CN1285406A - Complete sequence of Chinese Zhangzhou isolate gene group 1 and group 4 of banana top bundling virus - Google Patents

Abstract

The present invention relates to complete seqnence of Chinese Zhangzhou isolate BBTV gene group 1 and 4 and all open reading frames and their coded amino acid sequence, positive and inverted nucleotide sequences of coded amino acid and its derivative recombinant plasmid or transgenic plant so as to raise anti-BBTV power of banana; the complete or partial nucleotide sequence of coded amino acid and its complementary sequence can be used for PCR diagnosis of BBTV; BBTV DNA 1 and 4 intergenic region nucleotide sequence and its deletional sequential recombinant plasmid can be used for providing constitutive or tissue-specific expression of the gene for regulating target gene at upstream of the target gene in transgenic monocotyledonous plant or dicotyledonous plant.

Description

Abaca bunchy top virus China ZhangZhou isolate gene group 1 and 4 complete sequence

The present invention relates to abaca bunchy top virus (Banana Bunchy Top Virus, BBTV) genomic gene engineering field.Specifically, the present invention relates to the complete sequence of BBTV DNA 1 and 4; The sequence of BBTV DNA1 and 4 each its amino acids coding of open reading frame; The forward of BBTV DNA 1 and 4 its amino acids coding of open reading frame and reverse nucleotide sequence and deutero-recombinant plasmid or transgenic plant thus are to strengthen the anti-BBTV ability of banana; The complete nucleotide sequence of BBTV DNA 1 and 4 its coded amino acids of open reading frame or partial nucleotide sequence and complementary sequence thereof, and be used for the PCR diagnosis of BBTV; The sequence of BBTV DNA 1 and 4 intergenic regions (non-coding region) or complementary sequence have the degree of variation up to 20%; Contain the recombinant plasmid of BBTV DNA 1 and 4 non-coding region nucleotide sequences and disappearance nucleotide sequence thereof, and be provided at the goal gene upstream, to regulate composition or the tissue-specific expression of goal gene in genetically modified unifacial leaf or dicotyledons.

Banana bunchy top disease is the most serious a kind of in the banana disease, its symptom is the yellow of blade outer rim, vein, petiole and the blackish green striped of false stem tool, bunchy top and obviously dwarfing, cause crushing disaster when serious, the banana planting district that this disease just (is comprising China) in the world is spread.Harding[1] and Thomas[2] etc. people 1991 report from susceptible banana tissue, be purified to a spherical virus particle such as 18～20nm, its coat protein molecular weight is 20,100.Thomas[2] etc. human any of several broadleaf plants bud (Pentalonianigronervosa) successfully carried out the tieback test of this purification thing, prove that BBTV is the cause of disease that causes banana bunchy top disease.People such as Harding reported a genome (BBTV DNA 1) of having cloned BBTV in [3] 1993 years, proved that simultaneously the BBTV genome is a single-stranded cyclic DNA.Based on there being a dNTP-site (GGEGKT), infer the main reading frame replicative enzyme of may encoding.Yet do not find the energy coded housing albumen reading frame of size like this, estimate more than this component of BBTV genome.After this, people [4] (1994) such as Burns studies show that the BBTV genome contains 5 or may 7 components at least.People such as Karan [5] (1994) have cloned the BBTV DNA 1 from 10 different regions BBTV isolates, analysis revealed can be divided into two groups, South Pacific group (7 isolates such as Australia, Egypt, Fiji, India) and Asia group (Philippines, 3 isolates of TaiWan, China and Vietnam), in every group of the mean sequence difference is 1.9～3.0%, about 10% between two groups, main open reading frame encoded protein matter difference is approximately 5.0%.People such as Xie [6] (1994) have cloned BBTV DNA 1,2 and 5 from the Hawaii isolate, and sequential analysis shows and all belongs to South Pacific group.People such as Burns [7] (1995) have analyzed BBTV DNA 1～6 sequence.People such as Wanitchakorn [8] (1997) confirm the coat protein of BBTV DNA 3 codified 20kDa.People such as Dugdale [9] (1998) had reported once that BBTV DNA 1～6 intergenic region (non-coding region) had different promoter activities in transgenic plant.People such as Xiao Huogen [11] have also reported the sequence (belonging to the Asia group) of Chinese Guangdong isolate BBTV DNA 1 complete sequence and DNA 3 and 4 coding regions in 1999.

University of Queensland's (Queensland University) " BBTV dna sequence dna " patent (WO96/38564) once reported the sequence of BBTV DNA 3,4 and 6, corresponding to the DNA and the aminoacid sequence of open reading frame.And in " BBTV intergenic region " patent (WO96/38554) a part of fragment in district or degree of variation up to 20% is arranged between report BBTV DNA 1～6 element genes derived from said intergenic region dna molecular or its complementary sequence; Contain above-mentioned dna molecular, can strengthen in unifacial leaf and dicotyledons cell and express goal gene.

And the present invention is specifically related to Chinese ZhangZhou area isolate BBTV DNA1 and BBTV DNA4 they be different from existing report.The present invention has designed two non-adjacent primers with reference to Asia group BBTV DNA 1 coding region sequence [5] on purifying BBTV China ZhangZhou isolate and research its physicochemical property [10] basis, organizing total DNA with the banana of area, ZhangZhou tool typical case banana bunchy top disease symptom is template, obtain about 500bp fragment by pcr amplification, made up recombinant plasmid pBV1-1/2, order-checking back sequential analysis determines it is part (half the is long) sequence of BBTV DNA 1.By the half long sequences Design that predicts a pair of adjacent primer, organizing total DNA with the banana of area, ZhangZhou infection BBTV is template, obtain about 1kb fragment through pcr amplification, made up recombinant plasmid pBV1, order-checking shows that ZhangZhou isolate BBTV DNA 1 total length is 1,104 Nucleotide (received by GenBank/EMBL/DDBJ, Accession numberAF110266 will be open on December 31st, 1999).Compare with Australia, TaiWan, China and Guangdong isolate BBTV DNA 1, its nucleotide sequence homology is respectively 89%, 96% and 95%; The coding region nucleotide sequence homology is respectively 91%, 96% and 95%; Main common (CR-M) region sequence homology that compares its non-coding region with Australian isolate BBTVDNA 1 is 69%.So ZhangZhou isolate BBTV DNA 1 should belong to the new isolate of Asia group.

(CR-M) region sequence according to ZhangZhou isolate BBTV DNA 1 non-coding region has designed three pairs of non-adjacent primers, and isolate BBTV DNA is a template with ZhangZhou, carries out pcr amplification.Has only the fragment that goes out about 1kb with a pair of non-adjacent primer amplification wherein, recombinant plasmid called after pCM21, pCM22 has designed a pair of adjacent primer again predicting the sequence encoding district, and isolate BBTV DNA is a template with ZhangZhou, must obtain about 1kb fragment through pcr amplification, recombinant plasmid called after p400, p700, p160, order-checking shows that ZhangZhou isolate BBTV DNA 4 total lengths are 1,039 Nucleotide.Sequential analysis point out with Australian isolate BBTV DNA 4 nucleotide sequence homologies be 79%.Be respectively 81% and 87% with Australia and Chinese Guangdong isolate coding region amino acid sequence homology.The CR-M region sequence homology of the CR-M district of its non-coding region and Australian isolate BBTV DNA 4 is 70%.Therefore ZhangZhou isolate BBTV DNA 4 also should belong to the Asia group, and is the complete sequence of reporting BBTV DNA 4 in the group of Asia for the first time.

In sum, the related BBTV dna sequence dna of the present invention and University of Queensland's patent does not belong to same group, and the sequence variations degree exceeds 20%.The invention provides the complete sequence of ZhangZhou isolate BBTVDNA 1 and 4; DNA 1 is by 1, and 104nt forms (Fig. 1); DNA 4 is by 1, and 039nt forms (Fig. 5); The CR-M district homology of two sequence non-coding regions is 82%; The molecular weight that DNA 1 is made up of one 861 nucleotide sequence coded 286 amino-acid residues is that the protein (contain dNTP-binding site GGEKT (Fig. 2), supposition may be encoded and BBTV duplicates proteins associated matter) of 33kDa and the molecular weight of 129 nucleotide sequence coded 42 amino-acid residues compositions are the small protein matter of 5kDa; The molecular weight that DNA 4 is made up of one 351 nucleotide sequence coded 116 amino-acid residues is the protein of 15.5kDa, and its N-terminal contains about 30 hydrophobic amino acid residues (Fig. 6), the supposition motion protein of may encoding; The present invention also comprises the sequence or the complementary sequence of ZhangZhou isolate BBTV DNA 1 and 4 intergenic regions (non-coding region) and degree of variation up to 20% is arranged.

Fig. 1: the full length nucleotide sequence of BBTV ZhangZhou isolate DNA 1.The part Nucleotide of drawing dotted line is the CR-M district

Fig. 2: the aminoacid sequence of BBTV ZhangZhou isolate DNA 1 open reading frame coding 33kDa large protein.

Fig. 3: the PCR result of the banana diseased plant that the CTAB method is extracted and total DNA of healthy strain tissue relatively

1：1kb?DNA?Lader

2: the total DNA with healthy banana tissue is the PCR of template;

3: it is the PCR of template that the banana of making the infection BBTV of 1:103 dilution is organized total DNA

4: make 1:10 ⁴It is the PCR of template that the banana of the infection BBTV of dilution is organized total DNA

5: make 1:10 ⁵It is the PCR of template that the banana of the infection BBTV of dilution is organized total DNA

6: make 1:10 ⁶It is the PCR of template that the banana of the infection BBTV of dilution is organized total DNA

7: make 1:10 ⁷It is the PCR of template that the banana of the infection BBTV of dilution is organized total DNA

Fig. 4: contain BBTV ZhangZhou isolate DNA 1 coding region construction of recombinant plasmid mode chart.

Fig. 5: the full length nucleotide sequence of BBTV ZhangZhou isolate DNA 4.

Fig. 6: the proteic aminoacid sequence of BBTV ZhangZhou isolate DNA 4 open reading frames coding 15.5kDa.

Fig. 7: BBTV ZhangZhou isolate DNA 4 non-coding region nucleotide sequences.

Fig. 8: BBTV ZhangZhou isolate DNA 4 non-coding region excalation nucleotide sequences 1

Fig. 9: BBTV ZhangZhou isolate DNA 4 non-coding region excalation nucleotide sequences 2

Figure 10: contain the structure mould figure that ZhangZhou isolate DNA 4 expresses the binary vector of coding region gene.

The open reading frame clone's of the full-length clone of embodiment 1 ZhangZhou isolate BBTV DNA 1 and coding larger protein structure 1.1 design of primers

With reference to BBTV DNA 1 Asia group coding region sequence [5], design primer A, the B of a pair of clone half long BBTV genome 1.By the grand a pair of adjacent primer C of sequences Design, the D that is predicted in half Changke.

Primer A:5 '-CT CCATGGCGCGATATGTGGT-3 '

Nco?I

Primer B:5 '- CTGCAGACCCAAATA/TATG/TCTTCGAT-3 '

Pst?I

Primer C:5 '-CAGGCGCACACCTTGAGAAACG-3 '

The preparation of primer D:5 '-GGAAGAAGCCTCTCATCTGCTTC-3 ' 1.2 pBluescript II SK T-carriers

Get 3 μ g pBluscript II SK plasmids, in 100 μ l systems,, get 2 μ l electrophoretic examinationss with 37 ℃ of endonuclease reaction 1h of 0.5 μ l EcoR V (10u/ μ l).Phenol: chloroform: the above-mentioned solution of primary isoamyl alcohol mixing solutions (25: 24: 1) extracting is also used ethanol sedimentation, 70% washing with alcohol.This enzyme is cut carrier in 100 μ l pcr amplification systems (containing 10u/ μ lTaq0.5 μ l, 2mmol/L dTTP), and 72 ℃ of reaction 2h carry out the phenol extracting and purifying and (contain 10u/ μ lT in 50 μ l ligation systems this reaction solution ₄Dna ligase 2 μ l) in, 16 ℃ of reaction 12h rear electrophoresis reclaim about 3kb dna fragmentation.1.3 infect the extraction that the BBTV banana is organized total DNA

From-70 ℃ of refrigerators, take out and organize 50mg through the good infection BBTV banana of liquid nitrogen grinding from ZhangZhou, add 300 μ l CTAB and extract damping fluid (100mmol/L Tris, pH8.0,1.4mol/LNaCl, 20mmol/L EDTA, 2% CTAB), 65 ℃ of temperature are bathed 30min.Add equal-volume phenol: chloroform: primary isoamyl alcohol (25: 24: 1) mixing solutions, put upside down mixing, the centrifugal 5min of 12000r/min, get supernatant liquor and add the chloroform of 4 ℃ of precoolings of equal-volume: primary isoamyl alcohol (24: 1) mixing solutions, put upside down mixing, the centrifugal 5min of 12000r/min, in the supernatant solution that reclaims, add the equal-volume Virahol of precooling or the dehydrated alcohol of two volumes, the centrifugal 5min of 12000r/min, use 70% washing with alcohol more once, the ethanol volatilization is done the back and is added 50 μ l sterilization deionized water, gets 5 μ l electrophoretic examinationss.1.4 the structure that half Changke of BBTV DNA 1 is grand

In the pcr amplification system, every kind of dNTP is 2mmol/L, and grand primer A, the B in two and half Changke is respectively 0.4 μ mol/L, Taq plus II 0.03u/ μ l, dna profiling 1% (V/V).The pcr amplification condition is: 94 ℃ of pre-sex change 4min; 94 ℃ of 1min, 51 ℃ of 1min, 72 ℃ of 30s circulate 30 times; 72 ℃ of 10min.

After the purified recovery of pcr amplification product (fragment of bp more than 500), with pBluscript II SKT-carrier with 8: 1 mole ratio after carrying out ligation 8h under 16 ℃, after getting 0.5 μ l electric shock transformed competence colibacillus cell E.coliJM109, be applied on penbritin (50 μ g/ μ l) the LB solid medium that contains X-Gal and IPTG, cultivate 8h for 37 ℃, select white colony, cut the rear electrophoresis analysis with EcoR I and Hind III enzyme behind the extraction plasmid, select positive recombinant plasmid pBV1-1/2.1.5 the structure of the full-length clone of BBTV DNA 1

Pcr amplification system and roughly the same above, primer C and primer D replace primer A and primer B.The pcr amplification condition is: 94 ℃ of pre-sex change 4min; 94 ℃ of 1min, 68 ℃ of 1min, 72 ℃ of 30s circulate 30 times; 72 ℃ of 10min.The pcr amplification product of primer C, D (1, the 104kb fragment) cloning process is as 1.4.Analyze by EcoR I and Hind III double digestion, select positive recombinant plasmid pBV1.1.6 the open reading frame clone's of ZhangZhou isolate BBTV DNA 1 coding larger protein structure

In the pcr amplification system, every kind of dNTP is 2mmol/L, and two primer A, E are respectively 0.4 μ mol/L, Taq plus II 0.03u/ μ l, and it is 1% (V/V) that susceptible banana is organized total DNA.The PCR condition is: 94 ℃ of pre-sex change 4min; 94 ℃ of 1min, 51 ℃ of 1min, 72 ℃ of 1min circulate 30 times; 72 ℃ of 10min.

After the purified recovery of pcr amplification product (fragment of bp more than 500), after the Klenow benefit is flat, cut and reclaim big fragment with EcoR I enzyme again.PBluscript II SK reclaims big fragment behind Smal I and EcoR I double digestion.Two fragments after the recovery are after carrying out ligation 8h under 16 ℃, after getting 0.5 μ l electric shock transformed competence colibacillus cell E.coliJM109, be applied on penbritin (50 μ g/ μ l) the LB solid medium that contains X-Gal and IPTG, cultivate 8h for 37 ℃, select white colony, cut the rear electrophoresis analysis with EcoR I and HindIII enzyme after extracting plasmid, select positive recombinant plasmid pBtvorf1 (Fig. 4).

Embodiment 2 adopts pcr amplification diagnosis of technique BBTV2.1 banana to organize the alkaline process of total DNA to extract

Get 20mg banana blade, add the NaOH of 200 μ l 0.5N, fully grind, the centrifugal 5min of 8000r/min gets supernatant liquor and does pcr amplification.2.2 banana is organized the CTAB extraction method of total DNA

From-70 ℃ of refrigerators, take out and organize 50mg through the good infection BBTV banana of liquid nitrogen grinding from ZhangZhou, add 300 μ lCTAB and extract damping fluid (100mmol/L Tris, pH8.0,1.4mol/LNaCl, 20mmol/L EDTA, 2%CTAB), 65 ℃ of temperature are bathed 30min.Add equal-volume phenol: chloroform: primary isoamyl alcohol (25: 24: 1) mixing solutions, put upside down mixing, the centrifugal 5min of 12000r/min, get supernatant liquor and add the chloroform of 4 ℃ of precoolings of equal-volume: primary isoamyl alcohol (24: 1) mixing solutions, put upside down mixing, the centrifugal 5min of 12000r/min, in the supernatant solution that reclaims, add the equal-volume Virahol of precooling or the dehydrated alcohol of two volumes, the centrifugal 5min of 12000r/min, use 70% washing with alcohol more once, the ethanol volatilization is done the back and is added 50 μ l sterilization deionized water, gets 5 μ l electrophoretic examinationss.2.3 pcr amplification

Every kind of dNTP is 2mmol/L, and grand primer A, the B in two and half Changke is respectively 0.4 μ mol/L, Taq plus II 0.03u/ μ l, dna profiling 1% (V/V).The pcr amplification condition is: 94 ℃ of pre-sex change 4min; 94 ℃ of 1min, 51 ℃ of 1min, 72 ℃ of 30s circulate 30 times; 72 ℃ of 10min.2.4 the PCR rapid detection of BBTD

Use the CTAB method and extract total DNA of healthy and susceptible banana tissue, do 1: 10 respectively ³～1: 10 ⁷Dilution, be that dna profiling carries out PCR with these different dilution gradient solutions, do the contrast that water is template simultaneously.The result of PCR shows, the diseased tissues DNA that extracts with the CTAB method all has the PCR fragment of bp more than 500, and health tissues DNA PCR result is negative accordingly, does not have any band (Fig. 3).Use alkaline process and extract tissue DNA, when the original liquid of the DNA of diseased tissues was done the dilution of different gradients, different diseased tissues PCR reaction sensitivities was different.The diseased tissues DNA that has 1: 10 ⁶Diluent still have the PCR fragment of bp more than 500, the diseased tissues DNA that has 1: 10 ⁴Diluent but can not get the PCR fragment of bp more than 500, the DNA of strong tissue did 1: 10～1: 10 ⁷Dilute its PCR result all negative (not having any band).Sum up above result, extract tissue DNAs, 1: 10～1: 10 of its DNA with two kinds of methods ³Extent of dilution all can obtain the PCR fragment of bp more than 500.Corresponding to initial blade amount, application PCR can detect the BBTV in the Gamma Magnitude blade.

Embodiment 3 ZhangZhou isolate BBTV DNA 4 full-length clones and coding region forward and reverse sequence clone's structure 3.1. viral purification

According to people such as Cai Wenqi [10] method, from-70 ℃ of refrigerators, take out through the good infection BBTV banana tissue of liquid nitrogen grinding from ZhangZhou, add 2ml extracting solution (0.2mol/L phosphoric acid buffer with the 1g diseased tissues, pH7.4, contain 0.2% basic ethanol and 0.1% diethyldithio-carbamate salt) mixed, grind the two-layer filtered through gauze in back, filtrate is behind 7000r/min low-speed centrifugal 15min, supernatant liquor is through 36000r/min ultracentrifugation 2.5h (Beckman 45Ti rotary head), precipitation suspends with an amount of 0.07mol/L sodium phosphate buffer (pH7.2), behind 4 ℃ of stirring 2d, place 2d again, get supernatant liquor ultracentrifugation again behind the suspension low-speed centrifugal, its precipitation is with carrying out the cesium sulfate gradient centrifugation after 0.07mol/L sodium phosphate buffer (pH7.2) suspension in a small amount, merge the branch contain BBTV, again through hypervelocity and the low speed centrifugal BBTV goods that promptly obtain purifying of reporting to the leadship after accomplishing a task.3.2 BBTV nucleic acid extraction

Virus product adds equal-volume extraction buffer I (0.02mol/L Tris-HCl, pH9.0, contain 0.0001mol/L EDTA and 4%SDS), 60 ℃ of insulation 15min, add 65 ℃ of insulations of equal-volume extraction buffer II (40mmol/L Tris-HCl, pH8.0 contain 1%CTAB, 1mol/L NaCl, 5mmol/LEDTA, 0.5%PVP and 0.1% mercaptoethanol) 10min again, add the extracting of equal-volume chloroform, the centrifugal 16min of 10000r/min.Water adds equal-volume phenol: chloroform (1: 1) mixed solution again extracting once, the centrifugal 10min of 10000r/min, water adds the equal-volume Virahol, be mixed back 4 ℃ and place 1h, the centrifugal 6min of 10000r/min, 70% ethanol is washed precipitation once, puts to add water 100 μ l behind the air drying and dissolve its precipitation.3.3 the structure of ZhangZhou isolate BBTV DNA 4 non-full-length clones

Design of primers and pcr amplification: the CR-M region sequence of ZhangZhou isolate BBTV DNA 1 that has cloned according to us, designed three pairs of primers herein, primer sequence is as follows: Primer 1:TAC/TCGT/CTTAAGGGCCGCPrimer 2:AATCAACCCCGAT/ATCTTPrimer 3:AATCTTTGCTTTTCCCCPrimer 4:GGATAGCACAATCAACC

Wherein Primer 1 and Primer 2, Primer 1 and Primer 3, Primer 1 and Primer4 form paired primer respectively.

The pcr amplification condition is: (1) 94 ℃ of 4min.(2)94℃?50s，63℃?50s，72℃?1min。35 circulations altogether.(3)72℃?10min。

The pcr amplification system is as follows: every kind of primer concentration is 10pmol, dNTP _sBe 200 μ mol/L, Taq plus II is 1u, 1.5mmol/L MgCl ₂, 50mmol/L KCl, 20mmol/L Tris-HCl (pH9.0), 0.1% Triton X-100, BBTV DNA are 1 μ l, reaction volume is 50 μ l.

Have only that this just amplifies the fragment of about 1kb to primer with primer 1 and primer 2.In order to guarantee specific amplification, adopted higher annealing temperature (63 ℃), regulated primer concentration simultaneously, and the amount of BBTV DNA.The pcr amplification product of recovery and the about 1kb size of purifying from sepharose is mended flat its two ends with the Klenow enzyme then, the pBluescriptII-KS carrier that the while purifying is cut through EcoR V enzyme.Above-mentioned two fragments are connected 12-16h under 16 ℃ temperature, and transform employing CaCl ₂The competent cell DH5 α of method preparation.Transformant coated scribble 40 μ l X-gal (20mg/ml), on the LB solid medium of the penbritin of 4 μ l IPTG (200mg/ml) (60 μ g/ml), in 37 ℃ of incubators, cultivate 12-16h then.Select white colony and on above-mentioned LB solid medium, rule and continue to cultivate 12-16h, transfer to afterwards and continue to cultivate 12-16h in the LB liquid nutrient medium that contains ammonia benzyl mould (60 μ g/ml).Adopt boiling method or alkaline process to extract plasmid.(Kpn I EcoRI) cuts out, and PCR also can amplify the positive clone of clone of the segmental plasmid of about 1kb size simultaneously to use two enzymes.Detect by this method and obtained two positive colony pCM21 and pCM22.By manual order-checking and machine sequencing and carry out sequential analysis, learn that the sequence of these two positive colonies is in full accord, and its sequence and Australian isolate BBTV DNA 4 has homology.3.4 the structure of ZhangZhou isolate BBTV DNA 4 full-length clones

Design of primers: designed following a pair of adjacent export-oriented primer again according to above-mentioned resulting BBTV DNA 4 non-full-length clone coding region sequences: Primer 5:GAGGTATTGTGGAAGAGPrimer 6:TGACGAGCTCTGCATCT

The pcr amplification condition is: (2) 94 ℃ of 1min of (1) 94 ℃ of 4min, 63 ℃ of 1min, 72 ℃ of 1min.35 circulations altogether.(3)72℃?10min。

The pcr amplification system is as follows: every kind of primer concentration is 10pmol, and dNTPS is 200 μ mol/L, and Taqplus II is 1u, 1.5mmol/L MgCl ₂, 50mmol/L KCl, 20mmol/L Tris-HCl (pH9.0), 0.1% Triton X-100, BBTV DNA are 1 μ l, reaction volume is 50 μ l.

Make up ZhangZhou isolate BBTV DNA 4 full-length clones by 3.3 methods, obtain three positive colony P400, P700 and P160.Sequencing result shows that the sequence of these three positive colonies is in full accord, and its sequence total length is 1,039nt.With Australian isolate BBTV DNA 4 sequence homologies be 79%, be 70% with regard to main common (CR-M) region sequence homology of its non-coding region.ZhangZhou isolate BBTV DNA4 should belong to the Asia group.And be the complete sequence of reporting BBTV DNA 4 in the group of Asia for the first time.The N that learns Chinese ZhangZhou area BBTV DNA4 from the derivation aminoacid sequence holds by one section βZhe Die district that is made up of 30 hydrophobic amino acids approximately the motion albumen of BBTV so the open reading frame of BBTV genome 4 is encoded probably.3.5 the clone's of ZhangZhou isolate BBTV DNA 4 coding region forward sequences structure

Design of primers and PCR reaction: according to ZhangZhou isolate BBTV DNA 4 complete sequences of having cloned, 5 ' end and 3 ' end have designed two pairs of primers respectively in the coding region.Wherein Primer PB and PrimerPS are a pair of primers, and Primer NB and Primer NS are a pair of primers.Primer?PB：CGGGATCCAACCATGGCATTGACAACAGAGCPrimer?PS：CGCGTCGACGTATTAAAACATAGGGCCGPrimer?NB：CGGGATCCGTATTAAAACATAGGGCCGPrimer?NS：CGCGTCGACATGGCATTGACAACAGAGC

The pcr amplification condition is: (1) 94 ℃, and 4min.(2) 94 ℃ of 30s, 63 ℃ of 30s, 72 ℃ of 30s, 35 circulations altogether.(3)72℃，10min。

The pcr amplification system is as follows: every kind of primer concentration is 10pmol, and dNTPS is 200 μ mol/L, and Taq plus I is 1u, 1.5mmol/L MgCl ₂, 50mmol/L KCl, 20mmol/L Tris-HCl (pH9.0), 0.1%Triton X-100, the p400 plasmid DNA is 1 μ l, reaction volume is 50 μ l.

Reclaim the also fragment of the about 351bp size of purifying from the pcr amplification product of Primer PB and Primer PS, use BamH I and its two ends of Sal I double digestion then, purifying is through the pBluescript II-KS carrier of BamH I and Sal I double digestion simultaneously.Above-mentioned two fragments are connected 12-16h under 16 ℃ temperature, and conversion CaCl ₂The competent cell DH5 α of method preparation.Transformant coated scribble 40ul X-gal (20mg/ml), on the LB solid medium of the penbritin of 4 μ l IPTG (200mg/ml) (60 μ g/ml), in 37 ℃ of incubators, cultivate 12-16h then.Selecting white colony rules on above-mentioned LB solid medium and continue to cultivate 12-16h.Transfer to afterwards and continue to cultivate 12-16h in the LB liquid nutrient medium that contains penbritin (60 μ g/ml).Float glass process or alkaline process upgrading grain are boiled in employing.Can cut out with two enzymes (BamH I and Sal I), PCR also can amplify the positive clone of clone of the segmental plasmid of about 350bp size simultaneously.Detecting the positive colony that obtains by this method is P14.Adopt the sequencing kit of USB company that these two positive colonies are carried out manual order-checking then, and carry out sequencing analysis.Sequencing analysis shows: among the P14 among coding region sequence and the P400 coding region sequence row in full accord, its sequence total length is 351nt.The N terminal amino acid sequence of deriving is by one section βZhe Die district that is made up of 30 hydrophobic amino acids approximately, the motion albumen of BBTV so BBTV DNA 4 encodes probably.3.6 the clone's of ZhangZhou isolate BBTV DNA 4 coding region reverse sequences structure

From the pcr amplification product of Primer NB and Primer NS, reclaim and the fragment of the about 351bp size of purifying, and adopt 3.5 method to obtain positive colony N17.Sequencing analysis shows among the N17 that reverse sequence row in coding region are in full accord in the coding region reverse cloning sequence and P400, and its sequence total length is 351nt.

The structure 4.1 of the binary vector of embodiment 4 ZhangZhou isolate BBTV DNA, 4 expression coding region genes and sense-rna gene thereof is expressed the structure of the binary vector of coding region genes

Recovery and purifying connect 12-16h with above-mentioned two fragments through the pBin438 carrier of BamH I and Sal I double digestion with the fragment of BamH I and SalI about 351bp size that double digestion goes out from P14, while purifying under 16 ℃ temperature.Conversion CaCl ₂The competent cell DH5 α of method preparation.Transformant is coated on the LB solid medium that contains kantlex (50 μ g/ml), in 37 ℃ of incubators, cultivated 12-16h then.Selecting 12 bacterium colonies rules on above-mentioned LB solid medium and continue to cultivate 12-16h.Transfer to afterwards and continue to cultivate 12-16h in the LB liquid nutrient medium that contains kantlex (50 μ g/ml).Adopt alkaline process to extract plasmid.Can cut out with two enzymes (BamH I and Sal I), PCR also can amplify the positive clone of clone of the segmental plasmid of about 351bp size simultaneously.Detecting the positive colony that obtains by this method is pBin438B (Figure 10).4.2 the structure of the binary vector of sense-rna gene

From N17, cut out the fragment of about 351bp size, obtain positive colony pBin438S. by 4.1 methods

The clone of the non-coding region of embodiment 5 ZhangZhou isolate BBTV DNA 4, sequential analysis and disappearance are transformed the structure of 5.1 non-coding region full-length clones

According to ZhangZhou isolate BBTV DNA 4 complete sequences of having cloned, design primer respectively at non-coding region 5 ' end and 3 ' end.Primer?PRP：GGAATTCATAAGGATATTTACTGCPrimer?PRP41S：CGGGATCCATGGTTCACTGCCTCTTATTT

The pcr amplification condition is: (1) 94 ℃ of 4min.(2) 94 ℃ of 50s, 63 ℃ of 50s, 72 ℃ of 50s, 35 circulations altogether.(3)72℃?10min。

The pcr amplification system is as follows: primer concentration is 10pmol, and dNTPs is 2mmol/L, and Taq plusI is 1u, and the p400 plasmid DNA is 1 μ l, and reaction volume is 50 μ l.

From adopting Primer PRP, reclaim the also fragment of the about 688bp size of purifying in the pcr amplification product of Primer PRP41S, use BamH I and its two ends of EcoR I double digestion then, purifying is through BamH I and the two pBluescript II-KS carriers of cutting of EcoRI simultaneously.Above-mentioned two fragments are connected 12-16h under 16 ℃ temperature, and conversion CaCl ₂The competent cell DH5 α of method preparation.Transformant coated scribble 40 μ l X-gal (20mg/ml), on the LB solid medium of the penbritin of 4ul IPTG (200mg/ml) (60 μ g/ml), in 37 ℃ of incubators, cultivate 12-16h then.Selecting white colony rules on above-mentioned LB solid medium and continue to cultivate 12-16h.Transfer to afterwards and continue to cultivate 12-16h in the LB liquid nutrient medium that contains penbritin (60 μ g/ml).Adopt boiling method or alkaline process to extract plasmid.Can cut out with two enzymes (BamH I and EcoR I), PCR also can amplify the positive clone of clone of the segmental plasmid of about 688bp size simultaneously.Detecting the positive colony that obtains by this method is PP400.Adopt the sequencing kit of USB company that these two positive colonies are carried out manual order-checking then, and carry out sequencing analysis.Sequencing analysis shows: among the PP400 among cloned sequence and the P400 non-coding area sequence row in full accord, its sequence total length is 688nt.5.2 first disappearance of non-coding region is transformed clone's structure

Design of primers: Primer PRP41P:GGAATTCTGTACGGGAAAGTGATCPrimer PRP41S:CGGGATCCATGGTTCACTGCCTCTTATTT

The pcr amplification condition is: (1) 94 ℃ of 4min.(2)94℃?30s，63℃?30s，72℃30s。35 circulations altogether.(3)72℃?10min。The pcr amplification system is with 7.1.

From adopting Primer PRP41P, reclaim in the pcr amplification product of PrimerPRP41S and the fragment of the about 351bp size of purifying, and adopt 5.1 method to obtain positive colony PRP413.Sequencing analysis shows among the PRP413 that non-coding region 3 ' end parts sequence is in full accord in the cloned sequence and P400, and its sequence total length is 351nt.5.3 second disappearance of non-coding region transformed clone's structure

Primer: Primer PRP42P:GGAATTCCATCACGTGCAACTAACPrimer PRP41S:CGGGATCCATGGTTCACTGCCTCTTATTT

The pcr amplification condition is: (1) 94 ℃, and (2) 94 ℃ of 4min, 25s, 63 ℃, 25s, 72 ℃, 25s.35 circulations altogether.(3)72℃，10min。The pcr amplification system is with 7.1.

From adopting Primer PRP42P, reclaim in the pcr amplification product of PrimerPRP41S and the fragment of the about 240bp size of purifying, and adopt 5.1 method to obtain positive colony PRP422.Sequencing analysis shows among the PRP422 that non-coding region 3 ' end parts sequence row are in full accord in the cloned sequence and P400, and its sequence total length is 240nt.

：[1] Harding R M et al. ( 1991 ) Journal of General Virology 72：225-230[2] Thomas J.E et al. ( 1991 ) Journal of General Virology 72：217-224[3] Harding R M et al. ( 1993 ) Journal of General Virology 74：323-328[4] Burns T.M et al. ( 1994 ) Arch Virol.137：371-380[5] Karan M et al. ( 1994 ) Journal of General Virology 75：3541-3546[6] Xie W S et al. ( 1995 ) Photopathology 85：339-347[7] Burns T.M et al. ( 1995 ) Journal of General Virology 76：1471-1482[8] Wanitchakorn R et al. ( 1997 ) Arch Virol 142：1673-1680[9] Dugdale B et al. ( 1998 ) Journal of General Virology 79：2301-2311[10] ( 1997 ) 37：252-257[11] ( 1999 ) 15：55-63

Claims (10)

1. An abaca bunchy top virus (Banana Bunchy Top Virus, BBTV) open reading frame of Chinese ZhangZhou isolate gene group 1 is characterized in that length for having 861 Nucleotide, the proteinic aminoacid sequence of its coding 33kDa is:

   M?A?R?Y?V?V?C?W?M?F?T?I?N?N?P?A?S?L?P?V?M?R?D?E?I?K?Y?M?V?Y?Q?V?E34

   R?G?Q?E?G?T?R?H?V?Q?G?Y?V?E?M?K?R?R?S?S?L?K?Q?M?R?G?F?F?P?G?A?H?L67

   E?K?R?K?G?S?Q?E?E?A?R?A?Y?C?M?K?E?D?T?R?I?E?G?P?F?E?F?G?A?F?K?L?S100

   C?N?D?N?L?F?D?V?I?Q?D?M?R?E?A?H?K?R?P?L?E?Y?L?Y?D?C?P?N?T?F?D?R?S133

   K?D?T?L?Y?R?V?Q?A?E?L?N?K?T?K?A?M?N?S?W?K?T?S?F?N?A?W?T?S?E?V?E?N166

   I?M?A?E?P?C?Y?R?S?I?I?W?V?Y?G?P?N?E?G?E?G?K?P?T?Y?A?K?Y?L?M?K?P?K199

   N?A?F?Y?S?P?G?G?K?S?L?D?I?C?R?L?Y?N?Y?E?D?I?V?I?F?D?I?P?R?C?K?E?E232

   Y?L?N?Y?G?L?L?E?E?F?K?N?G?I?I?Q?S?G?K?Y?E?P?V?L?K?I?V?E?Y?V?E?V?R265

   L M A N F L P K E G I F S E D R I K L V A C and length are for having 129 Nucleotide, and the aminoacid sequence of its coding 5kDa small protein matter is:

   M?I?I?Y?L?M?S?Y?R?I?C?V?K?L?I?N?G?L?W?N?I?Y?M?I?V?R?I?P?S?T?E?V?R34

   I?H?Y?T?E?C?K?Q?S
2. 2. its nucleotides sequence of the proteinic amino acid of coding 33kDa of the Chinese ZhangZhou of BBTV according to claim 1 isolate gene group 1 is classified as:

   ATGGCGCGAT?ATGTGGTATG?CTGGATGTTC?ACCATCAACA?ATCCCGCTTC?GCTACCAGTG61

   ATGCGGGATG?AGATTAAATA?TATGGTATAT?CAAGTGGAGA?GGGGACAGGA?GGGTACTCGT121

   CATGTGCAAG?GATACGTCGA?GATGAAGAGA?CGAAGCTCTC?TGAAGCACAT?GAGAGGCTTC181

   TTCCCAGGCG?CACACCTTGA?GAAACGAAAG?GGGAGCCAAG?AGAGAGCACG?GGCTTACTGT241

   ATGAAGGAAG?ATACAAGAAT?CGAAGGTCCC?TTCGAGTTTG?GTGCATTTAA?ATTGTCATGT301

   AATGATAATT?TATTTGATGT?CATACTGGAT?ATGCGTGAAG?CTCATAAACG?GCCTCTGGAA361

   TATTTATATG?ATTGTCCGAA?TACCTTCCAC?AGAAGTAAGG?ATACATTATA?CAGAGTGCAA421

   GCAGAGCTGA?ATAAAACGAA?GGCGATGAAT?AGCTGGAAGA?CATCCTTCAA?TGCATGGACA481

   TCTGAAGTAG?AAAATATTAT?GGCGGAGCCA?TGTTATCGAA?GCATTATTTG?GGTCTATGGC541

   CCAAATGAAG?GTGAAGGAAA?GCCAACCTAT?GCAAAATATT?TAATGAAGCC?TAAGAATGCG601

   TTTTATTCGC?CAGGAGGAAA?ATCATTGGAT?ATATGTAGAT?TGTATAATTA?TGAGGATATA661

   GTTATATTTG?ATATTCCCAG?ATGCAAGGAG?GAATATTTAA?ACTATGGTTT?ATTAGAAGAA721

   TTTAAAAATG?GAATTATTCA?AAGCGGGAAA?TATGAACCCG?TTTTGAAAAT?TGTAGAATAT781

   GTGGAAGTCA?GGCTAATGGC?TAACTTCCTT?CCGAAGGAAG?GAATCTTTTC?TGAAGATCGA841

   ATAAAGCTAG TTGCTTGCTG A and its nucleotides sequence of coding 5kDa small protein matter amino acid are classified as:

   ATGATAATTT?ATTTGATGTC?ATACTGGATA?TGCGTGAAGC?TCATAAACGG?CCTCTGGAAT61

   ATTTATATGA?TTGTCCGAAT?ACCTTCCACA?GAAGTAAGGA?TACATTATAC?AGAGTGCAAG121

   CAGAGCTGA
3. 3. the open reading frame of BBTV China ZhangZhou isolate gene group 4 is characterized in that length for having 351 Nucleotide, and the proteinic aminoacid sequence of its coding 15.5kDa is:

   M?A?L?T?T?E?R?V?K?L?F?F?E?W?F?L?F?I?G?A?I?F?I?A?I?T?I?L?Y?I?L?L?A?34

   L?L?F?E?V?P?K?Y?I?K?E?V?V?K?Y?L?V?E?Y?M?T?R?R?R?V?W?M?Q?K?T?Q?L?T?67

   E?A?T?G?D?A?E?L?V?R?G?I?V?E?E?R?R?D?Q?Q?A?A?I I?P?Q?A?S?H?V?N?P?S100

   Q?A?R?R?D?D?Q?G?R?R?G?N?I?G?P?M?F
4. 4. its nucleotides sequence of the proteinic amino acid of coding 15.5kDa of the Chinese ZhangZhou of BBTV according to claim 3 isolate gene group 4 is classified as:

   ATGGCATTGA?CAACAGAGCG?GGTGAAACTA?TTCTTCGAAT?GGTTTCTGTT?TATTGGAGCA61

   ATATTCATTG?CGATAACAAT?ATTATATATA?TTGTTGGCAT?TGCTCTTTGA?GGTTCCCAAG121

   TATATTAAGG?AGGTTGTGAA?GTATCTCGTA?GAATACATGA?CCAGACGACG?TGTATGGATG181

   CAGAAAACGC?AGTTGACGGA?GGCAACCGGA?GATGCAGAGC?TCGTCAGAGG?TATTGTGGAA241

   GAGAGACGCG?ATCAACAAGC?GGCTATCATA?CCACAGGCAA?GTCATGTTAA?CCCTTCTCAA301

   GCAAGAAGGG?ATGACCAAGG?AAGACGAGGA?AACATCGGCC?CTATGTTTTA?A
5. 5. desired nucleotide sequence or partial nucleotide sequence or its complementary sequence in claim 2 and 4, and can be applied to the PCR diagnosis of BBTV.
6. 6. one group of recombinant plasmid, it contains desired nucleotide sequence and inverse kernel nucleotide sequence thereof in claim 2 and 4, and can be applied to cultivate anti-BBTV transgenosis banana plant.
7. 7. BBTV China ZhangZhou isolate gene group 1 intergenic region (non-coding region) is characterized in that its nucleotides sequence classifies as:

   ACACGCTATG?ACAATCGTAC?GATATGACAA?AAGGGGAAAA?GCAAAGATTC?GGGGGAAGAT61

   TGTGCTATCC?TAACGATTAA?GGGCCGCAGG?CCCGTCAAGA?TGGACGACGC?GATCATATGT121

   CCCTAGTTAG?TGCGCCACGT?AAGCGCTGGG?GCTTATTATT?ACCCCCAGCG?CTCGGGACGG181

   GACATTTGCA?TCTATAAATA?GACCTTCCCC?CGCTCCACTA?CAAGATCATC?ATCGACGACA240

   GAA
8. 8. BBTV China ZhangZhou isolate gene group 4 intergenic regions (non-coding region) is characterized in that its nucleotides sequence classifies as:

   TACACTGTAT?TATAATATAC?GAGAATATAA?ATGGATAAGG?ATATTTACTG?CAAACATATA61

   TAAGCGAAAA?TAATATATGT?TGTAAAAGAA?ACATATTGTA?ATATGTGANT?TGTATACGAG121

   TGTTGTATTT?ATAAACTATA?CAACACGCTA?TGACAAACGG?GGAAAAATGA?AGAATCGGGG181

   GTTGATTGGT?CTATCGTATC?GCTTAAGGGC?CGCAGGCCCG?TTGAAATGAT?TCTTTATTAA241

   ACAAATATAC?ATGATATGGA?TAGTTGAATA?TATAAACAAC?TATGTATAAA?TACAACAGAA301

   TGTTGTAAAC?AATAAAATAA?TGAGAAGATA?AGTATATTTG?TACGGGAAAG?TGATCACACC361

   CACCACTTTA?GTGGTGGGTC?ATATGTCCCG?AGTTAGTGCG?CCACGTAAGC?GCTGGGGCTT421

   ATTATTACCC?CCAGCGCTCG?GGACGGGACA?TCACGTGCAA?CTAACAAATG?CACGTGACTG481

   ATATGTATGA?TATAACGGTT?CAATGAACCG?GTATGTGAAG?TTGTAACGAA?ACGTCACGTA541

   TGAAAGAGAC?ATAAACGTGA?CGTAGTCAAA?TGTATTGAAT?AAACATTTGA?CGTCCGGTAG601

   CTTCCGAAGG?AAGCCATGAT?TGCTTCGAGG?CGAAGCAAAA?CATTTATATA?TTGGCCTGAA661

   CTGCTGCCTA?TAAATAAGAG?GCAGTGAA
9. One in claim 7 and 8 desired nucleotide sequence or its disappearance nucleotide sequence or basic complementary sequence degree of variation up to 20% is arranged.
10. 10. one group of recombinant plasmid, it contains desired nucleotide sequence or its disappearance nucleotide sequence and complementary nucleotide sequence thereof in claim 7 and 8, provide it may regulate transcribing of goal gene a goal gene upstream, and composition or tissue-specific expression in unifacial leaf or dicotyledons.

Images