CN1298884A - Human cyclic adenylicacid dependent protein kinase inhibitor-9 and polynucleotide for coding said polypeptide - Google Patents

Abstract

The present invention discloses a new polypeptide-human CAMP dependent protein kinase inhibitor-9, polynucleotide for encoding said polypeptide, and its emthod of producing the said polypeptide using DNA recombination technology. The present invention also discloses a method of treating various diseases by using the said polypeptide, such as cancer, memory disorder, automatic immune disease, asthma, etc.. The present invention also discloses an antagonistic for resisting the said polypeptide and its therapeutic effect.

Description

The polynucleotide of human cyclic adenylicacid dependent protein kinase inhibitor-9-9 and this polypeptide of coding

The invention belongs to biological technical field, specifically, the invention describes a kind of new polypeptide-human cAMP dependent kinases-9, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.

CAMP dependent kinases (PKA) is the target material of second messenger cAMP in the mammalian cell, and it plays an important role in many signal transduction process such as hormone, the neurotransmission factor in vivo.The PKA holoenzyme of non-activity is a tetramer, is combined into mixture by two regulation and control subunits (R) and two catalytic subunits (C).When the hormone in vivo level rises or under some other signal transmission factor effect, adenylate cyclase is activated by coupling special acceptor thereon, thereby caused intracellular cAMP concentration to rise.This moment, two cAMP molecules were attached to respectively on the R subunit of PKA, and the holoenzyme decomposition discharges two and has the active C subunit of phosphorylating kinase.Have some proteic phosphorylations of consistent order-Arg-Arg-X-Ser (Thr)-Y-(wherein Y is a hydrophobic amino acid) in C subunit that discharges and then the catalysis cell, produce the physiological effect that causes behind a series of signal transmittance process by the activity of regulating these target proteins.Produce effect aspect the activity of the phosphorylation of PKA by catalysis target protein enzyme in the speed of cytodifferentiation, cellular form, metabolic process etc. are many.In organism especially mammalian cell, the signal transfer function of nearly all cAMP mediation all relies on PKA to realize.

People cAMP dependent kinases (PKI) to free C subunit phosphorylating kinase active inhibition be in the cell except that the R subunit to the regulation and control on active another level of PKA, it is that a class is heat-resisting, the small molecular weight protein of the about 80kDa of acid proof.As a class competitive inhibitor of C subunit, it has very strong affinity and retarding effect.PKI in as the PKA inhibitor, mediate the tool catalytic activity the C subunit go out nuclear activity, this characteristic shows for the regulation and control of PKI gene expression dose can regulate in the nuclear in the active and then influence nuclear of C subunit some by the transcript and expression of regulatory gene.The cell cycle carry out in the process with regard to the expression of finding PKI and in intracellular distribution along with the different steps of cell cycle is different and be periodical change to the requirement of the phosphorylation degree of the transcriptional level of genes involved and associated protein.

PKI family mainly comprises three types isomer: PKI _α, PKI _βAnd PKI _χComprise two conservative aminoacid sequences in all PKI albumen: one is to suppress active relevant substrate analogue site with affinity, and its aminoacid sequence is-Arg-Thr-Gly-Arg-Arg-Asn-Ala-Ile-; Another be rich in leucine and hydrophobic amino acid go out born of the same parents' signal NES.The C subunit of the PKA of PKI and its regulation and control is the same with the R subunit, has multi-form isomer, and the expression level in different tissues also there are differences.The various multi-form isomer of three are combined into a meticulous regulator control system thus, have guaranteed in the privileged site of particular organization, cell, keep specific PKA activity level, to produce the specific effect that signal that cAMP is transmitted causes.

As the result of amino acid sequence homology, polypeptide of the present invention is differentiated by inferential ground and is a kind of new human protein kinase enzyme inhibitors.

Because people cAMP dependent kinases-9 albumen plays an important role in regulating body critical functions such as cell fission and fetal development as mentioned above, and believe and relate to a large amount of albumen in these regulate processes, thereby need to identify people cAMP dependent kinases-9 albumen of more these processes of participation in this area always, particularly identify this proteic aminoacid sequence.The separation of new person cAMP dependent kinases-9 protein coding gene also provides the foundation for determining the effect of this albumen under healthy and morbid state.This albumen may constitute the basis of exploitation medical diagnosis on disease and/or curative, and it is very important therefore separating its coding DNA.

An object of the present invention is to provide isolating new polypeptide-human cAMP dependent kinases-9 with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of this polypeptide of coding.

Another object of the present invention provides the recombinant vectors of the polynucleotide that contain coding people cAMP dependent kinases-9.

Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain coding people cAMP dependent kinases-9.

Another object of the present invention provides the method for producing people cAMP dependent kinases-9.

Another object of the present invention provides the antibody at polypeptide-human cAMP dependent kinases-9 of the present invention.

Another object of the present invention provides simulated compound, antagonist, agonist, the inhibitor at polypeptide-human cAMP dependent kinases-9 of the present invention.

Another object of the present invention provides the method for the diagnoses and treatment disease relevant unusually with people cAMP dependent kinases-9.

In a first aspect of the present invention, novel isolated people cAMP dependent kinases-9 is provided, this polypeptide is the people source, and it comprises: have the polypeptide of SEQ ID NO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is the polypeptide with SEQ IDNO:2 aminoacid sequence.

In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 75% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned people cAMP dependent kinases-9 of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 112-348 position among the SEQ ID NO:1; (b) has the sequence of 1-1040 position among the SEQ ID NO:1.

In a third aspect of the present invention, the recombinant vectors that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this recombinant vectors.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

The following term of using in this specification sheets and claims has following implication unless stated otherwise:

" nucleotide sequence " is meant oligonucleotide, Nucleotide or polynucleotide and fragment or part, also can refer to genome or synthetic DNA or RNA, and they can be strand or two strands, represent sense strand or antisense strand.Similarly, term " aminoacid sequence " is meant oligopeptides, peptide, polypeptide or protein sequence and fragment or part.When " aminoacid sequence " among the present invention related to a kind of aminoacid sequence of naturally occurring protein molecule, this " polypeptide " or " protein " did not mean that aminoacid sequence are restricted to the complete natural amino acid relevant with described protein molecule.

Protein or polynucleotide " variant " are meant a kind of polynucleotide sequence that has the aminoacid sequence of one or more amino acid or Nucleotide change or encode it.Described change can comprise disappearance, insertion or the replacement of amino acid in aminoacid sequence or the nucleotide sequence or Nucleotide.Variant can have " conservative property " and change, and wherein the amino acid of Ti Huaning has structure or the chemical property similar with original acid, as replacing Isoleucine with leucine.Variant also can have non-conservation and change, as replacing glycine with tryptophane.

" disappearance " is meant the disappearance of in aminoacid sequence or nucleotide sequence one or more amino acid or Nucleotide.

" insertion " or " interpolation " is meant that the change in aminoacid sequence or nucleotide sequence causes comparing the increase of one or more amino acid or Nucleotide with naturally occurring molecule." replacement " is meant by different amino acid or Nucleotide and replaces one or more amino acid or Nucleotide.

" biological activity " is meant the protein of structure, regulation and control or biochemical function with natural molecule.Similarly, term " immunologic competence " be meant natural, reorganization or synthetic protein and fragment thereof in suitable animal or cell, induce specific immune response and with specific antibody bonded ability.

" agonist " is meant when combining with people cAMP dependent kinases-9, thereby a kind of this protein that causes changes the molecule of regulating this protein active.Agonist can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of people cAMP dependent kinases-9.

" antagonist " or " inhibition " be meant when combining with people cAMP dependent kinases-9, a kind ofly seals or regulate into the biologic activity of cAMP dependent kinases-9 or the molecule of immunologic competence.Antagonist and inhibition can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of people cAMP dependent kinases-9.

" adjusting " is meant that the function of people cAMP dependent kinases-9 changes, and comprises the change of any other biological property, function or the immune property of the change of the rising of protein active or reduction, binding characteristic and people cAMP dependent kinases-9.

The pure basically ＂ of ＂ is meant and is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying people cAMP dependent kinases-9 of standard.Basically pure people cAMP dependent kinases-9 can produce single master tape on the irreducibility polyacrylamide gel.The purity available amino end acid sequence of people cAMP dependent kinases-9 polypeptide is analyzed.

" complementary " or " complementation " is meant under salt concn that allows and temperature condition by the natural combination of the polynucleotide of base pairing.For example, sequence " C-T-G-A " can combine with complementary sequence " G-A-C-T ".Complementation between two single chain molecules can be part or whole.Complementary degree between the nucleic acid chains has a significant effect for efficient of hybridizing between the nucleic acid chains and intensity.

" homology " is meant the complementary degree, can be portion homologous or complete homology." portion homologous " is meant a kind of part complementary sequence, and it can partly suppress the hybridization of complete complementary sequence and target nucleic acid at least.The inhibition of this hybridization can detect by hybridizing (Southern trace or Northern trace etc.) under the condition that reduces in the severity degree.Basically homologous sequence or hybridization probe can compete and suppress complete homologous sequence and target sequence the condition that reduces of severity degree under combine.This does not mean the conditions permit non-specific binding that the severity degree reduces because the conditional request two sequences that the severity degree reduces mutual be combined into specificity or selectivity interacts.

" homogeny percentage " be meant two or more amino acid or nucleotide sequence relatively in the same or analogous percentage of sequence.The available electron method is measured the homogeny percentage, as passing through MEGALIGN program (Lasergenesoftware package, DNASTAR, Inc., Madison Wis.).The MEGALIGN program can compare two or more sequences (Higgins, D.G. and P.M.Sharp (1988) Gene73:237-244) according to diverse ways such as Cluster method.The Cluster method is organized the series arrangement cluster by checking the distance between all pairings with each.Then with each bunch with in pairs or become set of dispense.Homogeny percentage between two aminoacid sequences such as sequence A and the sequence B calculates by following formula:

Also can be by the Cluster method or with the homogeny percentage (Hein J., (1990) Methods in emzumology 183:625-645) between known method in this area such as the Jotun Hein mensuration nucleotide sequence.

" similarity " is meant the degree that the identical or conservative property of corresponding position amino-acid residue when arranging contrast between the aminoacid sequence replaces.For example be used for amino acid that conservative property replaces, electronegative amino acid can comprise aspartic acid and L-glutamic acid; Positively charged amino acid can comprise Methionin and arginine; Having uncharged head group has similar hydrophilic amino acid can comprise leucine, Isoleucine and Xie Ansuan; Glycine and L-Ala; L-asparagine and glutamine; Serine and Threonine; Phenylalanine and tyrosine.

" antisense " is meant and specific DNA or RNA sequence complementary nucleotide sequence." antisense strand " is meant and " sense strand " complementary nucleic acid chains.

" derivative " is meant HFP or encodes its chemical modification object of nucleic acid.This chemical modification object can be with alkyl, acyl group or the amino hydrogen atom of replacing.The nucleic acid derivative codified keeps the polypeptide of the main biological characteristics of natural molecule.

" antibody " is meant complete antibody molecule and fragment thereof, as Fa, F (ab ') ₂And Fv, its energy specificity is in conjunction with the antigenic determinant of people cAMP dependent kinases-9.

" humanized antibody " is meant that the aminoacid sequence in non-antigen binding domain territory is replaced and becomes more similar to people's antibody, but still keep original in active antibody.

" isolating " speech refers to material is shifted out among its original environment (for example, if spontaneous its natural surroundings that just refers to).Such as it is exactly not to be separated that spontaneous polynucleotide or polypeptide are present in the Live Animals, but same polynucleotide or polypeptide with some or all in natural system with it the material of coexistence separately be exactly isolating.Such polynucleotide may be the parts of a certain carrier, the part that also possible such polynucleotide or polypeptide are a certain composition.Since carrier or composition are not the compositions of its natural surroundings, they remain isolating.

As used herein, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

As used herein, " isolating people cAMP dependent kinases-9 " is meant that people cAMP dependent kinases-9 is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying people cAMP dependent kinases-9 of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of people cAMP dependent kinases-9 polypeptide can be used amino acid sequence analysis.

The invention provides a kind of new polypeptide-human cAMP dependent kinases-9, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analogue of people cAMP dependent kinases-9.As used herein, term " fragment ", " derivative " are meant biological function or the active polypeptide that keeps people cAMP dependent kinases-9 of the present invention identical basically with " analogue ".The fragment of polypeptide of the present invention, derivative or analogue can be: (I) a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.

The invention provides isolating nucleic acid (polynucleotide), substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 1040 bases, and its open reading frame (112---348) 78 amino acid of having encoded.Relatively find according to amino acid sequence homologous, PKI albumen in this polypeptide and the rat testis has 74% homology (see figure 1), and deducibility goes out the 26S Proteasome Structure and Function that this people cAMP dependent kinases-9 has the PKI protein similar in the rat testis.

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.

The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 9 5%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.

The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, " nucleic acid fragment " length contain 10 Nucleotide at least, better be 20-30 Nucleotide at least, be more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding people cAMP dependent kinases-9.

Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.

The special polynucleotide sequence of coding people cAMP dependent kinases-9 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.

Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.

In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration people cAMP dependent kinases-9; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.

In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect the protein product of people cAMP dependent kinases-9 genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the recombinant vectors of polynucleotide of the present invention, and the genetically engineered host cell that produces through genetically engineered with the recombinant vectors of the present invention or cAMP dependent kinases-9 encoding sequence of directly choosing, and the method that produces polypeptide of the present invention through recombinant technology.

Among the present invention, the polynucleotide sequence of coding people cAMP dependent kinases-9 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.

Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains coding people cAMP dependent kinases-9 and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.MolecularCloning, a Laboratory Manual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The P of lambda particles phage _LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, the polynucleotide of coding people cAMP dependent kinases-9 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Alternative is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce people cAMP dependent kinases-9 (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:

(1). with the polynucleotide (or varient) of coding of the present invention people cAMP dependent kinases-9, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;

(2). in suitable medium, cultivate host cell;

(3). separation, protein purification from substratum or cell.

In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat cancer, disturbance of memory, autoimmune disease, asthma etc.

The activity of PKA is worked in many important biomolecules system.PKA is carried out selectivity suppress to find to induce diseases related, as the methods of treatment of cancer, disturbance of memory and autoimmune disease with PKA.

People's tracheae unstriated muscle (ASM) comprises β-2-suprarenin functional receptor.This acceptor the be upset increase that can cause cAMP in the cell and the activation of PKA, thus make several cell protein phosphorylations and relax.Activatory PKA also works in ASM cell proliferation.By PKA mediation mechanism, vasoactive intestinal peptide (VIP) optionally suppresses the growth and the amplification of people's tracheae smooth muscle cell effectively, and has suppressed the mitotic division effect of histamine.The deficiency of VIP may cause the ASM hyperplasia that causes owing to the unopposed sexual stimulus of endogenous cytokinin.The selective depressant of a PKA has been eliminated the inhibition effect of VIP.

A major cause of the chemotherapy failure of cancer is a so-called multiple drug resistance (MDR), the development of promptly many chemotherapeutic agent crossed resistances.MDR is usually with the MDR1 gene product---the overexpression of a multi-functional drug transport medium P glycoprotein is relevant.The expression of MDR1 can be regulated by PKA.MDR regulates its expression by regulation and control under the selectivity of the transcription factor of dependence PKA.PKA I type high expression level in mastocarcinoma demonstrates this phenotypic patient and survives and wish to reduce.Optionally PKA inhibitor: 8-CI-cAMP and Rp8-CI-cAMP are effective especially to the following adjusting of the MDR associated transcription factor of dependence PKA.These compounds are regulated a transient expression that is subjected to the reporter gene of several MDR1 promoter element controls down.

Selectivity PKA inhibitor 8-CI-cAMP etc. can reduce the expression of MDR1 in anti-multiple drug human breast cancer cell.PKI is to PKA also restraining effect selectively, thereby improves chemotherapeutical validity.And, may be able to find the method for the treatment of mammary cancer thus.

In colon cancer cell, gastrin and 8-Br-cAMP suppress the C subunit of PKA, and the C subunit plays an important role in the cell cycle process, so they have suppressed the growth of HCT116.Thereby PKI also can get involved the growth of cell cycle anticancer equally.

Systemic lupus erythematous (SLE) be a kind of be the unclear active immunity disorder of the cause of disease of feature with the cell immune response dysfunction.Serious SLE patient's complete T lymphocyte weakens in the catalytic protein phosphorylation of PKA.The important element that is not both adjusting T cell proliferative response of PKA concentration.Active the inducing of PKA suppressed CD 3-resisting monoclonal antibody in the T cell, the propagation of this antibody induction T cell.

PKA participates in the molecular events about learning and memory.When the peptide inhibition of PKA is expressed, interrupt relevant learning functionality in transgenic fly.In mammlian system, it is efficient for a long time that the inhibition of PKA has been blocked hippocampal, and this is considered to set up clearly a kind of mechanism of memory.The loss of memory of senile dementia is its old and feeble feature the earliest, and Tau albumen is by the PKA phosphorylation.The degraded of Tau relates to pathogenic senile dementia.The phosphorylation of PKA influences the speed of proteasome degradation.

In the active loss conditions of aforesaid some PKA, cell can with the antisense sequences transfection of PKI or with the inhibitor effect of PKI.Such disease comprises asthma, vesical fibrosis, and the disease of systemic red yabbi storehouse and some influence memories and study is as senile dementia.

The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) people cAMP dependent kinases-9.Agonist improves people cAMP dependent kinases-9 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can in the presence of medicine, the film preparation of mammalian cell or expressing human cAMP dependent kinases-9 be cultivated with the people cAMP dependent kinases-9 of mark.Measure the medicine raising then or check this interactional ability.

The antagonist of people cAMP dependent kinases-9 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of people cAMP dependent kinases-9 can combine and eliminate its function with people cAMP dependent kinases-9, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.

In screening during as the compound of antagonist, people cAMP dependent kinases-9 can be added in the bioanalysis mensuration, interactional influence between people cAMP dependent kinases-9 and its acceptor be determined whether compound is antagonist by measuring compound.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with people cAMP dependent kinases-9 bonded peptide molecule obtains.During screening, generally tackle people cAMP dependent kinases-9 molecule and carry out mark.

The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at people cAMP dependent kinases-9 antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

Can the choose method of cAMP dependent kinases-9 direct injection immune animal (as rabbit, mouse, rat etc.) of the production of polyclonal antibody obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of the monoclonal antibody of preparation people cAMP dependent kinases-9 includes but not limited to hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.4946778) also can be used for producing the single-chain antibody of anti-people cAMP dependent kinases-9.

The antibody of anti-people cAMP dependent kinases-9 can be used in the immunohistochemistry technology, detects the people cAMP dependent kinases-9 in the biopsy specimen.

With the also available labelled with radioisotope of people cAMP dependent kinases-9 bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people cAMP dependent kinases-9 high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing people cAMP dependent kinases-9 positive cells.

Antibody among the present invention can be used for treating or prevention and the relevant disease of people cAMP dependent kinases-9.The antibody that gives suitable dosage can stimulate or block the generation or the activity of people cAMP dependent kinases-9.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization people cAMP dependent kinases-9 level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.People cAMP dependent kinases-9 level that is detected in the test can be with laying down a definition the importance of people cAMP dependent kinases-9 in various diseases and be used to the disease of diagnosing people cAMP dependent kinases-9 to work.

Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.

The polynucleotide of coding people cAMP dependent kinases-9 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of people cAMP dependent kinases-9 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the people cAMP dependent kinases-9 of expressing variation, to suppress endogenic people cAMP dependent kinases-9 activity.For example, a kind of people cAMP dependent kinases-9 of variation can be the people cAMP dependent kinases-9 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of expression of people cAMP dependent kinases-9 or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding people cAMP dependent kinases-9 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding people cAMP dependent kinases-9 is found in existing document (Sambrook, et al., Molecular Cloning, a Laboratory Manual, Cold SpringHarbor Laboratory, New York, 1989).The polynucleotide of reorganization coding people cAMP dependent kinases-9 can be packaged in the liposome and be transferred in the cell in addition.

Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

Suppress the oligonucleotide (comprising sense-rna and DNA) of people cAMP dependent kinases-9mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.

The polynucleotide of coding people cAMP dependent kinases-9 can be used for the diagnosis with the relative disease of people cAMP dependent kinases-9.The unconventionality expression of the expression that the polynucleotide of coding people cAMP dependent kinases-9 can be used for detecting people cAMP dependent kinases-9 people cAMP dependent kinases-9 whether or under morbid state.As the dna sequence dna of the people cAMP dependent kinases-9 of encoding can be used for biopsy specimen is hybridized to judge the expression situation of people cAMP dependent kinases-9.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.The special primer of personnel selection cAMP dependent kinases-9 carries out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect people cAMP dependent kinases-9.

The sudden change that detects people cAMP dependent kinases-9 gene also can be used for the disease of diagnosing people cAMP dependent kinases-9 relevant.The form of people cAMP dependent kinases-9 sudden change comprises any unusual etc. with the normal wild type people cAMP point mutation that dependent kinases-the 9DNA sequence is compared, transposition, disappearance, reorganization and other.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.

Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.

The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.

Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.People cAMP dependent kinases-9 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's people cAMP dependent kinases-9 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.

Fig. 1 is the proteic amino acid sequence homology comparison diagram of the PKI in inventor cAMP dependent kinases-9 and the rat testis.The top sequence is a people cAMP dependent kinases-9, and the below sequence is the PKI albumen in the rat testis.Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".

Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating people cAMP dependent kinases-9.9kDa is proteinic molecular weight.The arrow indication is isolated protein band.

Fig. 3 has shown the Northern result of inventor cAMP dependent kinases-9.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Embodiment 1: the clone of people cAMP dependent kinases-9

Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure all clones' 5 ' and 3 ' terminal sequence with Dyeterminate cycle reaction sequencing kit (Perkin-Elmer company product) and ABI377 automatic sequencer (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0436f11 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0436f11 clone is 1040bp (shown in SEQ ID NO:1), from 112bp to 348bp the open reading frame (ORF) of a 237bp, the new protein (shown in SEQID NO:2) of encoding arranged.We are with this clone's called after pBS-0436f11, and the name of encoded protein matter is people cAMP dependent kinases-9.

Embodiment 2:cDNA clone's homology retrieval

With the sequence and the encoded protein sequence thereof of people cAMP dependent kinases-9 of the present invention, with Blast program (Basiclocal Alignment search tool) [Altschul, SF et al., J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.With the highest gene of people cAMP dependent kinases-9 homology of the present invention be PKI albumen in a kind of known rat testis, its encoded protein number is L02241 in the access of Genbank.Protein homology the results are shown in Fig. 1, both height homologies, and its homogeny is 58/78 (74%); Similarity is 66/78 (84%).Embodiment 3: with the gene of RT-PCR method clones coding people cAMP dependent kinases-9

Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:

Primer1：5′-GGGGGTTATTTTTAGCAATCTGGC-3′(SEQ?ID?NO：3)

Primer2：5′-GAAGATAGTAAAATTCGTTTAATAG-3′(SEQ?ID?NO：4)

Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;

Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.

The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/L Tris-HCl, (pH8.5), 1.5mmol/L MgCl ₂, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-1040bp shown in the SEQ ID NO:1 are identical.Embodiment 4:Northern blotting analyst cAMP dependent kinases-9 expression of gene

Extract total RNA[Anal.Biochem1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²P dATP prepares by random priming ³²The dna probe of P-mark.Used dna probe is people cAMP dependent kinases-9 coding region sequence (112bp to 348bp) of the pcr amplification shown in the SEQ ID NO:1.Probe (about 2 * 10 with the 32P-mark ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.l%SDS.Then, analyze with quantitative with Phosphor Imager.Embodiment 5: the vivoexpression of recombinant human cAMP dependent kinases-9, separation and purifying

According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:

Primer3：5′-CCCCATATGATGAGGACAGATTCATCAAAAATG-3′(SEQ?ID?NO：5)

Primer4：5′-CATGGATCCTCATTTTTCTTCATTTTGAGGC-3′(SEQ?ID?NO：6)

5 ' end of these two sections primers contains NdeI and BamHI restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, NdeI and BamHI restriction enzyme site are corresponding to the selectivity restriction enzyme site on the expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.6986 5.3).With the pBS-0436f11 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0436f11 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with NdeI and BamHI, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0436f11) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0436f11) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant, with carrying out chromatography, obtained the target protein people cAMP dependent kinases-9 of purifying with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cart ridge (Novagen company product).Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 9kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 6 anti-people cAMP dependent kinases-9 production of antibodies

With the synthetic specific polypeptide of following people cAMP dependent kinases-9: the NH2-Met-Arg-Thr-Asp-Ser-Ser-Lys-Met-Thr-Asp-Val-Glu-Ser-Gly-Val-COOH (SEQ ID NO:7) of Peptide synthesizer (PE company product).Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avramea s, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with people cAMP dependent kinases-9 specifically.Embodiment 7 DNA Microarray

Gene chip or gene micromatrix (DNA Microarray) are that present many National Laboratories and big drugmaker are all in the new technology of setting about developing and developing, it is meant and is arranged in a large amount of target fragments on the carriers such as glass, silicon in an orderly manner, to high-density, carry out the comparison and the analysis of data then with fluoroscopic examination and computer software, to reach purpose quick, efficient, that bioinformation is analyzed on high-throughput ground.Polynucleotide of the present invention can be used as target DNA and are used for biochip technology and are used for high-throughput and study new gene function; Seek and the new gene of the screening tissue specificity new gene of disease-related such as tumour particularly; The diagnosis of disease is as heredopathia.The existing in the literature multiple report of its concrete grammar step is as consulting document DeRisi, J.L., Lyer, V.﹠amp; Brown, P.O. (1997) Science278,680-686. and document Helle, R.A., Schema, M., Chai, A., Shalom, D., (1997) PNAS94:2150-2155. () point sample

Various full-length cDNA amounts to 4000The bar polynucleotide sequence is as target DNA, comprising polynucleotide of the present invention.They are increased by (method of being narrated as embodiment 3) PCR respectively, behind the purifying gained amplified production its concentration is transferred to about 500ng/ul, (available from U.S. Cartesian company) puts on glass medium with the Cartesian7500 point sample instrument, and distance between points is 280 μ m.Slide behind the point sample is carried out hydration, drying, places UV-crosslinked instrument crosslinked, and the wash-out after drying is fixed on DNA and is prepared into chip on the sheet glass.The existing in the literature multiple report of its concrete grammar step, the point sample post-processing step of present embodiment is:

1. hydration 4 hours in the wet environment;

2.0.2%SDS washed 1 minute;

3.ddH ₂The O washed twice, each 1 minute;

4.NaBH ₄Sealed 5 minutes;

5.95 in ℃ water 2 minutes;

6.0.2%SDS washed 1 minute;

7.ddH ₂Twice of O flushing;

8. airing, 25 ℃ to be stored in the dark place standby.(2) probe mark

With the single stage method total mRNA of extracting from normal brain activity and cerebral glioma respectively, and with Oligotex mRNA MidiKit (available from QiaGen company) purified mRNA, by reverse transcription respectively with fluorescent reagent Cy3dUTP (5-Amino-propargyl-2 '-deoxyuridine 5 '-triphate coupled to Cy3 fluorescent dye, available from Amersham Phamacia Biotech company) mRNA of mark normal cerebral tissue, with fluorescent reagent Cy5dUTP (5-Amino-propargyl-2 '-deoxyuridine 5 '-triphate coupled to Cy5fluorescent dye, available from Amer sham Phamacia Biotech company) mark cerebral glioma tissue mRNA, prepare probe after purified.Concrete steps and method be with reference to Schena, M., Shalon, D., Heller, R. (1996) Proc.Natl.Acad.Sci.USA.Vol.93:l0614-10619.Schena, M., Shalon, Dari., Davis, R.W. (1995) Science.270. (20): 467-480. (three) hybridization

Respectively will be from the probe of above two kinds of tissues with chip at UniHyb ^TMHybridized 16 hours in Hybri dizationSolution (available from the TeleChem company) hybridization solution, room temperature washings (1 * SSC, 0.2%SDS) the washing back is scanned with ScanArray 3000 scanners (available from U.S. General Scanning company), the image of scanning carries out data analysis with Imagene software (U.S. Biodiscovery company) to be handled, calculate the Cy3/Cy5 ratio of each point, this ratio is considered to express discrepant gene less than 0.5 greater than 2 point.

Experimental result shows, Cy3signal=12518.17 (getting the mean value of four experiments), Cy5signal=5694.28 (getting the mean value of four experiments), Cy3/Cy5=2.20, the expression of polynucleotide of the present invention in above two kinds of tissues has notable difference, shows that polynucleotide of the present invention are relevant with the cerebral glioma tissue.

Sequence table (1) general information: (ii) denomination of invention: the polynucleotide of people cAMP dependent kinases-9 and this polypeptide of coding are the sequence number (iii): the information of 7 (2) SEQ ID NO:1: (i) sequence signature:

(A) length: 1040bp

(B) type: nucleic acid

(C) chain: two strands

( D ) ： ( ii ) ：cDNA ( xi ) ：SEQ ID NO：1： 1 GGGGGTTATTTTTAGCAATCTGGCTCACACTGAGGGCTTCCTGCTCTATTCAGCAAATGT 61 GCAAATGGATGCTGCAGGACCGTAACAGTAGACATTGATGAAGATGTTGCTATGAGGACA121 GATTCATCAAAAATGACTGACGTGGAGTCTGGGGTCGCCAATTTTGCATCTTCAGCAAGG181 GCAGGCCGCCGGAATGCCTTACCAGACATCCAGAGTTCAGCTGCCACAGACGGAACCTCA241 GATTTGCCCCTCAAACTGGAGGCTCTCTCCGTGAAGGAAGATGCAAAAGAGAAAGATGAA301 AAAACAACACAAGACCAATTGGAAAAGCCTCAAAATGAAGAAAAATGAAGGCTCATAATC361 TATCAAGAGTGCTGAATTTCTGCATGTTGAAAGACTTAGTGGTTCTGTTTTCTTGAGACA421 TTTAATCTGGTGGTAACTGTGGTAACATTGCAGCCCTAAGCAGCATGTGTATATTAGATA481 ATTGTGTTGTGATGCTACTCACTTTGATTGCAATGATGATGTCCAAGGTAAGCTATTAAA541 AGGCAGGTTACTTCCAAATCGCACTGAAGGAAAAGGTTAAGAATAATACATGATCACAGA601 AATGCATACCACTGTCTGTAAACCCAACAAAATTCACTGTTCTCTTTTGGATTTATTTAG661 CCTGATGTATTTTTAATTCAATTTTTATGGTGATGGGCAAATCATTCTTGGTAAATGTAA721 ATCAAACATGATTGATTTAAAACTTCATGGAATTTGTAGAAAATTATGGACATTTTTGGT781 GAGAAAGAACAATAGTCAAAACTCACATGGATAGAGTGTGTTTGTTTTTTGCCAAAAATG841 CCCCAGACCTTTTCCCAAACCTCAAAAACGTCTTGGAAAAATTGTAAAAGTTTGATAACA901 GAAACATCTTTAGGATATTTTTGTCTGACGTATTTTGCTTCTAGTATGTGCCTACTGTGA 961 TTTTTTTCATGTGGAAAATGCAAAATTTGTAACAAAATGGTTATATGGAACATGCCTATT1021 AAACGAATTTTACTATCTTC ( 3 ) SEQ ID NO：2： ( i ) ：

(A) length: 78 amino acid

(B) type: amino acid

(D) topological structure: linear (ii) molecule type: polypeptide (xi) sequence description: the information of SEQ ID NO:2:1 Met Arg Thr Asp Ser Ser Lys Met Thr Asp Val Glu Ser Gly Val 16 Ala Asn Phe Ala Ser Ser Ala Arg Ala Gly Arg Arg Asn Ala Leu 31 Pro Asp Ile Gln Ser Ser Ala Ala Thr Asp Gly Thr Ser Asp Leu 46 Pro Leu Lys Leu Glu Ala Leu Ser Val Lys Glu Asp Ala Lys Glu 61 Lys Asp Glu Lys Thr Thr Gln Asp Gln Leu Glu Lys Pro Gln Asn 76 Glu Glu Lys (4) SEQ ID NO:3: (i) sequence signature

(A) length: 24 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO:3:5 '-GGGGGTTATTTTTAGCAATCTGGC-3 ' 24 (5) SEQ ID NO:4: (i) sequence signature

(A) length: 25 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO:4:5 '-GAAGATAGTAAAATTCGTTTAATAG-3 ' 25 (6) SEQ ID NO:5: (i) sequence signature

(A) length: 33 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO:5:5 '-CCCCATATGATGAGGACAGATTCATCAAAAATG-3 ' NdeI 33 (7) SEQ ID NO:6: (i) sequence signature

(A) length: 31 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO:6:5 '-CATGGATCCTCATTTTTCTTCATTTTGAGGC-3 ' BamHI 31 (8) SEQ ID NO:7: (i) sequence signature:

(A) length: 15 amino acid

(B) type: amino acid

(D) topological framework: linearity is molecule type (ii): polypeptide (xi) sequence description: SEQ ID NO:7:NH2-Met-Arg-Thr-Asp-Ser-Ser-Lys-Met-Thr-Asp-Val-Glu-Ser-Gly-Val-COOH

Claims (18)

1, a kind of isolated polypeptide-people cAMP dependent kinases-9 is characterized in that it includes: the polypeptide of the aminoacid sequence shown in the SEQID NO:2 or the active fragments of its polypeptide, analogue or derivative.

2, polypeptide as claimed in claim 1, the aminoacid sequence that it is characterized in that described polypeptide, analogue or derivative has the homogeny with the aminoacid sequence at least 95% shown in the SEQ ID NO:2.

3, polypeptide as claimed in claim 2 is characterized in that it comprises the polypeptide with the aminoacid sequence shown in the SEQ ID NO:2.

4, a kind of isolating polynucleotide is characterized in that described polynucleotide comprise to be selected from down a kind of in the group: (a) coding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2 or its fragment, analogue, derivative

Polynucleotide; (b) with polynucleotide (a) complementary polynucleotide; Or (c) and (a) or the polynucleotide of at least 75% homogeny (b) are arranged.

5, polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise the polynucleotide that coding has aminoacid sequence shown in the SEQ IDNO:2.

6, polynucleotide as claimed in claim 4, the sequence that it is characterized in that described polynucleotide include the sequence of 1-1040 position among the sequence of 112-348 position among the SEQ IDNO:1 or the SEQ ID NO:1.

7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that it is the recombinant vectors that is formed by the described polynucleotide of arbitrary claim among the claim 4-6 and plasmid, virus or vehicle expression vector establishment.

8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell:

(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or

(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.

9, a kind of preparation method with the active polypeptide of people cAMP dependent kinases-9, it is characterized in that described method comprises: (a) under expressing human cAMP dependent kinases-9 condition, cultivate the described through engineering approaches host cell of claim 8; (b) from culture, isolate and have the active polypeptide of people cAMP dependent kinases-9.

10, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with people cAMP dependent kinases-9 specificity bonded antibody.

11, the compound of an analoglike or adjusting polypeptide active or expression is characterized in that they are simulation, promotion, antagonism or the active compound that suppresses people cAMP dependent kinases-9.

12, compound as claimed in claim 11 is characterized in that it is the polynucleotide sequence shown in the SEQ ID NO:1 or its segmental antisense sequences.

13, the described application of compound of a kind of claim 11, it is characterized in that described compound be used for mediator cAMP dependent kinases-9 in vivo, the method for external activity.

14, a kind of disease relevant or method of disease susceptibility of detecting with the described polypeptide of arbitrary claim among the claim 1-3, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide, perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.

15, as the application of polypeptide as described in the arbitrary claim among the claim 1-3, it is characterized in that it is applied to screen the stand-in of people cAMP dependent kinases-9, agonist, antagonist or inhibitor; Perhaps be used for the peptide finger print identification.

16, as the application of the described nucleic acid molecule of arbitrary claim among the claim 4-6, it is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps be used for hybridization, perhaps be used to make gene chip or microarray as probe.

17,, it is characterized in that forming pharmaceutical composition with safe and effective dosage and pharmaceutically acceptable carrier as diagnosis or the treatment disease relevant unusually with people cAMP dependent kinases-9 with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor as the described polypeptide of arbitrary claim, polynucleotide or application of compound in claim 1-6 and 11.

18, the described polypeptide of arbitrary claim, polynucleotide or the application of compound among the claim 1-6 and 11 is characterized in that being used for the treatment of cancer with described polypeptide, polynucleotide or compound, disturbance of memory, autoimmune disease, the medicine of asthma.

Images