CN1293207A - Fusion protein with improved combining activity to target cell receptor - Google Patents

Abstract

A fusion protein preparey by linking the recombination toxin derivated by pseudomonads with cell factor is disclosed. Especially, the cell factor as piloting part is modified by recombination DNA technique to increase the target cell receptor bind activity of chimeric toxin generated by partial fusion of toxin. The composite medicine containing said fusion protein and the application of said medicine in treating tumor are also disclosed.

Description

Improved receptor in target cell in conjunction with active fused protein

The present invention relates to out the fused protein that pseudomonas deutero-recombinant toxin and cytokine are formed by connecting, particularly relate to the cytokine of recombinant DNA technology modification as targeting part, the receptor in target cell that merges the fused protein that is produced with raising and toxin moiety combines activity.

Harmful cell [Pastan et al., the Cell 47:641 (1986) that can use the toxin that is connected on somatomedin, cytokine, antibody, hormone and other cell guide molecules to kill and wound to carry specific receptors; Vitetta et al., Science 238:1098 (1987)].Can make the toxin of various kinds of cell or plant origin or intracellular toxin as cytotoxic agent, but wherein use the most extensively and tool DEVELOPMENT PROSPECT be by pseudomonas aeruginosa (Pseudomonas aeruginosa) excretory ETA (PE).After known PE entered eukaryotic cell, the inactivation elongation factor (EF-2) by the ribosylation of ADP in the catalysis cell, and then the protein synthesis in the inhibition eukaryotic cell caused necrocytosis.

X-ray crystallography research and mutation analysis prove, the PE molecule include three with produce the relevant structural area of cytotoxicity: be responsible for sensitive cells bonded N-terminal receptor binding domain (I district), be responsible for making toxin and molecule to insert to the interior middle transposition district (II district) of cytosol, and responsible inactivation target cell protein and the C-terminal enzymatic activity district (III district) that causes necrocytosis.Wherein the I district comprises mediated cell bonded I a district (amino acid/11-252) and the present I b district (amino acid 365-399) of not understanding its function fully.Mutation analysis to the I district shows the 57th Methionin (Lys ⁵⁷) in receptors bind, play an important role, and show Glu ⁵⁵³, Tyr ⁴⁸¹And His ⁶²⁶To the ADP ribosylation activity is indispensable.Studies show that some part in II district keeps cytotoxicity to the PE molecule and has vital role.Deleted I a district for the non-specific cell of eliminating the PE molecule in conjunction with active, the part EP molecule that keeps transposition and ADP ribosylation function simultaneously is called PE40 (the about 40KDa of molecular weight).

In recent years, the basic and applied research about chimeric toxin mainly concentrates on the PE molecule.The investigator attempts by to the variant functional zone of PE molecule or indivedual amino acid whose deletion or replace the non-special toxicity that reduces lps molecule, raising to the special toxicity of target cell, improve the receptor-binding activity of molecule and to the internalization ability of target cell, and reduce the immunogenicity of chimeric toxin or insert different identification molecules.For example, United States Patent (USP) 5,705,163 theme relate to the effect of carboxyl terminal in its cytotoxic activity of PE molecule, and the specific region that is suitable for being inserted as the required identification molecule (guide molecule) of selective killing target cell on the PE molecule C-terminal; United States Patent (USP) 5,821,238 disclose aminoterminal 1 to 28 amino acid (for example amino acid 364 is directly connected to the modified PE on the residue 381) in disappearance II district, thereby have significantly improved the PE to the Cytotoxic modification of target cell.United States Patent (USP) 5,621,078 discloses with two halfcystines on the L-Ala replacement residue 265 and 287; Perhaps with four halfcystines on the L-Ala replacement residue 265,287,372 and 379, with the PE molecule of the modification that obtains having changed biologic activity (comprise and improved cell killing activity and reduced receptor-binding activity) (also referring to european patent application 6,383,599).

Yet one can not be ignored but not cause that at present question of common concern is, more effectively combines with the target cell surface receptor in order to make chimeric molecule, and it must have suitable space conformation.This suitably conformation not only depends on the toxin moiety of chimeric molecule, and is subjected to the influence of guiding (or target-seeking) part to a great extent.After two meromixis, when forming new 2 and 3 dimensional organization, targeting part should have enough part conjugated groups to be exposed to acceptor molecule, and combination stably with it.Particularly deleted the situation of the PE40 in receptor binding domain (I a district) as toxin moiety in use, it is particularly important that this point just seems.The inventor is on the basis of the IL6-PE fused protein that has successfully made up cytokine 6 (IL-6) acceptor that optionally kills and wounds expression, attempt further the IL6 molecule to be carried out necessary modification, and then it is coupled to same through on the PE40 molecule of modifying.The result is surprisingly found out that IL6-PE40 compares with unmodified, and the fused protein that makes behind the modified IL-6 has improved its receptor-binding activity and greatly to the cytotoxic activity of the target cell of carrying the IL-6 acceptor, thereby has successfully finished the present invention.

An object of the present invention is to provide and comprise the fused protein that is connected to the IL-6 on the cytotoxic protein matter, be characterised in that wherein N-terminal as the IL-6 of targeting part maximum surpass 28 amino acid whose disappearances.

The preferred embodiment of this purpose according to the present invention, wherein said IL-6 has lacked 22 amino acid whose IL-6 of N-terminal.

The preferred embodiment of this purpose according to the present invention, wherein said cytotoxic protein matter is PE40.

Another object of the present invention provides the IL-6-PE40 fused protein that contains above-mentioned modification and the pharmaceutical composition of one or more pharmaceutically acceptable carriers or vehicle.

This purpose particularly preferred embodiment according to the present invention, the IL-6 as targeting part in the wherein said IL-6-PE40 fused protein molecule is the IL-6 that has lacked 22 amino acid whose modifications of N-terminal.

A further object of the present invention relates to the application of the IL-6-PE40 fused protein of the modification that makes by method of the present invention as antineoplastic agent.

Fig. 1 shows the structure of the recombinant plasmid pKIL6P40 be used to express IL6 (△ 1-22)-PE40.

Fig. 2 shows the protein synthesis restraining effect of IL6 (△ 1-22)-PE40 to the tumor cell line of various cultivations; ●-●, the SP2/0 cell; ▲-▲, the HepG2 cell; ■-■, the HL-60 cell; ※-※, the Hep2 cell; Zero, the L929 cell; △, the K562 cell; , the HeLa cell.

Fig. 3 shows that IL6 (△ 1-22)-PE40 and not modified IL6-PE40 chimeric toxin are to the inhibiting comparison of the protein synthesis of SP2/0 clone.The result is to represent with respect to the percent inhibition of the negative control group that does not add chimeric toxin.●-●，IL6(△1-22)-PE40；△-△，IL6-PE40。

The IL6 of Fig. 4 display part purifying (△ 1-22)-PE40 pair membrane-bound with the SP2/0 cytoplasm ¹²⁵The displacement of I-IL6.○，IL6(△1-22)-PE40；●，IL6-PE40。

The influence that the IL6-PE40 that Fig. 5 shows IL6 (△ the 1-22)-PE40 of purifying and unmodified generates the BALB/c mouse in-vivo tumour of inoculation tumour cell (SP2/0 clone).The result represents to treat after 10 days the percentage ratio of mice with tumor.Interlacing line is represented IL6 (△ 1-22)-PE40 with square frame; Vertical curve Nogata frame is represented IL6-PE40.

The target cell specific chimeric toxin that the present invention relates to improve particularly relates to by modifying said embedding The targeting part that closes in the lps molecule reaches with the binding specificity that improves said chimeric toxin and receptor in target cell Stability. As a representative instance, the present invention specifically described comprise by the receptor binding moiety of IL-6 and The fused protein that the active region of PE forms, contains basically pure said fusion egg at its preparation method The pharmaceutical composition of white matter, and the application of said pharmaceutical composition in the control growth of tumour cell.

Human interleukin (IL-6) is a kind of multi-functional cytokine that the normal mammalian cell produces, It has the function that stimulates polytype Cell Differentiation and growth. The people IL-6 of known maturation is by 184 ammonia Base acid forms, and the molecules of ammonia cardinal extremity mainly is the BA district, and carboxyl terminal mainly is receptor binding domain, and two The zone forms antiparallel A, B, four helical bundles of C, D. Confirmed that natural IL-6 lacks 1-28 Amino acids is to the not obviously impact of BA of molecule integral body. But as disappearance Arg³¹Or Asp³⁵Then can Make its activity reduce respectively 50 and 10,000 times. According to the hydrophobicity of people and mouse IL-6 prototype structure and with Source property is relatively inferred residue Glu²⁹-Leu ³⁴Though not the active site of molecule, they and carboxyl terminal shape Become a hydrophobic center, to correct folding the playing an important role of molecule. Someone proves disappearance Glu²⁹Can make life Thing is learned about 500 times of activity decreased (Brakenoff, et al., J.Immunol.145:561,1990). Yet, both Make disappearance to the 49th Asn residue, still do not lose the receptor-binding activity of molecule, and known wherein the 29 to 34 amino acids residues be consist of the IL-6 active structure face the zone that is situated between (Brakenoff, J.Immunol., 143:1175,1989). From three-D space structure, 31 and 35 residues and 118 The receptor binding site that forms with 121 residues spatially just with the site of 157-160 position residue formation Be in two rightabouts, they on both direction in conjunction with two receptor subunits gp130. 31+35 wherein The position residue is in the A spiral, and 118 and 121 residues are in the C spiral, and changing these four residues will lead Causing molecule can not be combined with gp130, and then forfeiture BA (Kishimoto, Blood.74:1,1989).

On the other hand, known interleukin-6 receptor (IL-6R) is by IL-6 receptor binding protein (gp80) And two subunits of signal transducer (gp130) form. Wherein, gp80 is responsible for the knot with ligand i L-6 Close and subsequently with the coupling of gp130 subunit, therefore gp130 then mainly participates in signal transduction, usually gp80 is claimed Be IL-6R. IL-6R is distributed on lymphocyte and the polytype non-lymphocyte, but IL-6 on the tumour cell The number of R than the high 2-20 of non-tumor cell (comprising lymphocyte) doubly (as referring to Yawata et al., EMBD J.12:1705,1993).

When some tumours take place, the change of unusual and its affinity of often expressing with IL-6R. For example, Have high-caliber HL-6 and solubility IL-6R in known myelomatosis multiplex people's the blood plasma. Now demonstrate,prove Bright, the high level expression of IL-6R is one of important step of bringing out myeloma. In addition, find the liver of cultivation Cancerous cell line (HepG2), HL-60 (HL-6), prostate cancer cell line (PC-3) etc. Tumor cell line is all with high level expression IL-6R. These expressions are equivalent to same just tissue-derived approximately The 5-200 of normal cell doubly. And wherein the number of high-affinity receptor accounts for total acceptor number purpose 10%, high, The KD value of low-affinity receptor differs about 100 times.

Based on above-mentioned basic research and clinical analysis, we determine to use 22 of amino terminal disappearances amino acid whose IL-6[is IL-6 (△ 1-22)] as carrier or the targeting part of PE molecule, with the complete PE molecule of disappearance it The PE40 in Ia district (as toxin moiety) merges, with the chimeric toxin IL-of preparation tumour cell target-specific 6 (△ 1-22)-PE40. With regard to the connected mode of IL-6 and PE40, although have the people proved IL6-PE40, In three kinds of resultant fused proteins of connected mode of IL6-PE40-PE40 and PE40-IL6-PE40 with IL6-PE40 Cytotoxicity be the strongest (Siegall, C.B.et al., J.Biol.Chem.265:16318,1990), but Consider receptor binding capacity, efficient and specificity, molecular size and the immunogenicity of chimeric toxin, and The composite factors such as the cell-penetrating ability of fused protein are particularly considered the Clinical practicability that it is potential, The inventor determines have the IL-6-PE40 combination of minimum LD50 value to prepare chimeric poison of the present invention with performance Plain.

Can according to recombinant DNA technology well known by persons skilled in the art (for example referring to Sambrook et al., Molecula Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, 2th Ed., 1989) finish various operations. At first, available suitable endonuclease is from carrying the PE40 gene Cut out the nucleotide fragments of coding PE40 toxin among initial plasmid such as the pVC8, and with same endonuclease From plasmid pBluescript, cut out bigger carrier segments. Then lower in the existence of T4 dna ligase, will The PE40 genetic fragment is connected on the carrier pBluescript. After enzyme is cut evaluation, obtain carrying the PE40 base Interstitial granules pBluescript-PE40 in the restructuring of cause.

Then in the presence of four kinds of deoxynucleoside triphosphates, use the synthetic Oligonucleolide primers, and with pUC19-IL-6 cDNA as template, through PCR reaction amplification N-terminal disappearance 22 amino acid whose IL-6 (△ 1-22).

Under the standard reaction condition, will carry out ligation with the middle interstitial granules that carries the PE40 gene of same endonuclease double digestion with the IL-6 gene of N end brachymemma.Behind the ligation mixture conversion of gained suitable Bacillus coli cells and insulation, select the antibiotics resistance bacterium colony and cut evaluation being carried out enzyme by the conversion plasmid DNA that bacterial strain comprised.Select to connect correct recombinant plasmid and carry out dna sequence analysis.

With the recombinant plasmid that the cutting of suitable restriction endonuclease as above obtains, the dna sequence dna that will comprise PE40 and IL-6 (△ 1-22) nucleotide coding sequence then and have a suitable restriction enzyme site is connected among the plasmid vector pKK-223-3.After further enzyme is cut evaluation, obtain recombinant expression plasmid pKIL6P40 with high level expression IL-6 of the present invention (△ 1-22)-PE40 fused protein.Fig. 1 has shown the construction strategy of recombinant expression plasmid pKIL6P40.

Transform suitable e. coli host cell with the recombinant expression plasmid pKIL6P40 that as above obtains, and be suitable for expressing under the condition of required fused protein, cultivate by transformant.Cultivate the back results and through the supersound process smudge cells.Super centrifugal collection inclusion body is also handled through sex change and renaturation in suitable damping fluid, and ultracentrifugation and collect supernatant liquor once more obtains this supernatant liquor after to the phosphate buffered saline (PBS) dialysis crude extract of IL-6 (△ 1-22)-PE40 fused protein.

Available cytotoxicity detection method detects crude extract or the cytotoxic activity of the partially purified fused protein that obtains behind ion-exchange and gel permeation chromatography.Use the protein example of sodium dodecyl sulfate-polyacrylamide gel electrophoresis method (SDS-PAGE) and Western blotting monitoring wash-out in the partial purification process.

Because fused protein mainly accumulates in the insoluble part of cell with the inclusion body form, thereby helps by sex change and renaturation partial purification recombinant protein to insoluble part.

Partially purified part enrichment IL-6 (△ 1-22)-PE40 fused protein, so can make us can detect its cell in vitro cytotoxic activity.Behind further ion-exchange and gel-filtration purifying, the purity of protein reaches 96% approximately.Analyze the eluted product of each purification step through SDS-PAGE, be shown in a master tape that is equivalent to the 59KD molecular size.Further confirm these data with the immunoblotting assay that radiolabeled PE40 did.

Available four fundamental tests are identified the character of the hybrid molecule that is formed by connecting by IL-6 and PE40: the test of (1) ADP ribosylation: be used for detecting the enzymatic activity that suppresses mammalian proteins matter synthetic IL-6 (△ 1-22)-PE40; (2) competitive in conjunction with inhibition test: as to detect the restraining effect of hybrid molecule, so as to estimating the IL-6 receptor-binding activity of IL-6 (△ 1-22)-PE40 to the IL-6 that is incorporated into the radio-labeled on the IL-6 acceptor of mouse myeloma SP2/0 cytolemma vesica surface; (3) cell toxicity test: detect the cytotoxic activity of IL-6 (△ 1-22)-PE40 to various primary cultures and clone; (4) anti-tumor in vivo activity test: the anti-tumor in vivo activity of estimating IL-6 (△ 1-22)-PE40 with the living Animal Models of inoculation myeloma cell line.Use in all tests by with the not modified IL6-PE40 of quadrat method preparation and under similarity condition, express and the PE40 that extracts in contrast.

By detecting the cytotoxic activity that the protein synthesis restraining effect comes IL-6 (△ the 1-22)-PE40 of estimating part purifying to different malignant proliferating cells to be.Found that fused protein of the present invention can rely on the mode killer cell with dosage, and has than big-difference between different clones.By table 1 and result shown in Figure 2 as can be seen, the cytotoxicity power of several tumor cell lines performances that IL6 of the present invention (△ 1-22)-PE40 fusion rotein confrontation is tested is successively: myelomatosis SP2/0 clone, liver gland cancer HepG2 clone, acute myeloid leukemia HL-60 clone, laryngocarcinoma Hep2 clone.The amount that causes IL-6 (△ the 1-22)-PE40 of 50% necrocytosis is followed successively by 0.3,0.7,0.9,1.3 μ g gross protein/holes (table 1).These experimental results show that also fusion rotein confrontation fibroma L929 clone of the present invention is relative much smaller with the cytotoxicity of cervical cancer HeLa clone.In addition, though acute myeloid leukemia cell (HL-60) to IL-6 (△ 1-22)-ten fens sensitivities of PE40, the toxic action of fusion rotein confrontation chronic leukemia clone (K562) is then obviously less under same concentrations.These the possibility of result are relevant with the IL-6 acceptor number of some tumor cell surface, and point out the different steps of growing in tumour, and the number of its cell surface receptor, distribution and receptor-ligand affinity may change to some extent.Therefore, in clinical practice, according to the cell of tumour that patient suffers from source and character, and based on the vitro cytotoxicity and the sensitivity test of necessity, it will be crucial pre-determining whether patient be suitable for using fused protein of the present invention and select suitable dosage.

Table 2 and Fig. 4 show IL-6 of the present invention (△ 1-22)-PE40 and IL-6 receptor-binding activity and cytotoxicity (ID as the IL6-PE40 fusion rotein confrontation SP2/0 myeloma cell line of positive control ₅₀) comparison.These results clearly illustrate that, compare with the IL-6-PE40 fused protein of targeting part not being modified, IL-6 of the present invention (△ 1-22)-PE40 has improved interleukin-6 receptor bonded ability on radiolabeled interleukin-6 of inhibition and the SP2/0 cytolemma significantly, and has improved it and killed and wounded the ability of SP2/0 cell.Generally speaking, as if these results further point out IL-6 (△ 1-22)-PE40 to have better target-specific and cytotoxic activity than not modified IL-6-PE40.

Treatment experiment to the laboratory animal of carrying the tumour transplatation thing will provide more direct evidence for the cytotoxicity and the clinical applicability of IL-6 of the present invention (△ 1-22)-PE40 chimeric toxin.From result shown in Figure 5 as can be seen, 36 hours chimeric toxin processing mouse behind the inoculation SP2/0 cell in mouse peritoneal with modification, as seen IL-6-PE40 and IL-6 of the present invention (△ 1-22)-PE40 all stops tumour to be grown in dosage dependence mode, high dosage (40ng/ days/mouse) group is efficient to be respectively 80% and 90%, and low dose group (20ng/ days/mouse) is efficient to be respectively 60% and 70%.On the contrary, only accept the control group of IL-6 and PBS, then have respectively in 70% and 80% the mouse peritoneal macroscopic noumenal tumour to have occurred.In-vivo tumour generate to suppress in the experiment IL-6 of the present invention (△ 1-22)-PE40 and the comparative studies of not modified IL-6-PE40 fused protein have further been proved the result of above-mentioned experiment in vitro.

Suppress in the experiment at external and in-vivo tumour IL-6 (△ 1-22)-PE40 and IL-6-PE40, the reason that this significant difference occurs is many-sided, but our supposition may be owing to preceding 22 amino acid of having deleted in the IL-6 molecule, thereby improved the receptors bind efficient of chimeric toxin, more helped the cutting of intracellular protease after having reduced the sterically hindered and molecular folding that toxin enters cell PE40.

Can be with IL-6 of the present invention (△ 1-22)-chimeric holotoxin of PE40 as the primary activity composition, and add one or more pharmaceutically acceptable carrier or vehicle, make the pharmaceutical composition that is suitable for being used for clinically the oncotherapy purpose.Wherein said carrier or vehicle comprise but be not only limited to phosphate buffered saline (PBS), physiological saline, etc. ooze glucose solution, dextran, lactose and dextran etc.According to the difference of tumor type of being treated and disease severity, can add one or more and chimeric toxin of the present invention in pharmaceutical composition of the present invention has auxiliary or synergistic other active compounds natural, synthetic or recombinant sources.In addition, can in pharmaceutical composition of the present invention, add and be selected from amino acid and Metal Zn such as human serum albumin, low molecular weight peptide, glycine or Methionin ²⁺, Mn ²⁺, Mg ²⁺, Ca ²⁺Deng the protein protectant of metal ion, and the stablizer that is selected from polyoxyethylene glycol, carboxymethyl cellulose, polyglycine, gsh.

Can be by conventional route of administration, the outer approach of the gi tract pharmaceutical composition of the present invention that comes into operation preferably is for example by administration in intravenously, intramuscular, the body cavity, in the tissue lumen, in the intracutaneous, subcutaneous or mucous membrane.The dosage of pharmaceutical composition of the present invention can be from several nanogram(ng)s to several mg/day, but each patient's concrete dosage will depend on character, type and severity, the patient's of disease to be treated age, body weight, general situation and to the susceptibility of medicine, and factors such as employed administering mode and approach.

A preferable use of IL-6 of the present invention (△ 1-22)-PE40 chimeric toxin is the treatment tumour, particularly treating with IL-6 is the tumour of the guiding factor or part binding factor, comprising but be not only limited to neoplasm diseases such as liver cancer, cancer of the stomach, laryngocarcinoma, bladder cancer, colorectal carcinoma, breast cancer, multiple myeloma, lymphatic cancer, neurospongioma, acute myeloid leukaemia and acute lymphoblastic sample leukemia.Another of IL-6 (△ 1-22)-PE40 preferably treated and used is to be used for the treatment of from rabbit eqpidemic disease and other disease of immune system that is caused by T and B cell, as organ graft rejection, red scar lupus, myasthenia gravis, rheumatoid arthritis, multiple sclerosis etc.

On the other hand, IL-6 of the present invention (△ 1-22)-PE40 can be used as diagnostic reagent and is used for the tumour of excision or live body pathological tissue or cell are carried out vitro tissue pathological examination, tissue chemical analysis and carry out cell killing and the specificity binding analysis, so as to judging target tumor treatment susceptibility and dosage.

The following example is intended to further describe for example the present invention, rather than limits the await the reply scope of claim of the present invention by any way.

Embodiment 1: the structure of recombinant expression vector

I. a large amount of preparations of initial plasmid: respectively with pVC8 (Novagen), the pUC19/IL-6 and pBluescript SK plasmid DNA (each 100ng) the transformed competence colibacillus intestinal bacteria JM105 that carry the PE40 gene.To be inoculated in the LB substratum that contains penbritin (500 μ g/ml) 37 ℃ of shaking culture 24 hours then by cell transformed.After extracting plasmid DNA, from pVC8, cut out the about 12kb fragment that contains the PE40 gene with XbaI and EcoRI respectively.With same enzyme double digestion pBluescript, obtain being about the big carrier segments of 295kb.Exist down in the T4 ligase enzyme, PE40 annealing is connected on the pBluescript carrier segments, form the plasmid pBluescript-PE40 of cyclisation.After enzyme is cut (NdeI+EcoRI and ApaI+SacI) evaluation, preserve standby down in-20 ℃.

II. under the standard reaction condition, use synthetic Oligonucleolide primers 1:5 '-CCGAGCTCGAATTCATGTCAGAACGAATTGACAAAC-3 ' (SEQ ID NO:1) and primer 2: 5 '-CTACATATGCCGAAGCCCTC-3 ' (SEQ ID NO:2), and with the linearizing cDNA of plasmid pUC19/IL-6 as template, pcr amplification contains the dna fragmentation of IL-6 (△ 1-22) gene.The IL-6 fragment of usefulness SacI+NdeI double digestion amplification and above the plasmid pBluescript-PE40 described in (I) respectively.After reclaiming resulting SacI-NdeI fragment, pressing about 4: 1 molar ratio of IL-6 fragment: pBluescript-PE40 mixes, in the presence of the T4 dna ligase, carry out ligation, so that IL-6 (△ 1-22) fragment is connected on the 5 ' end of PE40 gene, obtain recombinant plasmid pBIL6-PE40.

III. with obtaining ligation mixture transformed into escherichia coli JM109, and 37 ℃ of insulations of the bacterial strain that will be transformed 2 hours.Select positive bacterium colony then, and extract plasmid DNA and carry out enzyme and cut evaluation, further measure the nucleotide sequence of recombinant DNA, to confirm the existence of IL-6 (△ 1-22) and PE40.Digest (37 ℃, 2 hours) pBIL6-PE40 and plasmid pKK-223-3 (Pharmacia) with EcoRI respectively, and electrophoretic separation comprises the fragment (1700bp) and the pKK carrier segments of IL-6 (△ 1-22) and PE40 gene.Carry out ligation after gained two fragments are mixed by 4: 1 molar ratio, and with reaction mixture transformed into escherichia coli JM105.Cultivation is by cell transformed, and the plasmid DNA that it comprised carried out enzyme cut and identify and sequential analysis, further confirms the existence of IL-6 (△ 1-22) and PE40 fusion gene.SEQ ID NO:3 and SEQID NO:4 listed respectively IL6 (△ 1-22)-PE40 gene nucleotide sequence and by amino acid sequence coded.To so obtain recombinant expression plasmid names and is pKIL6-PE40.

Fig. 1 has shown the structure of the recombinant expression plasmid pKIL6-PE40 that is used for expressing IL6 (△ 1-22)-PE40 fused protein.

Embodiment 2: the expression of chimeric toxin and purifying

I. use recombinant plasmid pKIL6-PE40 transformed into escherichia coli JM105, and be cultured to logarithmic phase in 37 ℃.Enlarge to be inoculated in and be cultured to OD value on the LB substratum that contains penbritin and be about 1.0～1.2 o'clock adding IPTG and induced 2.5 hours.Centrifugal collecting cell was also placed 3 hours in-70 ℃.Melt refrigerated cell precipitation thing and be suspended in the lysis buffer (50mM Tris-HCl, pH8.0,1mM EDTA, 0.2mg/ml N,O-Diacetylmuramidase), supersound process (3 * 30 seconds) then, and with 25,000 * g centrifugal 20 minutes.Remove supernatant (soluble part) and throw out is suspended in sex change damping fluid (6M Guanidinium hydrochloride, 0.2M Tris-HCl, pH8.4,1mM EDTA, 50mM NaCl and 10mM dithiothreitol (DTT)).Behind the recentrifuge protein is diluted in the refolding damping fluid (50mM Tris-HCl, pH8.0,1mM EDTA, 0.25M NaCl and 5mM dithiothreitol (DTT)) (1: 50), and placed 24 hours in 4 ℃.With the protein of refolding to the PBS dialysis after, be used for cell toxicity test, or be further purified with ion-exchange or gel filtration method.

II. in the protein soln of renaturation, add DEAE-Sepharose Fast Flow resin (Pharmacia) and mix (4 ℃, 30 minutes), pack into then in the glass column, and with TE damping fluid (the 20mM Tris-HCl that contains 0.1M NaCl, pH8.0,1mM EDTA) washes post (A280 ≈ 0).With the TE buffer solution elution chimeric toxin that contains the 0.1-0.5mlNaCl gradient.After collecting eluate and using the Amicon thickener that the YM-35 film is housed to concentrate, the Sephacryl S-200 HR post (Pharmacia) that enriched material is crossed by balance in containing the 0.2M potassium phosphate buffer (pH6.5) of 0.4M NaCl.With the highly purified chimeric toxin of TE buffer solution elution that contains 0.1-0.5M NaCl gradient.Collect the peak value part of wash-out and (20 ℃) are preserved in PBS dialysis back packing.

Embodiment 3: sample detection and biological analysis

I. in the sample purification step, according to Chung and the described method of Collier (J.Infect.Immun, 16:832-841,1977), with each protein formulation with [ ¹⁴C] the wheat germ extract of NAD and enrichment elongation factor 2 is incubated together, detects the ADP ribosylation activity of each wash-out part.Simultaneously, (Vector Laboraories Inc.) and with the anti-PE antiserum(antisera) of rabbit partly carries out the Western engram analysis to each wash-out to use commercially available Vectastain test kit.In addition, detect protein content, and estimate molecular size with the SDS-PAGE method.

II. use the various tumour cells of having built strain as target cell, detect the cytotoxic activity of IL6 of the present invention (△ 1-22)-PE40.Briefly, (200 μ l substratum respectively contain about 10 to the tumour cell that routine is cultivated ⁶Individual cell) is inoculated in each hole of 96 hole microtiter plates, at 5%CO ₂IL6 (△ 1-22)-PE40 and the control sample PE40 that in each hole, adds different concns after the following 37 ℃ of incubated overnight of environment.37 ℃ of insulations added after 24 hours ³(insulation 12 hours is continued in Amersham, Corp.) (5 μ Ci/ hole) to the leucine of H mark.After flat board being placed-70 ℃ of freezing 2 hours and 37 ℃ melt fast, cell harvesting to glass fiber filter, is incorporated into radioactivity in the cell with the detection of β counter then.The result represents with the percentage incorporation efficiency of the control group of contacted protein not.Table 1 IL6 (△ 1-22)-PE40 is to the growth-inhibiting effect of the tumor cell line of different tissue sources

From table 1 and result shown in Figure 2 as can be seen, IL6 of the present invention (△ 1-22)-PE40 can kill and wound the tumour cell of multiple different tissue sources in dosage dependence mode.From the restraining effect to target cell amino acid incorporation that the necrocytosis number that added behind the chimeric toxin 24 hours is reflected, IL6 of the present invention (△ 1-22)-PE40 all has significant cytotoxic activity (ID to various kinds of cell such as myelomatosis, liver gland cancer, acute myeloid leukemia and people's laryngocarcinoma system ₅₀Value is 0.3-1.3 μ g protein/hole).Yet tumor cell line (fibroma and chronic myeloid leukemia clone) tissue-derived to other or different developmental phases shows much lower cytotoxicity (ID ₅₀Value is 1.6-2.5 μ g protein/hole).

In addition, it can also be seen that as if more not modified IL6-PE40 toxin of IL6 of the present invention (△ 1-22)-PE40 have better growth-inhibiting effect to the SP2/0 cell from comparison test result shown in Figure 3.

In order to confirm the specificity of cytotoxic activity, used in the experiment under similarity condition and to have expressed and partially purified simple PE40 protein compares sample, the result does not see that PE40 has substantial tumor growth restraining effect (result is not shown).

III. basically according to the described method of people such as Qayum (Br.J.Cancer 62:97-99,1990), carry out the specificity of IL6 (△ 1-22) in conjunction with experiment with the endochylema film of SP2/0 cell.Briefly, with SP2/0 cell (about 10 ⁶Individual) be suspended in and contain 10mM Tris-HCl, pH7.5,1mM dithiothreitol (DTT), 0.1%BSA prepare cell homogenates in the damping fluid of 1mM EDTA.4 ℃ centrifugal (after 500 * g) 15 minutes, gets supernatant and is suspended in the above-mentioned damping fluid with centrifugal 20 minutes of 20,000 * g and with the serous coat throw out once more.

The membranin that will as above prepare by every hole 100 μ g (final volume 100 μ l) is added in the 24 hole titer plates, respectively adds 10 then ^-6M ¹²⁵I-IL-6, add or do not add [ ¹²⁵I] under the IL-6 or IL6 (△ 1-22)-PE40 or IL-6-PE40 condition of mark, 4 ℃ of insulations 3 hours.After the insulation, wash sample and measure residual radioactivity (cpm) by Whatman filter paper with gamma counter with the above-mentioned damping fluid of 5ml.All are all triplicate in conjunction with test sample.In the presence of unlabelled IL-6, determine non-specific binding.

Fig. 4 has shown, and partially purified (after crossing the DEAE post) IL6 (△ 1-22)-PE40 (0) and IL6-PE40 (●) replace with the endochylema of SP2/0 cell membrane-bound in the presence of unlabelled IL-6 ¹²⁵The ability of I-IL-6.Wherein B representative is at competition thing IL-6, IL6 (△ 1-22) when existing and membrane-bound ¹²⁵The amount of I-IL-6 (cpm); Bo representative is not when competing thing and exist and membrane-bound ¹²⁵The amount of I-IL-6 (cpm).Therefrom as can be seen, add IL6 (△ the 1-22)-PE40 fused protein of cumulative concentration, can with concentration increase gradually and gradually the displacement with myelomatosis SP2/0 cytoplasm membrane-bound ¹²⁵I-IL-6.The IL6-PE40 of expression and purifying also obtains similar result under similarity condition, but the latter's replacing power obviously is lower than the former.

IV. for kill capability in the body of further studying IL6 of the present invention (△ 1-22)-PE40 fusion rotein confrontation tumour cell, we have set up myelomatosis band knurl animal model, and observe and write down the incidence of handling solid tumor in the mouse body of back with chimeric toxin of the present invention.Briefly, the male Balb/c mouse of raising is divided into 6 groups, 10 every group at random.Experimental group (1-4 group) is respectively through intraperitoneal injection (i.p.) about 1.2 * 10 ⁶Individual SP2/0 myeloma cell.36 hours (the 4th day) used IL6 (△ the 1-22)-PE40 and the IL6-PE40 treatment mouse (i.p.) of purifying respectively behind the inoculated tumour cell by the 5 and 100 μ g days/dosage of mouse.Control group (the 5th and 6 group) then come into operation (i.p.) contain isopyknic PBS of equimolar amount IL-6.Injection every day is once treated continuously and is put to death band knurl animal after 10 days, and through opening the abdomen anatomic observation, macroscopic solid tumor generates.

Find out that from result shown in Figure 5 the IL6-PE40 of modification and unmodified all stops tumour to be grown in dosage dependence mode, but compares with the IL6-PE40 of unmodified, IL6 of the present invention (△ 1-22)-PE40 obviously has stronger tumor growth and suppresses active.

( 1 ) ( Ⅰ ) ： ( Ⅱ ) ： ( Ⅲ ) ：5 ( Ⅵ ) ： ( A ) ： ( B ) ：175 ( C ) ： ( D ) ：130062 ( E ) ： ( V ) ( A ) ：3．5CXXⅢ ( B ) ：IBM PC ( C ) ：WINDOWS95 ( D ) ：WORD97 ( Ⅵ ) ： ( A ) ：86-0431-7962109 ( B ) ：86-0431-7973911-66692 ( 2 ) SEQ ID NO：1 ( Ⅰ ) ： ( A ) ：36 ( B ) ： ( C ) ： ( D ) ： ( Ⅱ ) ：cDNA ( Ⅲ ) ：SEQ ID NO：1

Information (I) sequence signature of CCGAGCTCGA ATTCATGTCA GAACGAATTG ACAAAC (2) SEQ ID NO:2: (A) length: 20 base pairs (B) type: nucleic acid (C) chain: strand (D) topological framework: linear (II) molecule type: cDNA (III) sequence description: SEQ ID NO:2

CTACATATGC CGAAGCCCTC ( 2 ) SEQ ID NO：3 ( Ⅰ ) ： ( A ) ：492 ( B ) ： ( C ) ： ( D ) ： ( Ⅱ ) ：cDNA ( Ⅲ ) ：SEQ ID NO：3ATGTCAGAAC GAATTGACAA ACAAATTCGG TAGATCCTCG ACGGCATCTCAGCCCTGAGA AAGGAGACAT GTAACAAGAG TAACAGTTGT GAAAGCAGCAAAGAGGCACT GGCAGAAAAC CTGAACCTTC CAAAGATGGC TGCTGAAAAAGATGGATGCT TCCAATCTGG ATTCAATGAG GAGACTTGCC TGGTGAAAATCATCACTGGT CTTTTGGAGT TTGAGGTATA CCTAGAGTAC CTCCAGAACAGATTTGAGAG TAGTCAGGAA CAAGCCAGAG CTGTGCAGAT GAGTACAAAAGTCCTGATCC AGTTCCTGCA GAAAAAGGCA AAGAATCTAG ATGCAATAACCACCCCTGAC CCAACCACAA ATGCCAGCCT GCTGACGAAG CTGCAGGCACAGAACCAGTG GCTGCAGGAC ATGACAACTC ATCTCATTCT GCGCAGCTTTAAGGAGTTCC TGCAGTCCAG CCTGAGGGCT CTTCGGCATA TG ( 2 ) SEQ ID NO：4 ( Ⅰ ) ： ( A ) ：1092 ( B ) ： ( C ) ： ( D ) ： ( Ⅱ ) ：cDNA ( Ⅲ ) ：SEQ ID NO：4GCCGAAGAGG GCGGCAGCCT GGCCGCGCTG ACCGCGCACC AGGCTTGCCACCTGCCGCTG GAGACTTTCA CCCGTCATCG CCAGCCGCGC GGCTGGGAACAACTGGAGCA GTGCGGCTAT CCGGTGCAGC GGCTGGTCGC CCTCTACCTGGCGGCGCGGC TGTCGTGGAA CCAGGTCGAC CAGGTGATCC GCAACGCCCTGGCCAGCCCC GGCAGCGGCG GCGACCTGGG CGAAGCGATC CGCGAGCAGCCGGAGCAGGC CCGTCTGGCC CTGACCCTGG CCGCCGCCGA GAGCGAGCGCTTCGTCCGGC AGGGCACCGG CAACGACGAG GCCGGCGCGG CCACCGCCGACGTGGTGAGC CTGACCTGCC CGGTCGCCGC CGGTGAATGC GCGGGCCCGGCGGACAGCGG CGACGCCCTG CTGGAGCGCA ACTATCCCACT GGCGCGGAGTTCCTCGGCGA CGGCGGCGAC GTCAGCTTCA GCACCCGCGG CACGCAGACCTGGACGGTGG AGCGGCTGCT CCAGGCGCAC CGCCAACTGG AGGAGCGCGGCTATGTGTTCG TCGGCTACCA CGGCACCTTC CTCGAAGCGG CGCAAAGCATCGTCTTCGGC GGGGTGCGCG CGCGCAGCCA GGACCTCGAC GCGATCTGGCGCGGTTTCTAT ATCGCCGGCG ATCCGGCGCT GGCCTACGGC TACGCCCAGGACCAGGAACC CGACGCACGC GGCCGGATCC GCAACGGTGC CCTGCTGCGGGTCTATGTGC CGCGCTCGAG CCTGCCGGGC TTCTACCGCA CCAGCCTGACCCTGGCCGCG CCGGAGGCGG CGGGCGAGGT CGAACGGCTG ATCGGCCATCCGCTGCCGCT GCGCCTGGAC GCCATCACCG GCCCCGAGGA GGAAGGCGGGCGCCTGGAGA CCATTCTCGG CTGGCCGCTG GCCGAGCGCA CCGTGGTGATTCCCTCGGCG ATCCCCACCG ACCCGCGCAA CGTCGGCGGC GACCTCGACCCGTCCAGCAT CCCCGACAAG GAACAGGCGA TCAGCGCCCT GCCGGACTACGCCAGCCAGC CCGGCAAACC GCCGCGCGAG GACCTGAAGT AA ( 2 ) SEQ ID NO：5 ( Ⅰ ) ： ( A ) ： ( B ) ： ( C ) ： ( D ) ： ( Ⅱ ) ： ( Ⅲ ) ：Met-Ser-Glu-Arg-Ile-Asp-Lys-Gln-Ile-Arg-Tyr-Ile-Leu-Asp-Gly-Ile-Ser-Ala-Leu-Arg-Lys-Glu-Thr-Cys-Asn-Lys-Ser-Asn-Met-Cys-Glu-Ser-Ser-Lys-Glu-Ala-Leu-Ala-Glu-Asn-Leu-Asn-Leu-Pro-Lys-Met-Ala-Ala-Glu-Lys-Asp-Gly-Cys-Phe-Gln-Ser-Gly-Phe-Asn-Glu-Glu-Thr-Cys-Leu-Val-Lys-Ile-Ile-Thr-Gly-Leu-Leu-Glu-Phe-Glu-Val-Tyr-Leu-Glu-Tyr-Leu-Gln-Asn-Arg-Phe-Glu-Ser-Ser-Glu-Glu-Gln-Ala-Arg-Ala-Val-Gln-Met-Ser-Thr-Lys-Val-Leu-Ile-Gln-Phe-Leu-Gln-Lys-Lys-Ala-Lys-Asn-Leu-Asp-Ala-Ile-Thr-Thr-Pro-Asp-Pro-Thr-Thr-Asn-Ala-Ser-Leu-Leu-Thr-Lys-Leu-Gln-Ala-Gln-Asn-Gln-Trp-Leu-Gln-Asp-Met-Thr-Thr-His-Leu-Ile-Leu-Arg-Ser-Phe-Lys-Glu-Phe-Leu-Gln-Ser-Ser-Leu-Arg-Ala-Leu-Arg-Gln-Met-Ala-Glu-Glu-Gly-Gly-Ser-Leu-Ala-Ala-Leu-Thr-Ala-His-Gln-Ala-Cys-His-Leu-Pro-Leu-Glu-Thr-Phe-Thr-Arg-His-Arg-Gln-Pro-Arg-Gly-Trp-Glu-Gln-Leu-Gly-Gln-Cys-Gly-Tyr-Pro-Val-Gln-Arg-Leu-Val-Ala-Leu-Tyr-Leu-Ala-Ala-Arg-Leu-Ser-Trp-Asp-Gln-Val-Asp-Gln-Val-Ile-Arg-Asn-Ala-Leu-Aln-Ser-Pro-Gly-Ser-Gly-Gly-Asp-Leu-Gly-Glu-Ala-Ile-Arg-Glu-Gln-Pro-Gln-Gln-Ala-Arg-Leu-Ala-Leu-Thr-Leu-Ala-Ala-Ala-Glu-Ser-Glu-Arg-Phe-Val-Arg-Gln-Gly-Thr-Gly-Asn-Asp-Gln-Ala-Gly-Ala-Ala-Asn-Ala-Asp-Val-Val-Ser-Leu-Thr-Cys-Pro-Val-Ala-Ala-Gly-glu-Cys-Ala-Gly-Pro-Ala-Asp-Gly-Asp-Ala-Leu-Leu-Glu-Arg-Asn-Tyr-Pro-Thr-Gly-Ala-Glu-Phe-Len-Gly-Asp-Gly-Gly-Asp-Val-Ser-Phe-Ser-Thr-Arg-Gly-Thr-Glr-Asn-Trp-Thr-Val-Gln-Arg-Leu-Leu-Gln-Ala-His-Arg-Gln-Leu-Gln-Gln-Arg-Gly-Tyr-Val-Phe-Val-Gly-Tyr-His-Gly-Thr-Phe-Leu-Gln-Ala-Ala-Gln-Ser-Ile-Val-Phe-Gly-Gly-Arg-Ala-Arg-Ser-Gln-Gln-Asp-Leu-Asp-Asp-Ala-Ile-Trp-Arg-Gly-Phe-Tyr-Ile-Ala-Gly-Asp-Pro-Ala-Leu-Ala-Tyr-Gly-Tyr-Ala-Gln-Asp-Gln-Gln-Pro-Asp-Ala-Gly-Arg-Ile-Arg-Asp-Gly-Ala-Leu-Len-Arg-Val-Tyr-Val-Pro-Arg-Ser-Ser-Len-Pro-Gly-Phe-Tyr-Arg-Thr-Ser-Leu-Thr-Leu-Ala-Ala-Pro-Gln-Ala-Ala-Gly-Gln-Val-Gln-Arg-Leu-Ile-Gly-His-Pro-Leu-Pro-Leu-Arg-Leu-Asp-Ala-Ile-Thr-Gly-Pro-Gln-Gln-Gly-Gly-Arg-Leu-Gln-Thr-Ile-Leu-Gly-Trp-Pro-Leu-Ala-Gln-Arg-Thr-Val-Val-Ile-Pro-Ser-Ala-Ile-Pro-Thr-Asp-Pro-Arg-Asn-Val-Gly-Gly-Asp-Leu-Asp-Pro-Ser-Ser-Ile-Pro-Asp-Lys-Gln-Gln-Ala-Ile-Ser-Ala-Leu-Pro-Asp-Tyr-Ala-Ser-Gln-Pro-Gly-Lys-Pro-Arg-Gln-Asp-Leu-Lys-end

Claims (6)

1. the fused protein that comprises the IL-6 that is connected to the modification on the cytotoxic protein matter is characterised in that wherein the modification to said IL-6 as targeting part comprises that the deletion N-terminal is no more than 28 amino acid at most.

2. according to the fused protein of claim 1, wherein said modification comprises that deletion is to 22 amino acid of N-terminal as the IL-6 of targeting part.

3. according to the fused protein of claim 1, wherein said cytotoxic protein matter is PE40.

4. contain the IL6-PE40 fused protein of modification of claim 1 and the pharmaceutical composition of one or more pharmaceutically acceptable carriers or vehicle.

5. according to the pharmaceutical composition of claim 4, wherein the IL-6 as targeting part is 22 amino acid whose IL-6 of disappearance N-terminal in the IL6-PE40 fused protein molecule of said modification.

6. according to the application of the pharmaceutical composition of claim 5 as antineoplastic agent.

Images