CN1297919A - Human zinc-finger protein 69 as one new kind of polypeptide and polynucleotides encoding this polypeptide - Google Patents

Human zinc-finger protein 69 as one new kind of polypeptide and polynucleotides encoding this polypeptide Download PDF

Info

Publication number
CN1297919A
CN1297919A CN99124128A CN99124128A CN1297919A CN 1297919 A CN1297919 A CN 1297919A CN 99124128 A CN99124128 A CN 99124128A CN 99124128 A CN99124128 A CN 99124128A CN 1297919 A CN1297919 A CN 1297919A
Authority
CN
China
Prior art keywords
polypeptide
polynucleotide
zinc finger
finger protein
human zinc
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN99124128A
Other languages
Chinese (zh)
Inventor
毛裕民
谢毅
裘敏燕
王勇
江广平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BORONG GENE DEVELOPMENT CO LTD SHANGHAI
Original Assignee
BORONG GENE DEVELOPMENT CO LTD SHANGHAI
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BORONG GENE DEVELOPMENT CO LTD SHANGHAI filed Critical BORONG GENE DEVELOPMENT CO LTD SHANGHAI
Priority to CN99124128A priority Critical patent/CN1297919A/en
Priority to AU15091/01A priority patent/AU1509101A/en
Priority to PCT/CN2000/000445 priority patent/WO2001038378A1/en
Publication of CN1297919A publication Critical patent/CN1297919A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention discloses a novel polypeptide, human zinc-finger protein 69, polynucleotides encoding this polypeptide and DNA recombination process to produce the polypeptide. The present invention also discloses the method of applying the polypeptide in treating various diseases, such as malignant tumor, nosohemia, HIV infection, immunological diseases and inflammations. The present invention also discloses the antagonist resisting the polypeptide and its treatment effect. The present invention also discloses the application of the polynucleotides encoding this polypeptide.

Description

The polynucleotide of a kind of new polypeptide--Novel Human Zinc Finger Protein 69 and this peptide species of coding
The invention belongs to biological technical field, specifically, the invention describes a kind of new polypeptide--Novel Human Zinc Finger Protein 69, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.
Zinc-binding protein participates in gene expression and regulation as transcription factor and signal transducers usually, and this proteinoid has constituted a very big protein family, is called as zinc finger protein.A zinc atom binding domains is made up of 25 to 30 amino-acid residues usually, and these amino-acid residues have been formed one or more atom binding site points.The combination of zinc atom makes protein folding become certain structure unit, these structures can well adapt to interaction between macromole (Berg, J.M.et al., 1996, Science, 271:1081-1085).Discover that zinc finger protein all has expression in the various tissues of different biologies, these tissues comprise hematopoietic cell, brain, neural system, the various tissue relevant with tumour and immortal cell line tissue etc.It all plays very important regulatory role in the genetic expression process of these tissues.
All zinc finger proteins all contain conservative zinc fingers, zinc fingers mainly contains two classes: C2H2 type and C2C2 type, in addition, also have a class zinc fingers to find in the zymic gene activation factor, 2 Zn atoms closely are close together and cooperate with 6 Cys, form the structure of " zinc bunch " core.Wherein distribute the most extensive with the C2H2 type.
C2H2 type Zinc finger domain, be that the Zn atom combines (C2H2) with 2 Cys, 2 His residues, refer to have in the unit one section comparatively conservative sequence at this class zinc: (Tyr, Phe)-X-Cys-X (2,4)-Cys-X3-Phe-X5-Leu-X2-His-X (3,5)-(wherein X represents arbitrary amino acid residue to His; Halfcystine and Histidine and zinc atom form coordinate bond, in conjunction with zinc atom; Other three conservative amino-acid residues form the hydrophobicity central zone; The amino-acid residue of other variation is responsible for mediating the interaction of albumen and other molecule).In zinc finger protein, the effect of Zn is protein molecule to be formed refer to that the skeleton of type conformation combines with DNA.Zinc fingers all exists in many and " protein-nucleic acid " and " protein-protein " interaction proteins associated.A zinc finger protein may contain one or more Zinc finger domains, and these structural domains are independently finished the function of oneself in vivo.Under many circumstances, contain the albumen of Zinc finger domain and special two strands and single stranded DNA sequence and interact, play a part transcription regulaton factor and signal transmission factor.Have now and discover that the Zinc finger domain of C2H2 type not only plays important regulatory role in the genetic expression process of some tissues, and it also plays a part crucial in the forming process of growing adjusting and some tissue tumors.
C2H2 type zinc finger protein also can be divided into various family by its constitutional features.Kruppel type zinc finger protein has promptly formed independently family in vivo, the member of this family is all contained the conservative zinc-finger motif of zinc finger protein family, and link together by conservative H/C connecting zone between each motif, conservative aminoacid sequence is contained in this zone: TGEKPY/F[Schuh R., Aicher W.Et al., Cell, 1986,47:1025-1032].In addition, people such as Bellefroid just pointed out in 1991, also contained a conservative motif of being made up of 75 amino acid by 1/3rd member at its N-terminal approximately in this family, and with this motif called after KRAB (Kruppel-associated box) structural domain.This structural domain is zinc finger protein N-terminal and DNA bonded structural domain, high conservative [Judith F.Margolin et al., Proc.Natl.Acad.Sci.USA, 1994,91:4509-4513] on evolving.This structural domain is divided into two box structures of A, B, wherein is rich in the amino-acid residue of variation, forms two wetting ability spirals.Some contains KRAB A-box and KRAB B-box simultaneously member in the zinc finger protein KRAB subfamily, and some only contains KRAB A-box.Discover, the KRAB structural domain is that a potential is transcribed the inhibition structural domain, wherein the wetting ability spiral fragment of being made up of 45 amino acid suppresses necessary for transcribing, amino acid whose replacement will weaken the inhibit feature of albumen to transcribing in the spirane structure, thereby cause the imbalance of gene transcript expression and cause various growths and disease [N.Tommerup et al. that pernicious disorder is relevant, Genomics, 1995,27:259-264 ].Simultaneously, also contain a conservative connecting zone between KRAB structural domain and first zinc fingers, a nucleic acid signal for locating is contained in this zone at least, and this signal is relevant with proteic correct location and performance function.
New Novel Human Zinc Finger Protein of the present invention and known Novel Human Zinc Finger Protein 184 have 52% identity and 66% similarity on protein level.And the N-terminal of both aminoacid sequences all contains the characteristic structural domain of zinc finger protein KRAB subfamily---KRAB structural domain; The characteristic structural domain that then contains C2H2 type zinc finger protein behind the KRAB structural domain---C2H2 zinc fingers.So new gene of the present invention is the newcomer in the Novel Human Zinc Finger Protein KRAB subfamily, called after zinc finger protein 69.And infer that with this it has similar biological function to Novel Human Zinc Finger Protein 184, to grow the generation of disorders and malignant disease relevant with some in vivo.
Because Novel Human Zinc Finger Protein 69 albumen play an important role in regulating body critical functions such as cell fission and fetal development as mentioned above, and believe and relate to a large amount of albumen in these regulate processes, thereby need to identify Novel Human Zinc Finger Protein 69 albumen of more these processes of participation in this area always, particularly identify this proteic aminoacid sequence.The separation of new Novel Human Zinc Finger Protein 69 protein coding genes also provides the foundation for determining the effect of this albumen under healthy and morbid state.This albumen may constitute the basis of exploitation medical diagnosis on disease and/or curative, and it is very important therefore separating its coding DNA.
An object of the present invention is to provide isolating new polypeptide--Novel Human Zinc Finger Protein 69 with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of this polypeptide of coding.
Another object of the present invention provides the recombinant vectors of the polynucleotide that contain the Novel Human Zinc Finger Protein 69 of encoding.
Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain the Novel Human Zinc Finger Protein 69 of encoding.
Another object of the present invention provides the method for producing Novel Human Zinc Finger Protein 69.
Another object of the present invention provides at polypeptide of the present invention--the antibody of Novel Human Zinc Finger Protein 69.
Another object of the present invention has provided at polypeptide of the present invention--the simulated compound of Novel Human Zinc Finger Protein 69, antagonist, agonist, inhibitor.
Another object of the present invention provides the method for the unusual relevant disease of diagnoses and treatment and Novel Human Zinc Finger Protein 69.
The present invention relates to a kind of isolated polypeptide, this polypeptide is the people source, and it comprises: polypeptide or its examples of conservative variations, bioactive fragment or derivative with SEQ ID No.2 aminoacid sequence.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
The invention still further relates to a kind of isolating polynucleotide, it comprises a kind of nucleotide sequence or its variant that is selected from down group:
(a) coding has the polynucleotide of the polypeptide of SEQ ID No.2 aminoacid sequence;
(b) with polynucleotide (a) complementary polynucleotide;
(c) with (a) or polynucleotide sequence (b) have the polynucleotide of at least 70% homogeny.
More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 352-2226 position among the SEQ ID NO:1; (b) has the sequence of 1-2550 position among the SEQ ID NO:1.
The present invention relates to a kind of carrier that contains polynucleotide of the present invention, particularly expression vector in addition; The host cell that this carrier of a kind of usefulness is genetically engineered comprises the host cell of conversion, transduction or transfection; A kind of method for preparing polypeptide of the present invention of cultivating described host cell and reclaiming expression product that comprises.
The invention still further relates to a kind of can with polypeptid specificity bonded antibody of the present invention.
The invention still further relates to a kind of simulation, activation, antagonism of screening or suppress the method for the compound of Novel Human Zinc Finger Protein 69 protein-actives, it comprises and utilizes polypeptide of the present invention.The invention still further relates to the compound that obtains with this method.
The invention still further relates to a kind of vitro detection and express the relevant disease or the method for disease susceptibility with Novel Human Zinc Finger Protein 69 abnormal proteins, comprise the sudden change in polypeptide described in the detection of biological sample or its coded polynucleotide sequence, perhaps the amount or the biological activity of polypeptide of the present invention in the detection of biological sample.
The present invention also relates to a kind of pharmaceutical composition, it contains polypeptide of the present invention or its stand-in, activator, antagonist or inhibitor and pharmaceutically acceptable carrier.
The invention still further relates to polypeptide of the present invention and/or polynucleotide and be used for the treatment of cancer, developmental character disease or immunological disease or other purposes owing to the medicine of Novel Human Zinc Finger Protein 69 diseases that abnormal expression causes in preparation.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
The following term of using in this specification sheets and claims has following implication unless stated otherwise:
" nucleotide sequence " is meant oligonucleotide, Nucleotide or polynucleotide and fragment or part, also can refer to genome or synthetic DNA or RNA, and they can be strand or two strands, represent sense strand or antisense strand.Similarly, term " aminoacid sequence " is meant oligopeptides, peptide, polypeptide or protein sequence and fragment or part.When " aminoacid sequence " among the present invention related to a kind of aminoacid sequence of naturally occurring protein molecule, this " polypeptide " or " protein " did not mean that aminoacid sequence are restricted to the complete natural amino acid relevant with described protein molecule.
Protein or polynucleotide " variant " are meant a kind of polynucleotide sequence that has the aminoacid sequence of one or more amino acid or Nucleotide change or encode it.Described change can comprise disappearance, insertion or the replacement of amino acid in aminoacid sequence or the nucleotide sequence or Nucleotide.Variant can have " conservative property " and change, and wherein the amino acid of Ti Huaning has structure or the chemical property similar with original acid, as replacing Isoleucine with leucine.Variant also can have non-conservation and change, as replacing glycine with tryptophane.
" disappearance " is meant the disappearance of in aminoacid sequence or nucleotide sequence one or more amino acid or Nucleotide.
" insertion " or " interpolation " is meant that the change in aminoacid sequence or nucleotide sequence causes comparing the increase of one or more amino acid or Nucleotide with naturally occurring molecule." replacement " is meant by different amino acid or Nucleotide and replaces one or more amino acid or Nucleotide.
" biological activity " is meant the protein of structure, regulation and control or biochemical function with natural molecule.Similarly, term " immunologic competence " be meant natural, reorganization or synthetic protein and fragment thereof in suitable animal or cell, induce specific immune response and with specific antibody bonded ability.
" agonist " is meant when combining with Novel Human Zinc Finger Protein 69, thereby a kind of this protein that causes changes the molecule of regulating this protein active.Agonist can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of Novel Human Zinc Finger Protein 69.
" antagonist, " or " inhibition " is meant when combining with Novel Human Zinc Finger Protein 69, a kind of sealing or the biologic activity of mediator's zinc finger protein 69 or the molecule of immunologic competence.Antagonist and inhibition can comprise protein, nucleic acid, carbohydrate or any other can be in conjunction with the molecule of Novel Human Zinc Finger Protein 69.
" regulate,, be meant that the function of Novel Human Zinc Finger Protein 69 changes, comprise the change of any other biological property, function or the immune property of the change of the rising of protein active or reduction, binding characteristic and Novel Human Zinc Finger Protein 69.
" pure basically " is meant and is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying Novel Human Zinc Finger Protein 69 of standard.Basically pure Novel Human Zinc Finger Protein 69 can produce single master tape on the irreducibility polyacrylamide gel.The purity available amino end acid sequence of Novel Human Zinc Finger Protein 69 polypeptide is analyzed.
" complementary " or " complementation " is meant under salt concn that allows and temperature condition by the natural combination of the polynucleotide of base pairing.For example, sequence " C-T-G-A " can combine with complementary sequence " G-A-C-T ".Complementation between two single chain molecules can be part or whole.Complementary degree between the nucleic acid chains has a significant effect for efficient of hybridizing between the nucleic acid chains and intensity.
" homology " is meant the complementary degree, can be portion homologous or complete homology." portion homologous " is meant a kind of part complementary sequence, and it can partly suppress the hybridization of complete complementary sequence and target nucleic acid at least.The inhibition of this hybridization can detect by hybridizing (Southern trace or Northern trace etc.) under the condition that reduces in the severity degree.Basically homologous sequence or hybridization probe can compete and suppress complete homologous sequence and target sequence the condition that reduces of severity degree under combine.This does not mean the conditions permit non-specific binding that the severity degree reduces because the conditional request two sequences that the severity degree reduces mutual be combined into specificity or selectivity interacts.
" homogeny percentage " be meant two or more amino acid or nucleotide sequence relatively in the same or analogous percentage of sequence.The available electron method is measured the homogeny percentage, as passing through MEGALIGN program (Lasergenesoftware package, DNASTAR, Inc., Madison Wis.).The MEGALIGN program can compare two or more sequences (Higgins, D.G. and P.M.Sharp (1988) Gene 73:237-244) according to diverse ways such as Cluster method.The Cluster method is organized the series arrangement cluster by checking the distance between all pairings with each.Then with each bunch with in pairs or become set of dispense.Homogeny percentage between two aminoacid sequences such as sequence A and the sequence B calculates by following formula: residue number---------------------------------------------------------100 of mating between sequence A and the sequence B
Interval residue number in the several sequence B of interval residue in the several sequence A of the residue of sequence A
Also can be by the Cluster method or with the homogeny percentage (Hein J., (1990) Methods in emzumology 183:625-645) between known method in this area such as the Jotun Hein mensuration nucleotide sequence.
" similarity " is meant the degree that the identical or conservative property of corresponding position amino-acid residue when arranging contrast between the aminoacid sequence replaces.For example be used for amino acid that conservative property replaces, electronegative amino acid can comprise aspartic acid and L-glutamic acid; Positively charged amino acid can comprise Methionin and arginine; Having uncharged head group has similar hydrophilic amino acid can comprise leucine, Isoleucine and Xie Ansuan; Glycine and L-Ala; L-asparagine and glutamine; Serine and Threonine; Phenylalanine and tyrosine.
" antisense " is meant and specific DNA or RNA sequence complementary nucleotide sequence." antisense strand " is meant and " sense strand " complementary nucleic acid chains.
" derivative " is meant HFP or encodes its chemical modification object of nucleic acid.This chemical modification object can be with alkyl, acyl group or the amino hydrogen atom of replacing.The nucleic acid derivative codified keeps the polypeptide of the main biological characteristics of natural molecule.
" antibody " is meant complete antibody molecule and fragment thereof, as Fa, F (ab ') 2And Fv, its energy specificity is in conjunction with the antigenic determinant of Novel Human Zinc Finger Protein 69.
" humanized antibody " is meant that the aminoacid sequence in non-antigen binding domain territory is replaced and becomes more similar to people's antibody, but still keep original in active antibody.
" isolating " speech refers to material is shifted out among its original environment (for example, if spontaneous its natural surroundings that just refers to).Such as it is exactly not to be separated that spontaneous polynucleotide or polypeptide are present in the Live Animals, but same polynucleotide or polypeptide with some or all in natural system with it the material of coexistence separately be exactly isolating.Such polynucleotide may be the parts of a certain carrier, the part that also possible such polynucleotide or polypeptide are a certain composition.Since carrier or composition are not the compositions of its natural surroundings, they remain isolating.
Many As used hereins, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and peptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating Novel Human Zinc Finger Protein 69 " is meant that Novel Human Zinc Finger Protein 69 is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying Novel Human Zinc Finger Protein 69 of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of Novel Human Zinc Finger Protein 69 polypeptide can be used amino acid sequence analysis.
The invention provides a kind of new polypeptide--Novel Human Zinc Finger Protein 69, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of Novel Human Zinc Finger Protein 69.As used herein, term " fragment ", " derivative " and " analogue " are meant biological function or the active polypeptide that keeps Novel Human Zinc Finger Protein of the present invention 69 identical basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) is a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.
The invention provides isolating nucleic acid (polynucleotide), substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 2550 bases, its open reading frame (352-2226) 624 amino acid of having encoded.Find relatively that according to amino acid sequence homologous this polypeptide and Novel Human Zinc Finger Protein 184 have 52% homology, deducibility goes out this Novel Human Zinc Finger Protein 69 and has the similar 26S Proteasome Structure and Function of Novel Human Zinc Finger Protein 184.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, " nucleic acid fragment " length contain 10 Nucleotide at least, better be 20-30 Nucleotide at least, be more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding Novel Human Zinc Finger Protein 69.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
The special polynucleotide sequence of coding Novel Human Zinc Finger Protein 69 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.
Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.
In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.
Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration Novel Human Zinc Finger Protein 69; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.
In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.
In (4) kind method, detect the protein product of Novel Human Zinc Finger Protein 69 genetic expressions and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with carrier of the present invention or directly with the host cell of Novel Human Zinc Finger Protein 69 encoding sequences through the genetically engineered generation, and the method that produces polypeptide of the present invention through recombinant technology.
Among the present invention, the polynucleotide sequence of coding Novel Human Zinc Finger Protein 69 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.
Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains the Novel Human Zinc Finger Protein 69 of encoding and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Go into the PL promotor of phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.
Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.
Among the present invention, the polynucleotide of coding Novel Human Zinc Finger Protein 69 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.
Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results 2Method is handled, and used step is well-known in this area.Alternative is to use MgCl 2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.
By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce Novel Human Zinc Finger Protein 69 (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people Novel Human Zinc Finger Protein 69, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). in suitable medium, cultivate host cell;
(3). separation, protein purification from substratum or cell.
In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat malignant tumour, adrenal gland defect, tetter, all kinds of inflammation, HIV infection and immunological disease etc.The member who discovers C2H2 type zinc finger protein KRAB subfamily all has expression human hematopoietic cell, brain, neural system, face tissue, the various absorption in the tissue that relevant tissue reaches and tumour is correlated with immortal cell line with secretion, but the expression in human T lymphocyte and sexual cell is significantly higher than other tissue.The member of this family is mainly regulating various cells whose development and differentiation in vivo, they can control the level that range gene is transcribed in vivo effectively, its abnormal expression may cause the unusual differentiation and the propagation of some cells, thereby the initiation various diseases comprises the cancer of growth disorder disease and some particular organizations etc.
Specifically with regard to zinc finger protein 69 of the present invention, its protein product can be used to prevent and treats various malignant tumour and the cancers relevant with its expression.These tumours and cancer include but not limited to following kind: the cancer of hematopoietic cell and tissue comprises leukemia, lymphoma, lymphosarcoma, myelomatosis etc.; The cancer of brain and nervous tissue comprises neuroma, neurospongioma, meningioma, neurofibroma and astrocytoma etc.; The various cancers of secretion or absorptive tissue, body of gland and organ comprise: suprarenal gland, Tiroidina, lung, pancreas, liver, prostate gland, uterus, bladder, kidney, testis and gi tract (small intestine, colon, rectum and stomach); Also have some and cellular abnormality differentiation, propagation and the relevant disease of degraded, comprise diseases such as hyperthyroidism, hypothyroidism, gastritis, polyp of colon, gastro-duodenal ulcer.
Zinc finger protein 69 of the present invention contains a KRAB structural domain, this structural domain is that a potential is transcribed the inhibition structural domain, amino acid whose sudden change will weaken the inhibit feature of albumen to transcribing in its spirane structure, also can cause the imbalance of gene transcript expression and cause various growths and pernicious disorder disease.These diseases include but not limited to following these, as heredity nervous system disorderss such as the cerebrovascular disease that ictal disorders, epilepsy, cerebral ischemia or hypertension such as spina bifida, hydrocephalus, achondroplastic dwarf's disease, renal tubule acidosis, anaemia, hypogenitalism, congenital glaucoma or cataract, congenital sensory nerve hearing loss, cerebral palsy cause, neurofibroma etc.
The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) Novel Human Zinc Finger Protein 69.Agonist improves Novel Human Zinc Finger Protein 69 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can in the presence of medicine, the film preparation of mammalian cell or expressing human zinc finger protein 69 be cultivated with the Novel Human Zinc Finger Protein 69 of mark.Measure the medicine raising then or check this interactional ability.
The antagonist of Novel Human Zinc Finger Protein 69 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of Novel Human Zinc Finger Protein 69 can combine and eliminate its function with Novel Human Zinc Finger Protein 69, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.
In screening during as the compound of antagonist, Novel Human Zinc Finger Protein 69 can be added during bioanalysiss measure, determine to interactional influence between Novel Human Zinc Finger Protein 69 and its acceptor whether compound is antagonist by measuring compound.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with Novel Human Zinc Finger Protein 69 bonded peptide molecules obtains.During screening, generally tackle Novel Human Zinc Finger Protein 69 molecules and carry out mark.
The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at Novel Human Zinc Finger Protein 69 antigenic determinants.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.
The method of the available Novel Human Zinc Finger Protein 69 direct injection immune animals of the production of polyclonal antibody (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of monoclonal antibody of preparation Novel Human Zinc Finger Protein 69 include but not limited to hybridoma technology (Kohler andMilstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.4946778) also can be used for producing the single-chain antibody of anti-Novel Human Zinc Finger Protein 69.
The antibody of anti-Novel Human Zinc Finger Protein 69 can be used in the immunohistochemistry technology, detects the Novel Human Zinc Finger Protein 69 in the biopsy specimen.
With the also available labelled with radioisotope of Novel Human Zinc Finger Protein 69 bonded monoclonal antibodies, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of Novel Human Zinc Finger Protein 69 high-affinities can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing Novel Human Zinc Finger Protein 69 positive cells.
The disease that antibody among the present invention can be used for treating or prevention and Novel Human Zinc Finger Protein 69 are relevant.The antibody that gives suitable dosage can stimulate or block the generation or the activity of Novel Human Zinc Finger Protein 69.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization Novel Human Zinc Finger Protein 69 levels.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.Novel Human Zinc Finger Protein 69 levels that detected in the test can be with laying down a definition the importance of Novel Human Zinc Finger Protein 69 in various diseases and be used to the disease of diagnosing Novel Human Zinc Finger Protein 69 to work.
Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.
The polynucleotide of coding Novel Human Zinc Finger Protein 69 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of Novel Human Zinc Finger Protein 69 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the Novel Human Zinc Finger Protein 69 of expressing variation, to suppress endogenic Novel Human Zinc Finger Protein 69 activity.For example, a kind of Novel Human Zinc Finger Protein 69 of variation can be the Novel Human Zinc Finger Protein 69 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of Novel Human Zinc Finger Protein 69 expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding Novel Human Zinc Finger Protein 69 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding Novel Human Zinc Finger Protein 69 is found in existing document (Sambrook, et al.).The polynucleotide of reorganization coding Novel Human Zinc Finger Protein 69 can be packaged in the liposome and be transferred in the cell in addition.
Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Suppress the oligonucleotide (comprising sense-rna and DNA) of Novel Human Zinc Finger Protein 69mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
The polynucleotide of coding Novel Human Zinc Finger Protein 69 can be used for the diagnosis with the relative disease of Novel Human Zinc Finger Protein 69.The unconventionality expression of the expression that the polynucleotide of coding Novel Human Zinc Finger Protein 69 can be used for detecting Novel Human Zinc Finger Protein 69 Novel Human Zinc Finger Protein 69 whether or under morbid state.As the dna sequence dna of the Novel Human Zinc Finger Protein 69 of encoding can be used for biopsy specimen is hybridized to judge the expression situation of Novel Human Zinc Finger Protein 69.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect Novel Human Zinc Finger Protein 69 with Novel Human Zinc Finger Protein 69 special primers.
The sudden change that detects Novel Human Zinc Finger Protein 69 genes also can be used for diagnosing the relevant disease of Novel Human Zinc Finger Protein 69.The form of Novel Human Zinc Finger Protein 69 sudden change comprises that the point mutation compared with normal wild type Novel Human Zinc Finger Protein 69 dna sequence dnas, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.
In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
The PCP localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).
The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch MedicalLibrary).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.
Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.
The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.
Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.Novel Human Zinc Finger Protein 69 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's Novel Human Zinc Finger Protein 69 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is the amino acid sequence homology comparison diagram of inventor's zinc finger protein 69 and Novel Human Zinc Finger Protein 184.The top sequence is a Novel Human Zinc Finger Protein 69, and the below sequence is a Novel Human Zinc Finger Protein 184.Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".
Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating Novel Human Zinc Finger Protein 69.69kDa is proteinic molecular weight.The arrow indication is isolated protein band.
{ embodiment }
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Embodiment 1: the clone of Novel Human Zinc Finger Protein 69
Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure all clones' 5 ' and 3 ' terminal sequence with Dye terminate cycle reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0550E06 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0550E06 clone is 2550bp (shown in Seq ID NO:1), from 352bp to 2226bp the open reading frame (ORF) of a 1875bp, the new protein (shown in Seq ID NO:2) of encoding arranged.We are with this clone's called after pBS-0550E06, encoded protein matter called after Novel Human Zinc Finger Protein 69.Embodiment 2:cDNA clone's homology retrieval
With the sequence and the encoded protein sequence thereof of Novel Human Zinc Finger Protein 69 of the present invention, with Blast program (Basiclocal Alignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10 ], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with Novel Human Zinc Finger Protein 69 homologys of the present invention is a kind of known Novel Human Zinc Finger Protein 184, and its encoded protein number is AC007842 in the access of Genbank.Protein homology the results are shown in Fig. 1, both height homologies, and its homogeny is 52%; Similarity is 66%.Embodiment 3: with the gene of RT-PCR method clones coding Novel Human Zinc Finger Protein 69
Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:
Primer1:5’-TCAAGAGAAGACTGTGCAACCCAA-3’ (SEQ?ID?NO:3)
Primer2:5’-AGGTCCAAGGTTTTTTATTCACTT-3, (SEQ?ID?NO:4)
Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;
Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.
The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/LTris-Cl, (pH8.5), 1.5mmol/L MgCl 2, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-2550bp shown in the SEQ ID NO:1 are identical.Embodiment 4:Northern blotting analyst zinc finger protein 69 expression of gene:
Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- 32P dATP prepares by random priming 32The dna probe of p-mark.Used dna probe is Novel Human Zinc Finger Protein 69 coding region sequences (352bp to 2226bp) of pcr amplification shown in Figure 1.Probe (about 2 * 10 with the 32P-mark 6Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH 2PO 4(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.Embodiment 5: the vivoexpression of recombinant human zinc finger protein 69, separation and purifying
According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:
Primer3:5’-CATGCTAGCATGGCCCATAAATATGTGGGTTTGC-3’ (Seq?ID?No:5)
Primer4:5’-CCCGAGCTCTTAGGGTATAACACTCATATGTTTT-3’ (Seq?ID?No:6)
5 ' end of these two sections primers contains Nhe I and Sac I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, Nhe I and Sac I restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0550E06 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0550E06 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with Nhe I and Sac I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0550E06) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0550E06) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Ouick Cartridge (Novagen company product), has obtained the target protein Novel Human Zinc Finger Protein 69 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 69kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 6 anti-Novel Human Zinc Finger Protein 69 production of antibodies
With synthetic following Novel Human Zinc Finger Protein 69 specific polypeptide: the NH of Peptide synthesizer (PE company product) 2-Met-Ala-His-Lys-Tyr-Val-Gly-Leu-Gln-Tyr-His-Gly-Ser-Val-Thr-COOH (SEQ ID NO:7).
Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with Novel Human Zinc Finger Protein 69 specifically.
Sequence table
(1) general information:
(ⅱ) denomination of invention: Novel Human Zinc Finger Protein 69 and encoding sequence thereof
(ⅲ) sequence number: 7
(2) information of SEQ ID NO:1:
(ⅰ) sequence signature:
(A) length: 2550bp
(B) type: nucleic acid
(C) chain: two strands
(D) topological framework: linearity
(ⅱ) molecule type: cDNA
( ⅹⅰ ) :SEQ ID NO:1: 1 TCAAGAGAAGACTGTGCAACCCAATTTGAGACCTAGATCAACATTCCCAAAATGGGGGCC 61 TGGTGGGAAAGCTTGTGTCTGATTCTGCCTTCCTTAAGAAGTGCCACACCTCTGCGATCA121 ACTCTGTACAGCTTAGTTAACTGGGGCTTGAATTCCACTGTTCTCCAAATTTTGTTTGAG181 GGTGTTTGTAGCACAGTTTGGAAGCTGAAATGAAGGGACAGGAAGGTTTATTAATGTATG241 TCATTGAGAACACTAAAGCCTCCTTTTCTCCTCTCTGGATTTTCTAGCTTTTGAACTTCT301 CAGATAGAGGAACCCCAGTGAAGACTGATCAGTTCTTACAGTTCTCAAAGCATGGCCCAT 361 AAATATGTGGGTTTGCAGTATCACGGATCAGTGACATTTGAGGATGTGGCCATAGCCTTC 421 TTCCAGCAGGAGTGGGAGAGTCTGGACTCTTCCCAGAGGGGCTTGTACAGAGATGTGATG 481 TTGGAGAACTACAGGAACTTGGTGTCAATGGCAGGACATTCCCGTTCTAAACCACATGTG 541 ATCGCCTTATTGGAACAATGGAAAGAGCCTGAAGTGACAGTGAGGAAAGATGGAAGAAGA 601 TGGTGCACAGATTTGCAGTTGGAAGATGATACAATCGGCTGTAAAGAAATGCCCACCTCT 661 GAAAACTGTCCATCTTTTGCTCTACATCAGAAAATAAGTAGACAGAAACCACGTGAATGT 721 CGGGAATATGGAAAGACCCTTTGTCAAGACTCAAAGCCTGTTCAACATGAAAGAATACAT 781 AGTAGTGAAAAACCCAACAGATGTAAAGAATGTGGGAAGAACTTTAGTAATGGACATCAA 841 CTCACCATACATCAGAGATTGCATGTTGGTGAGAAACCCTATAAATATGAAAAATGTGGG 901 AAGGCCTTTATCAGTGGCTCAGCCTTTGTTAAGCATGGGAGAATTCACACTGGTGAGAAG 961 CCACTCAAATGTAAGCAATGTGGAAAGACTATTAGCGGTAGCTATCAACTTACAGTACAT1021 AAGAGTATTCATACTGGGAAGAAACCATATGAGTGCGGGGAATGTGGGAAAGCTTTTCTA1081 GTATATGGAAAGCTTACCCGGCATCAGAGTACTCACACTGGTGAAAAACCCTTTGGGTGT1141 GAGGAGTGTGGGAAGGCCTTCAGTACCTTTTCATACCTGGTTCAACATCAGCGAATTCAT1201 ACCAGTGAAAAACCTTACGAATGCAAAGAATGTGGGAAGGCCTTTAGCACTAGCTCACCC1261 CTTGCTAAGCATCAGAGAATTCATACTGGCGAGAAACCCTATGAATGTAAGGAGTGTGGG1321 AAGTCCTTCACTGTGTATGGACAGCTTACTCGACATCAGAGTATTCATACTGGTGAGAAA1381 CCTTTTGAATGTAAGGAATGTGGAAAGGCCTTTAGACTTAGTTCCTTCCTTCATGCACAT1441 CAGCGAATTCATGCAGAGATAAAGCCCTACGGATGCAAGGAATGCGGGAAAACCTTCAGT1501 CGTGCCTCATATCTTGTTCAACATGGAAGACTTCACACTGGCGAGAAGCCCTGTGAATGT1561 AAGGAGTGTGGCAAGGCCTTTAGTACTGGCTCATACCTTGTTCAGCGTCAGAGGATCCAT1621 ACTGGGGAGAAACCCTATGAATGTAAGGAATGTGGCAAAGCCTTTATTAGTCGCCATCAG1681 CTTACCGTACATCAAAGGGTTCATACTGGAGAGAAACCCTATGAGTGTAAGGAATGTGGC1741 AAGGCCTTCAGAGTGCACGTACATCTCACACAGCATCGGAAAATTCATACTGATGTAAAG1801 CCCTATGAATGTAAGGAATGTGGAAAGACTTTTAGTCGAGCCTCGTACCTTGTACAACAT1861 AGCAGAATCCATACTGGTAAGAAGCCCTATGAGTGTAAGGAGTGTGGCAAGGCCTTCAGT1921 TCTGGCTCATACCTTGTTCAGCATCAAAGAATTCATACTGGGGAGAAACCCTATGAATGT1981 AACAAATGTGGGAAAGCCTTTACTGTTTATGGACAACTTATTGGACATCAGAGTGTTCAC2041 ACTGGTGAGAAACCTTTTGAATGTAAGGAATGCGGGAAGGCCTTTAGACTTAATTCATTC2101 CTTACTGAACATCAGCGGGTACACACTGGTGAGAAACCCTTTAAATGCAAAAAATGTGGG2161 AAGACCTTTAGATACAGTTCAGCCCTTAAAGTGCATCTGAGAAAACATATGAGTGTTATA2221 CCCTAAGAGTCTGAGGAGTGTGGGAAGTGCTTCGTGTGTGGCTCAAACATTGTTGAACAT2281 CGGGGAATTTATGCTGGTAGGAAACTTTCAAATGTGAAGAATATTGGCAGGTCTATTCTC2341 ATCTTATAATTCATAATATAACTCAGAAAACATAAGAATATTCCTTTGTCATTTATAGGT2401 TTGTAATACCAATATTTATACTGGTGGACCATTCAGAAAAAGTGGGAAACGTTATTACTT2461 AATGGTTACAGCACTGACAGCATGAACTTTTATATGATGCATTTATTCTAATGTGATTGT2521 ATGAACAAGTGAATAAAAAACCTTGGACCT
(3) information of SEQ ID NO:2:
(ⅰ) sequence signature:
(A) length: 624 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ⅱ) molecule type: polypeptide
( ⅹⅰ ) :SEQ ID NO:2: 1 Met Ala His Lys Tyr Val Gly Leu Gln Tyr His Gly Ser Val Thr 16 Phe Glu Asp Val Ala Ile Ala Phe Phe Gln Gln Glu Trp Glu Ser 31 Leu Asp Ser Ser Gln Arg Gly Leu Tyr Arg Asp Val Met Leu Glu 46 Asn Tyr Arg Asn Leu Val Ser Met Ala Gly His Ser Arg Ser Lys 61 Pro His Val Ile Ala Leu Leu Glu Gln Trp Lys Glu Pro Glu Val 76 Thr Val Arg Lys Asp Gly Arg Arg Trp Cys Thr Asp Leu Gln Leu 91 Glu Asp Asp Thr Ile Gly Cys Lys Glu Met Pro Thr Ser Glu Asn106 Cys Pro Ser Phe Ala Leu His Gln Lys Ile Ser Arg Gln Lys Pro121 Arg Glu Cys Arg Glu Tyr Gly Lys Thr Leu Cys Gln Asp Ser Lys136 Pro Val Gln His Glu Arg lle His Ser Ser Glu Lys Pro Asn Arg151 Cys Lys Glu Cys Gly Lys Asn Phe Ser Asn Gly His Gln Leu Thr166 Ile His Gln Arg Leu His Val Gly Glu Lys Pro Tyr Lys Tyr Glu181 Lys Cys Gly Lys Ala Phe Ile Ser Gly Ser Ala Phe Val Lys His196 Gly Arg Ile His Thr Gly Glu Lys Pro Leu Lys Cys Lys Gln Cys211 Gly Lys Thr Ile Ser Gly Ser Tyr Gln Leu Thr Val His Lys Ser226 Ile His Thr Gly Lys Lys Pro Tyr Glu Cys Gly Glu Cys Gly Lys241 Ala Phe Leu Val Tyr Gly Lys Leu Thr Arg His Gln Ser Thr His256 Thr Gly Glu Lys Pro Phe Gly Cys Glu Glu Cys Gly Lys Ala Phe271 Ser Thr Phe Ser Tyr Leu Val Gln His Gln Arg Ile His Thr Ser286 Glu Lys Pro Tyr Glu Cys Lys Glu Cys Gly Lys Ala Phe Ser Thr301 Ser Ser Pro Leu Ala Lys His Gln Arg Ile His Thr Gly Glu Lys316 Pro Tyr Glu Cys Lys Glu Cys Gly Lys Ser Phe Thr Val Tyr Gly331 Gln Leu Thr Arg His Gln Ser Ile His Thr Gly Glu Lys Pro Phe346 Glu Cys Lys Glu Cys Gly Lys Ala Phe Arg Leu Ser Ser Phe Leu361 His Ala His Gln Arg Ile His Ala Glu Ile Lys Pro Tyr Gly Cys376 Lys Glu Cys Gly Lys Thr Phe Ser Arg Ala Ser Tyr Leu Val Gln391 His Gly Arg Leu His Thr Gly Glu Lys Pro Cys Glu Cys Lys Glu406 Cys Gly Lys Ala Phe Ser Thr Gly Ser Tyr Leu Val Gln Arg Gln421 Arg Ile His Thr Gly Glu Lys Pro Tyr Glu Cys Lys Glu Cys Gly436 Lys Ala Phe Ile Ser Arg His Gln Leu Thr Val His Gln Arg Val451 His Thr Gly Glu Lys Pro Tyr Glu Cys Lys Glu Cys Gly Lys Ala466 Phe Arg Val His Val His Leu Thr Gln His Arg Lys Ile His Thr481 Asp Val Lys Pro Tyr Glu Cys Lys Glu Cys Gly Lys Thr Phe Ser496 Arg Ala Ser Tyr Leu Val Gln His Ser Arg Ile His Thr Gly Lys511 Lys Pro Tyr Glu Cys Lys Glu Cys Gly Lys Ala Phe Ser Ser Gly526 Ser Tyr Leu Val Gln His Gln Arg Ile His Thr Gly Glu Lys Pro541 Tyr Glu Cys Asn Lys Cys Gly Lys Ala Phe Thr Val Tyr Gly Gln556 Leu Ile Gly His Gln Ser Val His Thr Gly Glu Lys Pro Phe Glu571 Cys Lys Glu Cys Gly Lys Ala Phe Arg Leu Asn Ser Phe Leu Thr586 Glu His Gln Arg Val His Thr Gly Glu Lys Pro Phe Lys Cys Lys601 Lys Cys Gly Lys Thr Phe Arg Tyr Ser Ser Ala Leu Lys Val His616 Leu Arg Lys His Met Sar Val Ile Pro
(4) information of SEQ ID NO:3
(ⅰ) sequence signature
(A) length: 24 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: SEQ ID NO:3:TCAAGAGAAGACTGTGCAACCCAA 24
(5) information of SEQ ID NO:4
(ⅰ) sequence signature
(A) length: 24 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: SEQ ID NO:4:AGGTCCAAGGTTTTTTATTCACTT 24
(6) information of SEQ ID NO:5
(ⅰ) sequence signature
(A) length: 32 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: SEQ ID NO:5:CAGCCATGGCGGGGAAGAAGAATGTTCTGTCG 32
(7) information of SEQ ID NO:6
(ⅰ) sequence signature
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: SEQ ID NO:6:CCCGGATCCCGCTGCTTGGCCTTCTTCAC 29
(8) information of SEQ ID NO:7:
(ⅰ) sequence signature:
(A) length: 15 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ⅱ) molecule type: polypeptide
(ⅹ ⅰ) sequence description: SEQ ID NO:7:Met-Ala-Gly-Lys-Lys-Asn-Val-Leu-Ser-Ser-Leu-Ala-Val-Tyr-Ala 15

Claims (18)

1, a kind of isolated polypeptide-Novel Human Zinc Finger Protein 69 is characterized in that it includes: the polypeptide of the aminoacid sequence shown in the SEQ ID NO:2 or active fragments, analogue or the derivative of its polypeptide.
2, polypeptide as claimed in claim 1, the aminoacid sequence that it is characterized in that described polypeptide, analogue or derivative has the homogeny with the aminoacid sequence at least 95% shown in the SEQ ID NO:2.
3, polypeptide as claimed in claim 2 is characterized in that it comprises the polypeptide with the aminoacid sequence shown in the SEQ ID NO:2.
4, a kind of isolating polynucleotide, it is characterized in that described polynucleotide comprise be selected from down the group in a kind of:
(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2 or its fragment, analogue, derivative;
(b) with polynucleotide (a) complementary polynucleotide; Or
(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.
5, polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise the polynucleotide that coding has aminoacid sequence shown in the SEQID NO:2.
6, polynucleotide as claimed in claim 4, the sequence that it is characterized in that described polynucleotide include the sequence of 1-2550 position among the sequence of 352-2226 position among the SEQ IDNO:1 or the SEQ ID NO:1.
7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that it is the recombinant vectors that is formed by the described polynucleotide of arbitrary claim among the claim 4-6 and plasmid, virus or vehicle expression vector establishment.
8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell:
(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or
(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.
9, a kind of preparation method with Novel Human Zinc Finger Protein 69 active polypeptide is characterized in that described method comprises: (a) under expressing human zinc finger protein 69 conditions, cultivate the described through engineering approaches host cell of claim 8; (b) from culture, isolate and have Novel Human Zinc Finger Protein 69 active polypeptide.
10, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with Novel Human Zinc Finger Protein 69 specificity bonded antibody.
11, the compound of an analoglike or adjusting polypeptide active or expression is characterized in that they are simulation, promotion, antagonism or the active compound that suppresses Novel Human Zinc Finger Protein 69.
12, compound as claimed in claim 11 is characterized in that it is the polynucleotide sequence shown in the SEQ ID NO:1 or its segmental antisense sequences.
13, the described application of compound of a kind of claim 11, it is characterized in that described compound be used for mediator's zinc finger protein 69 in vivo, the method for external activity.
14, a kind of disease relevant or method of disease susceptibility of detecting with the described polypeptide of arbitrary claim among the claim 1-3, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide, perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.
15, as the application of polypeptide as described in the arbitrary claim among the claim 1-3, it is characterized in that it is applied to screen the stand-in of Novel Human Zinc Finger Protein 69, agonist, antagonist or inhibitor; Perhaps be used for the peptide finger print identification.
16, as the application of the described nucleic acid molecule of arbitrary claim among the claim 4-6, it is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps be used for hybridization, perhaps be used to make gene chip or microarray as probe.
17,, it is characterized in that forming pharmaceutical composition with safe and effective dosage and pharmaceutically acceptable carrier as the relevant unusually disease of diagnosis or treatment and Novel Human Zinc Finger Protein 69 with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor as the described polypeptide of arbitrary claim, polynucleotide or application of compound in claim 1-6 and 11.
18, the described polypeptide of arbitrary claim, polynucleotide or the application of compound among the claim 1-6 and 11, it is characterized in that being used for the treatment of as malignant tumour with described polypeptide, polynucleotide or compound, hemopathy, the medicine of HIV infection and immunological disease and all kinds of inflammation.
CN99124128A 1999-11-26 1999-11-26 Human zinc-finger protein 69 as one new kind of polypeptide and polynucleotides encoding this polypeptide Pending CN1297919A (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN99124128A CN1297919A (en) 1999-11-26 1999-11-26 Human zinc-finger protein 69 as one new kind of polypeptide and polynucleotides encoding this polypeptide
AU15091/01A AU1509101A (en) 1999-11-26 2000-11-20 A new polypeptide-zinc finger protein 69 and the polynucleotide encoding it
PCT/CN2000/000445 WO2001038378A1 (en) 1999-11-26 2000-11-20 A new polypeptide-zinc finger protein 69 and the polynucleotide encoding it

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN99124128A CN1297919A (en) 1999-11-26 1999-11-26 Human zinc-finger protein 69 as one new kind of polypeptide and polynucleotides encoding this polypeptide

Publications (1)

Publication Number Publication Date
CN1297919A true CN1297919A (en) 2001-06-06

Family

ID=5283221

Family Applications (1)

Application Number Title Priority Date Filing Date
CN99124128A Pending CN1297919A (en) 1999-11-26 1999-11-26 Human zinc-finger protein 69 as one new kind of polypeptide and polynucleotides encoding this polypeptide

Country Status (3)

Country Link
CN (1) CN1297919A (en)
AU (1) AU1509101A (en)
WO (1) WO2001038378A1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994003599A1 (en) * 1992-08-04 1994-02-17 Sagami Chemical Research Center HUMAN cDNA AND PROTEIN WHICH SAID cDNA CODES FOR
WO1999021991A1 (en) * 1997-10-29 1999-05-06 Shanghai Second Medical University Bmzf12: a zinc finger gene cloned from bone marrow

Also Published As

Publication number Publication date
AU1509101A (en) 2001-06-04
WO2001038378A1 (en) 2001-05-31

Similar Documents

Publication Publication Date Title
CN1296967A (en) Polypeptide-human deaf related gene 14 and polynucleotide for coding said polypeptide
CN1297916A (en) Human bromo structure domain-containing protein 95 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1296974A (en) Polypeptide-human histone H2A.21 and polynucleotide for coding said polypeptide
CN1297914A (en) Human zinc-finger protein 58 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1297902A (en) Human reticulin 80 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1296975A (en) Polypeptide-human ribosomal protein L23 and polynucleotide for coding said polypeptide
CN1297919A (en) Human zinc-finger protein 69 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1297907A (en) Human acetylglactoside transferase 45 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1297917A (en) Human zinc-finger protein 38 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1297905A (en) Human ribosomal protein L14.22 as one new kind of polypeptide and polynuceotides encoding this polypeptide
CN1297904A (en) Human cytokinin inducing-gene expressing protein 25 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1296976A (en) Polypeptide-human epidermal growth factor receptor protein 25 and polynucleotide for coding said polypeptide
CN1297920A (en) Human zinc-finger protein 44 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1303930A (en) Novel polypeptide-zinc finger protein 57 and polynucleotide coding said polypeptide
CN1297929A (en) Human zinc-finger protein 60 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1297931A (en) Human ABC transfer protein 39 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1470520A (en) Polypeptide-zine finger protein 40 and polynucleotide encoding this polypeptide
CN1296952A (en) Polypeptide-complement receptor 222 and polynucleotide for coding said polypeptide
CN1297915A (en) Human zinc-finger protein 46 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1296957A (en) Polypeptide-murine tricarboxylic acid vector 39 and polynucleotide for coding said polypeptide
CN1297903A (en) Human zinc-finger protein 70 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1298002A (en) Human dihydropyrrole-5-carboxylate reductase 30 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1296966A (en) Polypeptide-human SR splicing factor 52 and polynucleotide for coding said polypeptide
CN1297918A (en) Human transcription termination factor binding protein 54 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1297912A (en) Human zinc-finger protein 35 as one new kind of polypeptide and polynucleotides encoding this polypeptide

Legal Events

Date Code Title Description
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C06 Publication
PB01 Publication
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication