcgac 1206

<210>8

<211>1206

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉encoding sequence of p75-catenation sequence-IL1Ra fusion rotein

<400>8

ttgcccgccc aggtggcatt tacaccctac gccccggagc ccgggagcac atgccggctc 60

agagaatact atgaccagac agctcagatg tgctgcagca aatgctcgcc gggccaacat 120

gcaaaagtct tctgtaccaa gacctcggac accgtgtgtg actcctgtga ggacagcaca 180

tacacccagc tctggaactg ggttcccgag tgcttgagct gtggctcccg ctgtagctct 240

gaccaggtgg aaactcaagc ctgcactcgg gaacagaacc gcatctgcac ctgcaggccc 300

ggctggtact gcgcgctgag caagcaggag gggtgccggc tgtgcgcgcc gctgcgcaag 360

tgccgcccgg gcttcggcgt ggccagacca ggaactgaaa catcagacgt ggtgtgcaag 420

ccctgtgccc cggggacgtt ctccaacacg acttcatcca cggatatttg caggccccac 480

cagatctgta acgtggtggc catccctggg aatgcaagca tggatgcagt ctgcacgtcc 540

acgtccccca cccggagtat ggccccaggg gcagtacact taccccagcc agtgtccaca 600

cgatcccaac acacgcagcc aactccagaa cccagcactg ctccaagcac ctccttcctg 660

ctcccaatgg gccccagccc cccagctgaa gggagcactg gcgacggcgg cggcggctcc 720

ggcggcggcg gctccggcgg cggcggctcc cgaccctctg ggagaaaatc cagcaagatg 780

caagccttca gaatctggga tgttaaccag aagaccttct atctgaggaa caaccaacta 840

gttgctggat acttgcaagg accaaatgtc aatttagaag aaaagataga tgtggtaccc 900

attgagcctc atgctctgtt cttgggaatc catggaggga agatgtgcct gtcctgtgtc 960

aagtctggtg atgagaccag actccagctg gaggcagtta acatcactga cctgagcgag 1020

aacagaaagc aggacaagcg cttcgccttc atccgctcag acagtggccc caccaccagt 1080

tttgagtctg ccgcctgccc cggttggttc ctctgcacag cgatggaagc tgaccagccc 1140

gtcagcctca ccaatatgcc tgacgaaggc gtcatggtca ccaaattcta cttccaggag 1200

gacgag 1206

<210>9

<211>15

<212>PRT

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉catenation sequence

<400>9

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210>10

<211>45

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉encoding sequence of catenation sequence

<400>10

ggcggcggcg gctccggcgg cggcggctcc ggcggcggcg gctcc 45

<210>11

<211>42

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>11

cagaagctta tgttgcccgc ccaggtggca tttacaccct ac 42

<210>12

<211>36

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>12

gtcgcaggac ttgggctcgt cgccagtgct cccttc 36

<210>13

<211>19

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>13

cttgccgggg gacagggac 19

<210>14

<211>30

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>14

cagcgaccct ctgggagaaa atccagcaag 30

<210>15

<211>28

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>15

caggaattcc tcgtcctcct ggaagtag 28

<210>16

<211>39

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>16

gtccctgtcc cccggcaagc gaccctctgg gagaaaatc 39

<210>17

<211>84

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>17

aatgccacct gggcgggcaa ggagccgccg ccgccggagc cgccgccgcc ggagccgccg 60

ccgccctcgt cctcctggaa gtag 84

<210>18

<211>39

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>18

cagaagctta tgcgaccctc tgggagaaaa tccagcaag 39

<210>19

<211>30

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>19

caggaattcg tcgccagtgc tcccttcagc 30

Claims (8)

1. fusion rotein, by human soluble tumor necrosis factor II receptor, human normal immunoglobulin Fc fragment and interleukin I receptor antagonist IL1Ra constitute, and its aminoacid sequence is shown in SEQ ID NO:1 or SEQ IDNO:2.

2. fusion rotein, by human soluble tumor necrosis factor II receptor, catenation sequence and interleukin I receptor antagonist IL1Ra constitute, and its aminoacid sequence is shown in SEQ ID NO:3 or SEQ ID NO:4.

3. nucleic acid molecule, the described fusion rotein of coding claim 1, its sequence is shown in SEQ ID NO:5 or SEQ ID NO:6.

4. nucleic acid molecule, the described fusion rotein of coding claim 2, its sequence is shown in SEQ ID NO:7 or SEQ ID NO:8.

5. expression vector comprises and is selected from the expression regulation sequence that encoding sequence arbitrary among SEQ ID NO:5 to the SEQ ID NO:8 is connected with operability with it.

6. a host cell contains the described expression vector of claim 5.

7. host cell according to claim 6, it is CHO.

8. the preparation method of claim 1 or 2 described fusion roteins, its step comprises:

1) provide the nucleotide sequence of encoding fusion protein, described sequence is selected among SEQ ID NO:5 to the SEQ IDNO:8 arbitrary;

2) construction of expression vector;

3) this expression vector is imported host cell;

4) cultivate transformed host cell under conditions suitable for the expression;

5) collect supernatant liquor, and the purified fusion protein product.

Images