CN1283236C - Application Hehoupu phenol in preparing antitumour multi medicinal tolerant medicine - Google Patents
Application Hehoupu phenol in preparing antitumour multi medicinal tolerant medicine Download PDFInfo
- Publication number
- CN1283236C CN1283236C CN 200410025780 CN200410025780A CN1283236C CN 1283236 C CN1283236 C CN 1283236C CN 200410025780 CN200410025780 CN 200410025780 CN 200410025780 A CN200410025780 A CN 200410025780A CN 1283236 C CN1283236 C CN 1283236C
- Authority
- CN
- China
- Prior art keywords
- honokiol
- cell
- medicine
- kbv200
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to a use of honokiol for preparing drugs for preventing the multidrug resistance of tumors, wherein honokiol has molecular weight of 266.33, a chemical name of 3, 5'-diallyl-4, 2'-dihydroxybiphenyl and a molecular formula of C18H18O2, and has low toxicity for a human body. The prepared honokiol drugs of the present invention comprise preparation acceptable drug excipient or carriers, and are prepared into an intestinal tract combination dosage form or a non-intestinal tract combination dosage form by a known method in the preparation field; the dosage forms mainly comprise liquid preparations, granules, tablets, electuary, pills, capsules and dripping pills or injection. The compound of the present invention can effectively control the generation of tumor vessels by acting on mdr1; honokiol has low toxicity, but clinical antitumor drugs used at present all have high toxicity for a human body; drugs for reversing multidrug resistance is clinically lacked at present, so honokiol has excellent application prospects as a clinical antitumor medicine.
Description
Technical field
The invention belongs to the purposes of native compound, relate to new purposes, relate in particular to the purposes of honokiol in the medicine of preparation artitumor multi-medicine-resistant from honokiol plant extract or synthetic.
Background technology
Honokiol is a kind of native compound that extracts from the plant Cortex Magnoliae Officinalis.Its chemical constitution is as follows:
When honokiol is tested in to bodies such as its antithrombotic, anxieties
(1-5), proving can be by gastrointestinal absorption, and have in the body holdup time long, do not have characteristics such as obvious toxic-side effects.
(Multdrug resistance MDR) is meant tumor cell under chemotherapeutics or other factor effects to tumor multi-medicine drug-resistant, and number of chemical structural similarity or different other drugs are produced drug resistance (6-9).MDR is the major reason of clinical chemotherapy failure, and the cause of the death of most of tumor patients is directly or indirectly relevant with drug resistance, and therefore, seeking multidrug-resistance reversal agent is one of Critical policies of antitumor drug research.The molecular mechanism that tumor multi-medicine drug-resistant forms has number of mechanisms, and wherein topmost mechanism is tumor cell multidrug resistance gene mdr1 high expressed, the coded product of mdr1 be the P-glycoprotein (permeabiliaty-glycoprotein, P-gp).P-gp is a transmembrane protein, the about 170KD of molecular weight, and its function pumps the extracellular to the contrary Concentraton gradient of intracellular medicine just as one " Teat pipette " when consuming ATP, make drug accumulation minimizing in the cell, produces drug resistance.The multiple chemotherapeutics of Shi Yonging comprises that purple three alcohols, anthracene nucleus class, vinca etc. all are substrates of P-gp clinically.Therefore, when tumor cell produces the drug resistance that is caused by the p-gp high expressed, tumor cell will develop immunity to drugs to the different medicine of multiple 26S Proteasome Structure and Function, cause the failure of chemotherapy of tumors.Multiple factor can cause the high expressed of P-gp in the tumor cell, can induce kinds of tumor cells and tumor tissues mdr1 genetic transcription and expression as drug-induced, hypoxia etc.
[4]
Summary of the invention
The purpose of this invention is to provide the purposes of a kind of honokiol in the medicine of preparation artitumor multi-medicine-resistant, the English honokiol by name of this honokiol, CAS number:35354-74-6, molecular weight: 266.33, chemical name is: 3,5 '-diallyl-4,2 '-dihydroxybiphenyl, molecular formula is C
18H
18O
2, little to human toxicity, the honokiol medicine of the present invention's preparation comprises preparation allowable pharmaceutical excipients or carrier, drug prepared also contains other antitumor drug.
Honokiol of the present invention is the application in preparation clinical tumor chemotherapeutics also.
Described honokiol medicine can be made the dosage form of intestinal or non-intestinal combination medicine by this formulation art known method.Dosage form mainly comprises liquid preparation, granule, tablet, electuary, soft gelatin capsule, capsule, drop pill or injection.
The form of medication of preparation mainly comprises oral administration or drug administration by injection.
The beneficial effect of the application of honokiol of the present invention in the preparation antitumor drug is as follows: (1) honokiol can effectively suppress the multidrug resistance of tumor, this compound effects is in mdr1, can effectively control tumor vascular generation, have potential applicability in clinical practice; (2) honokiol toxicity is low, and used clinical antitumor drug all has bigger toxicity to human body at present; (3) the present medicine that lacks the energy reverse multiple drug resistance of tumor clinically, so honokiol has the application prospect of good clinical antineoplastic agent.
Description of drawings
Fig. 1 is the expression of mdr1 gene transcriptional level in sensitive cells KB and mdr cell KBV200.
Fig. 2 is daunorubicin gathering in KB and KBV.
Fig. 3 A is the influence of honokiol to the mRNA content of drug resistant gene mdr1 and hypoxia inducible factor-1 in the KBV200 cell.
Fig. 3 B is the rectangular histogram of honokiol to the influence of the mRNA content of drug resistant gene mdr1 and hypoxia inducible factor-1 in the KBV200 cell.
Fig. 4 A is the influence of honokiol to the protein content of hypoxia inducible factor-1 in the KBV200 cell.
Fig. 4 B is the rectangular histogram of honokiol to the protein content influence of hypoxia inducible factor-1 in the KBV200 cell.
Fig. 5 is the influence of honokiol to drug resistant gene mdr1 product P-gp content in the KBV200 cell.
Fig. 6 A is the influence that honokiol gathers rhodamine 123 in the KBV200 cell.
The rectangular histogram of Fig. 6 B influence that to be honokiol gather rhodamine 123 in the KBV200 cell.
The specific embodiment
The invention will be further described below in conjunction with the drawings and specific embodiments.
Embodiment 1: the human mouth squamous cell carcinoma is the mensuration that the intracellular mdr1 of KB and drug resistance cell strain KBV200 thereof expresses.
(1) experiment material
Cell strain: the human mouth squamous cell carcinoma is that KB and drug resistance cell strain KBV200 thereof are available from Inst. of Hematology, Chinese Academy of Medical Sciences.
Reagent: honokiol is available from Nat'l Pharmaceutical ﹠ Biological Products Control Institute.
Instrument: electrophresis apparatus, ultraviolet imagery instrument.
(2) experimental technique
Cell culture: KB and KBV200 cell are cultivated under 37C, 5%CO2 condition with 10% calf serum RPMI RPMI-1640 (U.S. Sigma company).Drug-resistant cell strain KBV200 is the persister that vincristine is induced foundation, maintains stable growth in the 200ng/ml vincristine (VCR), and experiment drug withdrawal the last week is cultivated.
Reverse transcription polymerase chain reaction,PCR (RT-PCR): detect the expression of MDR gene mdr1, β-actin (actin) is as internal reference.Total RNA extracts test kit Trizol extracting with RNA and reference reagent box description is operated.Get the cell of 1 * 10-5/ml respectively, adopt RNA to extract test kit Trizol (American I nvitrogen company) reagent and extract total RNA by operating instruction, measure through ultraviolet spectrophotometer, it is quantitative to carry out RNA.Adopt the reverse test kit of U.S. Promega company, carry out cDNA by its method explanation and synthesize.RNA 2ug in the reaction system, AMV-RT buffer 4ul, RNA enzyme inhibitor RNasin 20U, dNTP 2ul, cDNA primer 50pmol/L, enzyme transcriptase AMV 20U, 25mmol/L MgCl
24ul put the 37C water-bath 60 minutes, 10 minutes synthetic cDNA of 95C.MDR1 primer upstream sequence 5 ' TGTACCCATCATTGCAATAGCAGG3 ', downstream sequence is 5 ' ATATGTTCAAACTTCTGCTCCTGA3 ', intervening sequence length is 164bp.The PCR reaction system of 25ul, contain 5 * PCR reactant liquor 5ul, each 7.5pmol/L of upstream and downstream primer, 1.5U Taq enzyme and 50ng cDNA, reaction condition be 95 ℃ of 5 minutes → 1 circulation 95 ℃ 1.5 minutes 58 ℃ 1 minute, 72 ℃ 3 minutes → 33 circulations { 95 ℃ 0.75 minute, 58 ℃ 1 minute, 72 ℃ 1 minute → 1 circulation 95 ℃ 0.75 minute, 58 ℃ 1 minute, 72 ℃ 3 minutes → 72 ℃ of 7 minutes → 4 ℃ maintenances.β-actin is as internal reference, PCR system with MDR1, forward primer is 5 ' AGGCCAACCGCGAGAAGATGACC3 ', downstream primer is 5 ' GAAGTCCAGGGCGACGTAGCAC3 ', the upstream and downstream primer sequence is spaced apart 350bp, and reaction condition is 95 ℃ of 5 minutes → 25-28 circulation { 95 ℃ 20 seconds → 55 ℃ 20 seconds → 72 ℃ 30 seconds → 72 ℃ 7 minutes → 4 ℃ maintenances.
(3) experimental result
Referring to Fig. 1, wherein M is a molecular weight marker.RT-PCR detects the expression of mdr1 gene transcription level and finds that KB is negative, and KBV200 is a strong positive, illustrates that the KBV cell is the multidrug resistance cell of P-gp high expressed.
Embodiment 2: daunorubicin is in KB and KBV200 cell inner accumulated.
(1) experiment material
Cell strain: the human mouth squamous cell carcinoma is that KB and drug resistance cell strain KBV200 thereof are available from Inst. of Hematology, Chinese Academy of Medical Sciences.
Reagent: honokiol is available from Nat'l Pharmaceutical ﹠ Biological Products Control Institute.Daunorubicin (DNR) is a Zhejiang Haizheng Pharmaceutical Co company limited product.
Instrument: U.S. BECTON DICKSON (BD) flow cytometer.
(2) experimental technique
Cell culture: KB and KBV200 cell provide by the Zhejiang University institute of oncology, cultivate under 37C, 5%CO2 condition with 10% calf serum RPMI RPMI-1640.Drug-resistant cell strain KBV200 is the persister that vincristine is induced foundation, maintains stable growth among the 200ng/ml VCR, and experiment drug withdrawal the last week is cultivated.
It is anthracene nucleus medicament that flow cytometer detects interior DNR content: the DNR of cell, has the characteristics of autofluorescence.Can adopt flow cytometer to detect DNR content in the fluorescence spectrometry cell, (fluore cent second inten ity second FI) represent the relative amount of the interior DNR concentration of cell with the DNR fluorescence intensity.KB and KBV200 cell make 1 * 10 respectively
6Cell suspension adds 2ug/ml DNR, at 37 ℃, 5%CO
2Hatch 1h under the condition, centrifugal, cold phosphate buffer (PBS) washing 2 times, row flow cytometer (FCM) detects.
(3) experimental result
With the fluorescent value in FCM counting 10,000 cells, the result shows that DNR content is starkly lower than the KB cell in the KBV200 cell.Come comparison from the fluorescence average, KB fluorescence average is 1000.6, KBV200 then has only 200.2, KB is about 5 times of KBV200, referring to Fig. 2, all add 2ug/mlDNR in KB and the KBV200 cell, wherein scheming the interior DNR fluorescence average of a:KBV200 cell is 200.2, and the intracellular DNR fluorescence of figure b:KB average is 1000.6.Can find out that in view of the above KBV200 can effectively efflux DNR by P-gp,
Embodiment 3: honokiol is to the inhibitory action of mdr1 and hypoxia inducible factor mRNA expression
(1) experiment material
Cell strain: the human mouth squamous cell carcinoma is that KB and drug resistance cell strain KBV200 thereof are available from Inst. of Hematology, Chinese Academy of Medical Sciences.
Reagent: honokiol is available from Nat'l Pharmaceutical ﹠ Biological Products Control Institute.Daunorubicin (DNR) is a Zhejiang Haizheng Pharmaceutical Co company limited product.
Instrument: electrophresis apparatus, ultraviolet imagery instrument, cell culture incubator.
(2) experimental technique
Cell culture: the KBV200 cell inoculation is in 40ml glass culture bottle, with the RMPI-1640 culture medium that contains 10% calf serum, be positioned over 37 ℃, 5%CO
2The feather cockscomb of incubating cultivate; Successively decrease with the vincristine of 120-40ng/ml and to keep drug resistance, be used for experiment after the drug withdrawal in two days; With 0.25% pancreatin-0.02% diethylamine tetraacethyl (EDTA) digestion, normal saline was washed 2 times when cell proliferation to 90% was full, and the centrifugal residual back of pancreatin of going is made into 1 * 10 with fresh culture
5The cell suspension of/ml; Get 500ul and be inoculated in 24 orifice plates and make PCR and detect, or get 2000ul and be inoculated in that 6 orifice plates are made FCM and western blotting (Western Blot) detects; Cultured cell made adherent in about 24 hours before the experiment.
Cell grouping: cell is divided into normal oxygen group (N) organizes greatly with hypoxia group (H) two.Hypoxia group 100uMCoCl
2(chlorination Cobalt) simulation; Concentration according to honokiol respectively is divided into 3 groups then, be respectively N0, N1, N5 and H0, H1, H5, wherein the concentration of the numeric representation honokiol after the N/H is represented normal oxygen group honokiol concentration 1ug/ml as N1, H1 represents hypoxia group honokiol concentration 1ug/ml, and the rest may be inferred.
RT-PCR: fresh culture dilutes honokiol mother solution (5mg/ml), makes into the working solution of 0-5ug/ml, fully changes cell culture fluid with this behind the mixing, places 5%CO
2, 37 ℃ incubate feather cockscomb and cultivate; Continuous culture is 12 hours after the normal oxygen group dosing, and hypoxia group is cultivated after 1 hour and added CoCl
2Solution makes into final concentration 100uM, continues to cultivate 11 hours; Get the cell of 1 * 10-5/ml respectively, adopt Trizol (Invitrogen company) reagent to extract total RNA by operating instruction, measure through ultraviolet spectrophotometer, it is quantitative to carry out RNA.Adopt the reverse test kit of Promega company, carry out cDNA by its method explanation and synthesize.RNA 2ug in the reaction system, AMV-RT buffer 4ul, RNA enzyme inhibitor (Rnasin) 20U, dNTP 2ul, cDNA primer 50pmol/L, reverse transcriptase AMV 20U, 25mmol/L MgCl
24ul put the 37C water-bath 60 minutes, 10 minutes synthetic cDNA of 95C.
The primer sequence of table 1:mdr1, hypoxia inducible factor-1 (HIF-1) and that contrast β-actin:
| Primer | Forward primer (5 '-3 ') | Downstream primer (5 '-3 ') | PCR product (base pair bp) |
| HIF-1α MDR1 β-actin | CCAGTTACGTTCCTTCGATCAG TGTACCCATCATTGCAATAGCAGG AGGCCAACCGCGAGAAGATGACC | TCACCAAACAGAGCAGGAAAAG ATATGTTCAAACTTCTGCTCCTGA GAAGTCCAGGGCGACGTAGCAC | ?143 ?165 ?350 |
The PCR condition:
HIF-1:94 ℃ 5 minutes → 35 circulations { 94 ℃ 30 seconds → 54 ℃ 30 seconds → 72 ℃ 30 seconds } → 72 ℃ of 5 minutes → 4 ℃ preservations
MDR1:95 ℃ 5 minutes → 1 circulation 95 ℃ 1.5 minutes 58 ℃ 1 minute, 72 ℃ 3 minutes → 33 circulations 95 ℃ 0.75 minute, 58 ℃ 1 minute, 72 ℃ 1 minute → 1 circulation 95 ℃ 0.75 minute, 58 ℃ 1 minute, 72 ℃ 3 minutes → 72 ℃ of 7 minutes → 4 ℃ maintenances.
β-actin:95 ℃ of 5 minutes → 25-28 circulation { 95 ℃ 20 seconds → 55 ℃ 20 seconds → 72 ℃ 30 seconds → 72 ℃ 7 minutes → 4 ℃ maintenances.
(3) experimental result
Be provided with 0,1 and three concentration of 5ug/ml when detecting chemical hypoxia and normal oxygen honokiol to the influence of KBV200 cell multidrug resistance.Referring to the normal oxygen of Fig. 3 A:N; H chemistry hypoxia is promptly used CoCl
2Handle; The Honokiol honokiol; β-actin is a beta-actin; MDR1 is a multidrug resistance gene; HIF-1 α is hypoxia inducible factor-1 α.The horizontal HIF-1 α of KBV200 cell base mRNA expression is lower, CoCl
2(100uM) obviously raise HIF-1 α and MDR1mRNA and express, the gray value of PCR product electrophoretic band increases by 48.5% and 35.7% respectively.During normal oxygen, the honokiol concentration dependent suppresses HIF-1 α mRNA expresses, and the suppression ratio during 1ug/ml is 84%, and the honokiol inhibition that HIF-1 α mRNA expresses during to chemical hypoxia is remarkable equally, and the suppression ratio during 1ug/ml reaches 90%.Honokiol is basic and HIF-1 α-cause to the trend that influences of KBV200 cell MDR1mRNA: CoCl
2(100uM) effect 11hr raises the MDR1mRNA expression second, and the PCR product increases by 36% than foundation level.The expression of MDR1mRNA when the honokiol concentration dependent is reduced normal oxygen and chemical hypoxia, referring to Fig. 3 A and Fig. 3 B, among Fig. 3 B: a is the influence that honokiol is expressed HIF-1mRNA; B is the influence that honokiol is expressed MDR1 mRNA; N0 represents normal oxygen; N1 and N5 are illustrated in and add 1 and 5 μ g/ml honokiols under the normal oxygen; H0, H1, H5 are illustrated in CoCl
2Handle and add 0,1,5 μ g/ml honokiols simultaneously.But the amplitude of downward modulation during hypoxia is bigger, and 5ug/ml concentration suppression ratio when chemical hypoxia reaches 98%, and same concentration suppression ratio when normal oxygen is 51%.
Embodiment 4: honokiol downward modulation hypoxia inducible factor-1 α gathering in the KBV cell.
(1) experiment material
Cell strain: human mouth scale cancer drug resistance cell strain KBV200 is available from Inst. of Hematology, Chinese Academy of Medical Sciences.
Reagent: honokiol, Chinese medicine and biological product are identified institute; Polyvinylidene fluoride film (PVDF) film (Bio-Rad company), sheep anti-mouse antibody (the KPL of horseradish peroxidase (HRP) labelling, the U.S.), mouse-anti people HIF-1 α (NeoMarkers, the U.S.), chemiluminescence detection system ECL reactant liquor (SantaCruz company), protein determination test kit (DC Protein Assay Kit, Bio-Rad company), immunohistochemistry test kit (Foochow steps new company).
Instrument: culture bottle, culture plate, CO2 gas incubator, electrophresis apparatus, electricity changes the film instrument.
(2) experimental technique: cell culture: grouping: be divided into 5 groups according to different honokiol concentration, respectively with 1,2,3,4,5 expressions.1 group is contrast; 2 groups add CoCl
2(150uM); 3 groups of CoCl
2(150uM)+honokiol 0.1ug/ml; 4 groups of CoCl
2(150uM)+honokiol 0.5ug/ml; 5 groups of CoCl
2(150uM)+honokiol 1ug/ml.
Drug-induced: KBV200 cell 2 * 10
4Every hole is inoculated in 24 orifice plates, 3 every group multiple holes; With the RPIM1640 culture medium dilution honokiol storage liquid (5mg/ml) that contains 3% calf serum, fully mixing is made into desired concn, and changes cell culture fluid with this; Drug effect added CoCl after 1 hour
2(except the matched group), making its final concentration is 150uM, continues to cultivate 3 hours.Collecting cell extracts RNA or protein, does western blotting (Western Blot) and detects intracellular HIF-1 protein content.
Western blot: collect cultured cell, wash twice with normal saline, cell precipitation adds 1 * protein extraction buffer (protein extract buffer), dispel, boiled in the boiling water 15 minutes, centrifugal 20 minutes of 13000 rotating speeds (rpm) are got supernatant and are measured protein concentration (being undertaken by DC Protein Assay Kit description).Get protein extract 50ug, add 2 * SDS sample-loading buffer of equivalent, 100 ℃ were boiled 5 minutes, do sodium lauryl sulfate-polypropylene acyl ammonia gel (SDS-PAGE) electrophoresis, spacer gel constant voltage 50V, separation gel constant voltage 100V, electrophoresis to bromophenol blue dyestuff arrives the gel forefront, stops electrophoresis.
Change film: electrophoresis is taken off glue after finishing, and gel is dipped in an amount of commentaries on classics film buffer (Transferbuffer) balance 30 minutes.Intercepting simultaneously is polyvinylidene fluoride film (PVDF) film and 2 3M filter paper of size suitably, pvdf membrane is soaked in absolute methanol earlier, together be dipped among the Transferbuffer with filter paper then, balance 10～15 minutes, film is put anode, glue is put negative electrode, 2 3M filter paper are respectively filled up on the two sides, constant current 110mA, and 4 ℃ of chromatography cabinet transfer films spend the night.
Sealing: sealing is 1 hour in the buffer (TBST) that commentaries on classics is had proteic film to be dipped in to contain 10% defatted milk powder.Hybridization: take out the film that has sealed, be dipped in 1 then: among the mouse-anti people HIF-1 of 400-500 dilution (with the buffer (TBST) that contains 5% defatted milk powder, pH7.4 preparation), 4 ℃ are spent the night, TBST rinsing 5 minutes * 5 times, be dipped in the sheep anti-mouse igg antibody (with the TBST that contains 5% defatted milk powder, pH 7.4 preparations) of horseradish peroxidase (HRP) labelling of dilution in 1: 10000 TBST rinsing 5 minutes * 5 times again.
Tabletting, develop a film: take out film, preparation colour developing liquid (ECL A liquid 0.7ml+ECL B liquid 0.7ml) is added on the film, inhales after 5 minutes and removes unnecessary liquid, and preservative film envelope film is fixed in the magazine, and tabletting is developed a film.
(3) experimental result:
Embodiment 5: the influence that honokiol is expressed KBV200 cell P-gp
(1) experiment material
Cell strain: human mouth scale cancer drug resistance cell strain KBV200 is available from Inst. of Hematology, Chinese Academy of Medical Sciences.
Reagent: honokiol is available from Nat'l Pharmaceutical ﹠ Biological Products Control Institute.The mouse-anti people P-gp monoclonal antibody of FITC labelling is U.S. BECTON DICKSON (BD) company product.
Instrument: cell culture incubator, flow cytometer.
(2) experimental technique
Flow cytometer FCM detects KBV200 cell surface P-pg and expresses: cell is handled: the KBV200 cell inoculation is in 6 orifice plates, every hole 2 * 10
5Cell is cultivated and was made adherent in 24 hours; Fresh culture dilutes honokiol mother solution (5mg/ml), makes into the working solution of 0-5ug/ml, fully changes cell culture fluid with this behind the mixing, places 5%CO
2, 37 ℃ incubate feather cockscomb and cultivate; Continuous culture is 12 hours after the normal oxygen group dosing, and hypoxia group adds the cultivation of variable concentrations honokiol and adds CoCl after 1 hour
2Solution makes into final concentration 100uM, continues to cultivate 11 hours.Collecting cell: discard culture fluid, the ice normal saline is washed 2 times, adds 0.125% pancreatin effect about 30 seconds, pancreatin is removed in suction, and every hole adds 1000ul ice normal saline collecting cell, and 4 ℃ centrifugal, the ice normal saline is washed 2 times, and cell precipitation is dissolved in the 500ul glacial phosphoric acid buffer (PBS), puts standby on ice.Antibody incubation: cell suspension adds fluorescently-labeled mouse-anti people P-gp monoclonal antibody (dilution in 1: 500), and 4 ℃ of lucifuges were hatched 30 minutes, washed 3 times with the PBS that contains 1% calf serum, and 4 ℃ of lucifuges were reacted 20 minutes, and PBS washes 3 times, makes cell suspension with PBS at last.Flow cytometer detects: fluorescence exciting wavelength 488nm, emission wavelength 530nm, counting MDR positive cell number, and the fluorescence intensity on positive cell surface, several 10000 cells of every batch total.Analyze: estimate CoCl
2(100uM) chemical hypoxia influence that KBV200 cell P-gp is expressed, and honokiol during to normal oxygen and chemical hypoxia P-gp express effect (suppression ratio).
(3) experimental result
Honokiol 0,1 and 5ug/ml act on normal oxygen and chemical hypoxia group KBV200 cell respectively, and cell suspension detects the proteic expression of film surface P-gp with flow cytometer after fluorescent antibody is hatched.Be illustrated in the honokiol that adds 0,1 and 5 μ g/ml under the normal oxygen referring to Fig. 5: N0, N1 and N5, H0, H1, H5 is illustrated in CoCl
2During processing, add 0,1,5 μ g/ml honokiols simultaneously, Fluorescent intensity is a fluorescence intensity.The chemistry hypoxia obviously strengthens the fluorescence intensity of KBV200 surface of cell membrane P-gp antibody, and fluorescent value is compared with matched group and strengthened 16.6%.The honokiol concentration dependent is reduced normal oxygen group P-gp protein expression, and the suppression ratio of matched group is respectively 44.1% and 74.3%.The P-gp that honokiol 1ug/ml and 5ug/ml significantly reduce due to the chemical hypoxia raises, and suppression ratio is respectively 84.1% and 85.4%.During 1ug/ml concentration, the following modulation that honokiol is compared normal oxygen group to the downward modulation of chemical hypoxia group P-gp is big, the former is 1.9 times of the latter, and during 5ug/ml, downward modulation percentage rate to chemical hypoxia group and normal oxygen group is respectively 85.4% and 74.3%, ratio between the two is 1.1, during obviously than 1ug/ml little (referring to table 1).This result proves absolutely that honokiol all can suppress the expression of P-gp at normal oxygen and chemical hypoxia, and is dose dependent.
Embodiment 6: honokiol is to the influence of drug accumulation in the MDR cell KBV200 cell.
(1) experiment material
Cell strain: human mouth scale cancer drug resistance cell strain KBV200 is available from Inst. of Hematology, Chinese Academy of Medical Sciences.
Reagent: honokiol is available from Nat'l Pharmaceutical ﹠ Biological Products Control Institute.Fluorescein rhodamine 123 (Rh123) is a U.S. Sigma company product.
Instrument: cell culture incubator, fluorescence microscope.
(2) experimental technique
The influence that honokiol gathers Rh123 in the KBV200 cell
Drug-induced: the KBV200 cell inoculation is in 6 orifice plates, every hole 2 * 10
5Cell is cultivated and was made adherent in 24 hours; Fresh culture dilutes honokiol mother solution (5mg/ml), makes into the working solution of 0-5ug/ml, fully changes cell culture fluid with this behind the mixing, in 5%CO
2, 37 ℃ incubate feather cockscomb and cultivated 12 hours.Rh123 is hatched: discard culture fluid, and about 30 seconds of 0.125% pancreatin effect, the centrifugal pancreatin of removing is made cell suspension with fresh medium; Add the Rh123 of 0.8%ug/ml, hatched 1 hour for 37 ℃; Cell smear is made: collecting cell → 4 are ℃ centrifugal, the ice normal saline wash 2 times → add an amount of normal saline to make cell suspension → drip in right amount on microscope slide, getting rid of the sheet machine, to get rid of sheet → put into the lucifuge box standby.Fluorescence microscope: fluorescence exciting wavelength 488nm, detect wavelength 513nm.Respectively at 100 * and 400 * mirror under get 3 visuals field that fluorescence is the strongest and take the photograph sheet.Analyze: get 3 the strongest visuals field of fluorescence for every group, handle, obtain the average gray value of 3 visual field total fluorescence intensities, make rectangular histogram, and do the T check and ask the significant difference degree with average gray value with Scion Image image software.
(3) experimental result
The situation of gathering of Rh123 in honokiol 1ug/ml and the 5ug/ml pretreatment KBV200 cell 12 hours, fluorescence microscope cell.Referring to Fig. 6 A and Fig. 6 B, among Fig. 6 A: a is susceptibility cell KB; B is multidrug resistance cell KBV200; C is that KBV200 handles through 1 μ g/ml honokiol; D is that KBV200 handles through 5 μ g/ml honokiols.Among Fig. 6 B: KB represents susceptibility cell KB; KBV-H0 represents multidrug resistance cell KBV200+0 μ g/ml honokiol; KBV-H1 represents multidrug resistance cell KBV200+1 μ g/ml honokiol; KBV-H5 represents multidrug resistance cell KBV200+5 μ g/ml honokiol.A little less than gathering very without the intracellular fluorescence of the KBV200 of drug treating, total fluorescence intensity has only 5.4% of its sensitive strain KB cell.The honokiol dose dependent increases fluorescence intensity in the cell, during 1ug/ml concentration gathering of Rh123 is increased by 200% (P＜0.01), increases by 275% (P＜0.01) during 5ug/ml concentration.These presentation of results: after honokiol was handled the KBV200 cell, intracellular P-gp expressed and is suppressed, and the result shows as the minimizing that effluxes of Rh123, and promptly Rh123 increases intracellular the gathering of KBV200.
In sum, the P-gp that honokiol can suppress under normal oxygen and the hypoxia condition effectively expresses, owing to the high expressed of P-gp is a kind of main and modal reason of multidrug resistance, and the clinical tumor chemotherapy lacks the medicine of effectively reverse and prophylaxis of tumours multidrug resistance at present, and honokiol has very big potential applicability in clinical practice.
The partial reference document that the present invention relates to:
1.Liou?KT，Shen?YC，Chen?CF，Tsao?CM，Tsai?SK.The?anti-inflammatory?effect?of?honokiol?on?neutrophils：mechanisms?in?the?inhibition?of?reactive?oxygen?species?production.Eur?J?Pharmacol.2003；475(1-3)：19-27
2.Teng?CM，Chen?CC，Ko?FN，Lee?LG，Huang?TF，Chen?YP，Hsu?HY.Two?antiplatlet?agents?from?Magnoliaofficinalis.Thromb?Res.1988；50：757-765
3.Liou?KT，Lin?SM，Huang?SS，Chih?CL，Tsai?SK.Honokiol?ameliorates?cerebral?infraction?fromischemia-reperfusion?injury?in?rats.Planta?Med.2003；69(2)：130-134
4.Lo?YC，Teng?CM，Chen?CF，Chen?CC，Hong?CY.Magnolol?and?honokiol?isolated?from?Magnolia?officinalisprotect?rat?heart?mitochondria?against?lipid?peroxidation.Biochem?Pharmacol.1994；47：549-553
5.Watanabe?K，Watanabe?H，Goto?Y，Yamaguchi?M，Yamamoto?N，Hagino?K.Pharmacological?properties?ofmagnolol?and?honokiol?extracted?from?Magnolia?officinalis：central?depressant?effects.Planta?Med.1983；49：103-108
6.Juliano?RL，Ling?V.?A?surface?glycoprotein?modulating?drug?permeability?in?Chinese?hamsterovary?cell?mutants.Biochim?Biophys?Acta.1976，455(1)：152-162.
7.Ling?V.?Thompson?LH.Reduced?permeability?in?CHO?cells?as?a?mechanism?of?resistanceto?colchicine.J?Cell?Physiol，1974：83(1)：103-106.
8.Johnsione?RW，Ruefli?AA，Smyth?MJ.Multiple?physiological?functions?for?multidrugtransporter?P-glycoprotein？Trends?Biochem?Sci，2000，25(1)：1-6]
9.Gottesman?MM，Pastan?I.Biochemistry?of?multidrug?resistance?mediated?by?themultidrug?transporter.Annu?Rev?Biochem，1993，62：385-386.
Claims (5)
1. the purposes of honokiol in preparation artitumor multi-medicine-resistant medicine, the molecular weight of described honokiol is: 266.33, chemical name is: 3,5 '-diallyl-4,2 '-dihydroxybiphenyl, molecular formula is C
18H
18O
2, it is characterized in that: drug prepared also contains preparation allowable pharmaceutical excipients or carrier.
2. the purposes of honokiol according to claim 1 in preparation artitumor multi-medicine-resistant medicine, it is characterized in that: drug prepared is an antineoplastic chemotherapy medicine.
3. the purposes of honokiol according to claim 1 and 2 in preparation artitumor multi-medicine-resistant medicine, it is characterized in that: drug prepared also contains other antitumor drug.
4. the purposes of honokiol according to claim 1 and 2 in preparation artitumor multi-medicine-resistant medicine, it is characterized in that: the dosage form of described medicine comprises liquid preparation, granule, tablet or soft gelatin capsule.
5. the purposes of honokiol according to claim 4 in preparation artitumor multi-medicine-resistant medicine, it is characterized in that: the administering mode of described medicine comprises oral administration or drug administration by injection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410025780 CN1283236C (en) | 2004-07-02 | 2004-07-02 | Application Hehoupu phenol in preparing antitumour multi medicinal tolerant medicine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410025780 CN1283236C (en) | 2004-07-02 | 2004-07-02 | Application Hehoupu phenol in preparing antitumour multi medicinal tolerant medicine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1596881A CN1596881A (en) | 2005-03-23 |
| CN1283236C true CN1283236C (en) | 2006-11-08 |
Family
ID=34663844
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410025780 Expired - Fee Related CN1283236C (en) | 2004-07-02 | 2004-07-02 | Application Hehoupu phenol in preparing antitumour multi medicinal tolerant medicine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1283236C (en) |
-
2004
- 2004-07-02 CN CN 200410025780 patent/CN1283236C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1596881A (en) | 2005-03-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106974938A (en) | A kind of the excretion body and its pharmaceutical preparation in the mesenchymal stem cells MSCs source with antihepatocarcinoma effect | |
| CN115364176B (en) | Application of dendrobium-derived nano vesicles in preparation of medicines for preventing and treating atherosclerosis diseases | |
| CN105209028B (en) | The method for treating Fatty Liver Disease | |
| CN106929577A (en) | A kind of lncRNA biomarker related to adenocarcinoma of lung | |
| CN112353797B (en) | Application of indole-3-acetonitrile in preparation of medicine for treating or preventing influenza virus infection | |
| CN104352521B (en) | Prepare the method for calf spleen extract and the application in antitumor and immunological regulation | |
| CN1283236C (en) | Application Hehoupu phenol in preparing antitumour multi medicinal tolerant medicine | |
| CN108329381A (en) | A kind of ten hexapeptides from Eucheuma and its application in preparing prevention Malignant tumor of bonal metastasis drug | |
| Borkar | Mucormycosis: a surge in mucorales fungal infection in post–covid patients in Indian States and insight into known and unknown factors | |
| CN1172677C (en) | Application of astragalin A in preparing medicinal composition | |
| CN106420791A (en) | Application of miR-145-3p in preparing medicines for preventing or treating multiple myeloma disease | |
| CN1621037A (en) | Application of Schisandrin-B in preparing medicine for treating tumor | |
| CN104958306B (en) | Platinum medicine is preparing the application in treating ovarian cancer to compound Hu 17 alone or in combination | |
| Al-Nasrawi | Cutaneous mycoses among Diabetes patients | |
| CN104173325B (en) | Application of the palmitinic acid in preparation treatment liver cancer and anti-liver cancer and anti-diversion medicaments | |
| KR20200064040A (en) | Nanovesicles derived from Blautia bacteria and Use thereof | |
| TW201225953A (en) | Pharmaceutical composition and health food for liver fibrosis, cirrhosis and hepatitis | |
| CN103045715A (en) | Medicament target for treating acute promyelocytic leukemia and inhibitor thereof | |
| CN111773215A (en) | Medicine for treating AML and application thereof | |
| CN111374979A (en) | Medical application of compound in treatment of oral cancer by inducing apoptosis of oral cancer cells | |
| CN107260752B (en) | Synergistic anti-pancreatic cancer pharmaceutical composition | |
| CN1418633A (en) | Anti-cancer assistant medicine contg. 20(S)-protopanaxadiol as effective component, and its application | |
| CN115607606B (en) | Application of capsicum-derived nano vesicles in preparation of drugs for preventing and treating atherosclerosis diseases | |
| CN110664821A (en) | Application of panaxadiol in preparing medicine for inhibiting expression of PD-L1 and tumor cell proliferation protein | |
| CN101057836A (en) | Application of honokiol in preparing medicine for treating acute leukemia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20061108 Termination date: 20130702 |