CN1304411C - Saltant dihydrofolic acid reductase gene and application in mammal cell gene expression thereof - Google Patents
Saltant dihydrofolic acid reductase gene and application in mammal cell gene expression thereof Download PDFInfo
- Publication number
- CN1304411C CN1304411C CNB021039461A CN02103946A CN1304411C CN 1304411 C CN1304411 C CN 1304411C CN B021039461 A CNB021039461 A CN B021039461A CN 02103946 A CN02103946 A CN 02103946A CN 1304411 C CN1304411 C CN 1304411C
- Authority
- CN
- China
- Prior art keywords
- gene
- expression
- cell
- tetrahydrofolate dehydrogenase
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Abstract
The present invention relates to a nucleotide sequence and an amino acid sequence of missense mutation dihydrofolate reductase, which can improve mammalian cell expression levels and a method for gene expression in mammalian cells by using the dihydrofolate reductase genes.
Description
Invention field
The invention belongs to biological technical field, describe a kind of sequence and the aminoacid sequence of polynucleotide sequence coding thus of dihydrofolate reductase gene of missense mutation, and utilized sweet acid sequence of this multinuclear and aminoacid sequence to carry out the method for mammalian cell expression.
Background technology
The expression vector of mammalian cell expression system generally all contains and can filter out the selective marker that foreign gene integrated or have the amplification system that selectivity increases copy number.Tetrahydrofolate dehydrogenase is present the most frequently used selective amplification system.Tetrahydrofolate dehydrogenase can generate tetrahydrofolic acid (THFA) with folic acid catalysis.And that tetrahydrofolic acid (THFA) is the biosynthesizing of purine, single thymine ribonucleoside phosphate and glycine is necessary.Methotrexate can combine with Tetrahydrofolate dehydrogenase and the activity that suppresses it causes the death of cell.When the cell that contains dihydrofolate reductase gene was grown in the substratum of the methotrexate concentration that progressively raises, the gene of Tetrahydrofolate dehydrogenase can obtain synchronous amplification.The gene copy number that part can be resisted the cell Tetrahydrofolate dehydrogenase of high strength ammonia methopterin can reach thousands of, and the expression amount of Tetrahydrofolate dehydrogenase can improve thousands of times.Therefore, select to make Tetrahydrofolate dehydrogenase and the goal gene that will express to increase jointly by the pressurization of methotrexate, thereby the expression level that improves goal gene is at present the most frequently used gene amplification method (.Mammalian cell biotechnologyin protein production.Berlin such as Hansj rg Hauser; New York:de Gruyter, 1997).
Because the Tetrahydrofolate dehydrogenase amplification system is by methotrexate the restraining effect of Tetrahydrofolate dehydrogenase to be come the goal gene that will express is selected and increased, thereby the activity of Tetrahydrofolate dehydrogenase and expression level have significant effects to the expression output of the engineering cell of screening.By the conserved sequence that uses weak promoter, has a mind to damage Kozak can improve mammalian expression system expression level (Li Yuyang. gene expression technique. Beijing: Science Press, 2001,139-158).Prompting helps to screen the high expressing cell strain that will express goal gene by the activity and the expression level of reduction Tetrahydrofolate dehydrogenase intentionally.
Detailed Description Of The Invention
The invention discloses a kind of polynucleotide sequence and amino acid sequence corresponding of missense mutation dihydrofolate reductase gene.
The dihydrofolate reductase gene of this missense mutation is that the method by the PCR random mutation obtains, and its encoded protein matter is converted to Threonine in the 77th amino acids by Serine, and its complete sequence is seen SEQ ID NO2.
Because the change of aminoacid sequence may cause the change of dihydrofolate reductase protein structure.Utilize interleukin-11 0 expression vector of the dihydrofolate reductase gene structure of this sudden change, after transfection CHO DHFR-cell was removed its dependence condition HT (xanthoglobulin and Thymine deoxyriboside mixed solution), the expression output of its interleukin-11 0 of the cell mixing of screening and monoclonal cell all improved about 3 times than the Tetrahydrofolate dehydrogenase of wild-type.Prompting Tetrahydrofolate dehydrogenase the 77th amino acids is converted to the activity that Threonine may reduce Tetrahydrofolate dehydrogenase by Serine.
The invention discloses the method for carrying out mammalian cell expression by the amino acid whose gene of this missense mutation of coding.The method of carrying out mammalian cell expression by coding this missense mutation amino acid whose gene of using that provides among the present invention is meant that utilization selects mammalian cells transfected by the amino acid whose gene of this missense mutation of coding as selective marker and amplification system and improve the method for cellular expression levels by methotrexate.The goal gene that the expression vector that utilizes the dihydrofolate reductase gene of this sudden change to make up can be expressed and this mutator gene are building up to jointly that pair cell carries out transfection on the carrier, also can be they to be building up to respectively pair cell carries out cotransfection on the different carriers.
Description of drawings
Following accompanying drawing is used to illustrate the specific embodiments of invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is the mutator gene screening expression plasmid collection of illustrative plates that utilizes the directed method that connects of three fragments to make up, and EF1 α/HTLV is a promotor, and hIL10 is an interleukin-11 0, and IRES is an internal ribosome entry site, and PCR refers to utilize Diversify
TMPCR Random Mutagenesis Kit carries out the dna fragmentation of pcr amplification with primer 1 and primer 2.
Fig. 2, Fig. 3 be respectively for utilize primer 1 and primer 2 increase respectively wild-type dihydrofolate reductase gene and screen the dihydrofolate reductase gene of sudden change, the plasmid map of construction expression plasmid A and expression plasmid B respectively.
Below in conjunction with specific embodiment, further illustrate the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, all according to normal condition as Sambrook etc., molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: the structure of Tetrahydrofolate dehydrogenase mutator gene and screening
Utilize Diversify
TMPCR Random Mutagenesis Kit (Clonteeh company) makes up the Tetrahydrofolate dehydrogenase mutator gene.The PCR condition is as follows: reaction volume, 50 μ l; Deionized water 31 μ l, 10 * TITANIUM Taq Buffer, 5 μ l, MnSO
44 μ l, dGTP (2mM) 5 μ l, 50 * DiversifydNTP Mix, 1 μ l, primer 1 (10 μ M, sequence is seen SEQ ID NO3) 1 μ l, primer 2 (10 μ M, sequence is seen SEQ ID NO4) 1 μ l, dihydrofolate reductase gene template (1ng/ μ l), TITANIUMTaq enzyme 1 μ l; Thermal cycling: 94 ℃, 30 seconds; 94 ℃ 30 seconds, 56 ℃ 30 seconds, 68 ℃ 1 minute, 30 the circulation; 68 ℃, 1 minute.
The rubber tapping purifying reclaims the amplified production of 610bp behind the pcr amplification, cuts with BamHI and EcoRI enzyme, utilizes the directed method that connects of three fragments to make up mutator gene screening expression plasmid.The promotor of this screening expression plasmid is EF-1 α/eIF4g hybrid promoter, contains white medium 10 genes on the expression plasmid, and white medium 10 genes link together with dihydrofolate reductase gene fragment to be screened by IRES.Above ligation liquid is transformed DH5 α cell, and directly transformed bacteria liquid is shaken bacterium, extract plasmid.
The plasmid of above extraction is utilized Lipofectamine (GIBCO company) transfection CHO DHFR-cell, and transfection was gone down to posterity in six orifice plates by 1/4,1/8 and 1/12 after treating that cell converged in 48 hours, and removed the HT mixed solution.Substratum is α-MEM, in add 10% the dialysis serum (Hyclone company).
Keep cultivate two week the back utilize method picking monoclonal cell to 96 orifice plate of shop agarose, treat cell in 96 orifice plates, grow converge to 80～100% after, get the expression concentration of nutrient solution with the method survey interleukin-11 0 of ELISA.Select 156 of monoclonal cells altogether, the cell strain expression amount that expression level is the highest is 300ng/10
6Individual cell 24 hours.
Extract the chromosomal DNA of high cell strain of expression level with the method for phenol-chloroform, and carry out conventional pcr amplification with primer 1 (sequence is seen SEQ ID NO3) and primer 2 (sequence is seen SEQ ID NO4), amplified production tapped rubber check order behind the purifying, order-checking discovery dihydrofolate reductase gene is converted to C+230 base by G, and nucleotide sequence the results are shown in SEQ ID NO1.
Embodiment 2:CHO cell expressing interleukin-11 0
Utilize primer 1 and primer 2 increase respectively wild-type dihydrofolate reductase gene and screen the dihydrofolate reductase gene of sudden change, construction expression plasmid A and B (construction process and plasmid map reference example 1) respectively.By the difference of the method in the embodiment 1 transfection CHO DHFR
-, remove the expression level of the interleukin-11 0 of the monoclonal cell that detects cell mixing and picking behind the HT respectively.Expression plasmid A removes behind the HT cell mixing, and to express interleukin-11 0 expression amount be 36ng/10
624 hours, expression plasmid B removes behind the HT cell mixing, and to express interleukin-11 0 expression amount be 124ng/10
624 hours.60 monoclonal cells of each picking of expression plasmid A and B, the high expression level amount of the monoclonal cell strain of expression plasmid A is 108ng/10
624 hours, the high expression level amount of the monoclonal cell strain of expression plasmid B was 380ng/10
624 hours.The cell expressing output that prompting utilizes the missense mutation dihydrofolate reductase gene that obtains among the present invention to filter out is higher than the dihydrofolate reductase gene of wild-type, and the expression output of goal gene approximately improves 3 times.
Sequence table
(1) general information:
Denomination of invention: a kind of Tetrahydrofolate dehydrogenase of missense mutation and encoding sequence thereof
Sequence number: 4
(2) information of SEQ ID NO1:
(I) sequence signature:
(A) type: nucleic acid
(B) length: 564 bases
(C) chain: two strands
(D) topological framework; Linear
(II) molecule type: cDNA
(III) sequence description:
atggttcgaccattgaactgcatcgtcgccgtgtcccaagatatggggattggcaagaacggagacctacc
ctggcctccgctcaggaacgagttcaagtacttccaaagaatgaccacaacctcttcagtggaaggtaaac
agaatctggtgattatgggtaggaaaacctggttctccattcctgagaagaatcgacctttaaaggacagaat
taatatagttctcactagagaactcaaagaaccaccacgaggagctcattttcttgccaaaagtttggatgat
gccttaagacttattgaacaaccggarttggcaagtaaagtagacatggtttggatagtcggaggcagttct
gtttaccaggaagccatgaatcaaccaggccacctcagactctttgtgacaaggatcatgcaggaatttgaa
agtgacacgtttttcccagaaattgatttggggaaatataaacttctcccagaatacccaggcgtcctctctga
ggtccaggaggaaaaaggcatcaagtataagtttgaagtctacgagaagaaagactaa
(3) information of SEQ ID NO2:
(I) sequence signature:
(A) type: amino acid
(B) length: 187 amino acid
(D) topological framework; Linear
(II) molecule type: protein
(III) sequence description:
M?V?R?P?L?N?C?I?V?A?V?S?Q?D?M?G?I?G?K?N?G?D?L?P?W?P?P?L?R?N?E?F?K?Y?F?Q?R?MT?T?T?S?S?V?E?G?K?Q?N?L?V?I?M?G?R?K?T?W?F?S?I?P?E?K?N?R?P?L?K?D?R?I?N?I?V?L?T?R?E?LK?E?P?P?R?G?A?H?F?L?A?K?S?L?D?D?A?L?R?L?I?E?Q?P?E?L?A?S?K?V?D?M?V?W?I?V?G?G?S?S?VY?Q?E?A?M?N?Q?P?G?H?L?R?L?F?V?T?R?I?M?Q?E?F?E?S?D?T?F?F?P?E?I?D?L?G?K?Y?K?L?L?P?EY?P?G?V?L?S?E?V?Q?E?E?K?G?I?K?Y?K?F?E?V?Y?E?K?K?D
(4) information of SEQ ID NO3
(I) sequence signature:
(A) type: nucleic acid
(B) length: 27 bases
(C) chain: strand
(D) topological framework; Linear
(II) molecule type: oligonucleotide
(III) sequence description:
ATTGGATCCATGGTTCGACCATTGAACT
(4) information of SEQ ID NO4
(I) sequence signature:
(A) type: nucleic acid
(B) length: 29 bases
(C) chain: strand
(D) topological framework; Linear
(II) molecule type: oligonucleotide
(III) sequence description:
TCAGAATTCTGCATAGCTTTAGGAGGGGA
Claims (6)
1, a kind of dihydrofolate reductase gene of missense mutation is characterized in that it has the nucleotide sequence shown in the SEQ ID NO1.
2, a kind of Tetrahydrofolate dehydrogenase DHFR-S77T of missense mutation is characterized in that the 77th amino acids of Tetrahydrofolate dehydrogenase is converted to Threonine by Serine, and its amino acid complete sequence is seen SEQ ID NO2.
3, utilize the gene of aminoacid sequence in the coding claim 2 in host cell, to carry out the method for destination gene expression as selective marker and amplification system.
4, the method described in the claim 3, wherein said host cell are Chinese hamster ovary cell.
5, the encoding gene of the Tetrahydrofolate dehydrogenase DHFR-S77T of the missense mutation described in the claim 2 application in polypeptide and protein production as selective marker and amplification system.
6, the described application of claim 5, amplification system wherein are meant the raising that utilizes methotrexate concentration and the goal gene copy number are increased.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB021039461A CN1304411C (en) | 2002-02-21 | 2002-02-21 | Saltant dihydrofolic acid reductase gene and application in mammal cell gene expression thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB021039461A CN1304411C (en) | 2002-02-21 | 2002-02-21 | Saltant dihydrofolic acid reductase gene and application in mammal cell gene expression thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1439647A CN1439647A (en) | 2003-09-03 |
| CN1304411C true CN1304411C (en) | 2007-03-14 |
Family
ID=27793005
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB021039461A Expired - Fee Related CN1304411C (en) | 2002-02-21 | 2002-02-21 | Saltant dihydrofolic acid reductase gene and application in mammal cell gene expression thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1304411C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117305261B (en) * | 2023-11-30 | 2024-02-23 | 北京智源人工智能研究院 | Dihydrofolate reductase kink and mutant thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4585739A (en) * | 1983-03-07 | 1986-04-29 | E. I. Du Pont De Nemours And Company | Plasmid for foreign gene expression in B. subtilis |
| WO1990006363A1 (en) * | 1988-12-08 | 1990-06-14 | Damon Biotech, Inc. | Expression induction method employing mutant dhfr gene |
| WO1997033988A1 (en) * | 1996-03-12 | 1997-09-18 | Sloan-Kettering Institute For Cancer Research | Double mutants of dihydrofolate reductase and methods of using same |
| US5776724A (en) * | 1988-10-24 | 1998-07-07 | Yale University | Chaperonin-mediated protein folding |
| CN1301857A (en) * | 1999-12-29 | 2001-07-04 | 复旦大学 | New polypeptide-dihydroflate reductase 10 and polynucleotide coding such polypeptide |
| CN1325971A (en) * | 2000-05-31 | 2001-12-12 | 上海博德基因开发有限公司 | Polypeptide-dihydrofolate reductase 14 and polynucleotide for coding it |
| CN1325977A (en) * | 2000-05-31 | 2001-12-12 | 上海博德基因开发有限公司 | Polypeptide-dihydrofolate reductase 22 and polynucleotide for coding it |
-
2002
- 2002-02-21 CN CNB021039461A patent/CN1304411C/en not_active Expired - Fee Related
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4585739A (en) * | 1983-03-07 | 1986-04-29 | E. I. Du Pont De Nemours And Company | Plasmid for foreign gene expression in B. subtilis |
| US5776724A (en) * | 1988-10-24 | 1998-07-07 | Yale University | Chaperonin-mediated protein folding |
| WO1990006363A1 (en) * | 1988-12-08 | 1990-06-14 | Damon Biotech, Inc. | Expression induction method employing mutant dhfr gene |
| WO1997033988A1 (en) * | 1996-03-12 | 1997-09-18 | Sloan-Kettering Institute For Cancer Research | Double mutants of dihydrofolate reductase and methods of using same |
| CN1301857A (en) * | 1999-12-29 | 2001-07-04 | 复旦大学 | New polypeptide-dihydroflate reductase 10 and polynucleotide coding such polypeptide |
| CN1325971A (en) * | 2000-05-31 | 2001-12-12 | 上海博德基因开发有限公司 | Polypeptide-dihydrofolate reductase 14 and polynucleotide for coding it |
| CN1325977A (en) * | 2000-05-31 | 2001-12-12 | 上海博德基因开发有限公司 | Polypeptide-dihydrofolate reductase 22 and polynucleotide for coding it |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1439647A (en) | 2003-09-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Moriyama et al. | Genome size and intron size in Drosophila. | |
| Yu et al. | Pseudouridines in spliceosomal snRNAs | |
| CN1308683A (en) | Methods for generating highly diverse libraries | |
| Jurka et al. | Integration of retroposable elements in mammals: selection of target sites | |
| CN102124106A (en) | Method for production of cDNA library having reduced content of cDNA clone derived from highly expressed gene | |
| CN107012130A (en) | A kind of glucose oxidase mutant and its encoding gene and application | |
| CN102181527B (en) | Construction method of terminal gene library of full genome mRNA3' | |
| CN110643606B (en) | Class II deoxyribozyme mutant capable of rapidly hydrolyzing DNA | |
| CN102140450A (en) | Method for separating long terminal repeats of retrotransposons | |
| CN1304411C (en) | Saltant dihydrofolic acid reductase gene and application in mammal cell gene expression thereof | |
| CN1134538C (en) | Fy7 polymerase | |
| CN112301020B (en) | III type deoxyribozyme mutant and preparation method and application thereof | |
| CN101381724A (en) | Method for separating short interspersed repeated segments based on magnetic bead probe complexes | |
| US9834762B2 (en) | Modified polymerases for replication of threose nucleic acids | |
| CN112175954A (en) | IV-type deoxyribozyme mutant and preparation method and application thereof | |
| Schlüter et al. | The rat Prm3 gene is an intronless member of the protamine gene cluster and is expressed in haploid male germ cells | |
| WO2003089617A3 (en) | Methods for increasing homologous recombination of a nucleic acid sequence | |
| EP2261332A2 (en) | Libraries of recombinant chimeric proteins | |
| Bresler et al. | The mechanism of messenger-RNA replication in bacteria | |
| CN109983136B (en) | Method for purifying reversible blocking deoxyribonucleoside triphosphate and sequencing method | |
| CN1258745A (en) | New-type subtilisin and its preparation and application | |
| CN110982834A (en) | Plasmid construction kit, plasmid construction method and application thereof | |
| Ikehara et al. | Origin and evolutionary process of the genetic code | |
| CN117568348A (en) | Gene for maintaining monomer supercoiled poly-A plasmid and application thereof | |
| CN116751763B (en) | Cpf1 protein, V-type gene editing system and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070314 Termination date: 20130221 |