CN1274824C - Nucleotide specific to O-antigen of shigella boydii 11 and bacillus coli 0105 - Google Patents
Nucleotide specific to O-antigen of shigella boydii 11 and bacillus coli 0105 Download PDFInfo
- Publication number
- CN1274824C CN1274824C CNB031005357A CN03100535A CN1274824C CN 1274824 C CN1274824 C CN 1274824C CN B031005357 A CNB031005357 A CN B031005357A CN 03100535 A CN03100535 A CN 03100535A CN 1274824 C CN1274824 C CN 1274824C
- Authority
- CN
- China
- Prior art keywords
- gene
- nucleotide
- bases
- antigen
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a specific nucleotide to the O-antigens of Shigella bodyii 11 and Escherichia coli 0105. The specific nucleotide is the nucleotide complete sequence of gene clusters in Shigella bodyii 11 for controlling the synthesis of O-antigens. The present invention also comprises the structure of O-antigen gene clusters and the oligonucleotide of glycosyltransferase genes and unit processing genes (comprising wzx genes or genes with the similar functions of wzx, wzy genes or genes with the similar functions of wzy)in the O-antigen gene clusters stemmed from Shigella bodyii 11, and a method for obtaining bacteria O-antigen gene clusters. The present invention verifies that both of the specific nucleotide and the oligonucleotide have high specificity to all of the O-antigens of Shigella bodyii 11 and Escherichia coli 0105 through PCR. The present invention also discloses a method for using the oligonucleotide of the present invention to detect and identify Shigella bodyii 11 and Escherichia coli 0105 in human bodies and environment.
Description
Technical field
The present invention relates to the complete nucleotide sequence of control O-antigen synthetic gene cluster in Shigella bogdii 11 types (Shigella boydii 11), particularly relate in Shigella bogdii 11 types oligonucleotide in the control O-antigen synthetic gene cluster, can utilize these oligonucleotide of O-antigen-specific Shigella bogdii 11 types and the intestinal bacteria O105 (Escherichiacoli O105) in human body and the environment and identify O-antigen in these pathogenic bacterium quickly and accurately.
Background technology
Shigellae is the pathogenic bacterium that grow up along with the human evolution, can attack colon film epithelial cell, causes self limiting pyogenic infection focus, causes human bacillary dysentery.Human have higher susceptibility to Shigellae, only need be less than the infection that ten bacterium just can cause the people, children and adult easy infection, particularly children, easily cause acute poisoning dysentery, and the O-antigen of Shigellae is the one of the main reasons that Shigellae causes disease.
O-antigen is the O specific polysaccharide composition in the gram negative bacterium lipopolysaccharides, and it is made up of many multiple oligosaccharide unit.The antigenic building-up process of O-is studied clearlyer: by glycosyltransferase nucleoside diphosphate monose is transferred on the fat molecule that is fixed on the cell inner membrance earlier, then in the inboard synthesis of oligose unit of inner membrance, the antigenic oligosaccharide unit of O-is transferred to the inner membrance outside by the transhipment enzyme again, then aggregate into polysaccharide by polysaccharase, be connected to again and form lipopolysaccharide molecule [Whitfield, C. (1995) " Biosynthesis of lipopolysaccharide Oantigens " .Trends in Microbiology.3:178-185 on the glycolipid molecule; Schnaitman, C.A.andJ.D.Klena. (1993) " Genetics of lipopolysaccharide biosynthesis inentericbacteria " .Microbiological Reviews, 57 (3): 655-682].Coding is responsible for the generally adjacent arrangement on karyomit(e) of gene of all enzyme molecules of O-antigen synthetic, form a gene cluster [Reeves, P.R., et al. (1996) " Bacterial polysaccharide synthesis and genenomenclature " Trends in Microbiology, 4:495-503].In Shigellae, intestinal bacteria and Salmonellas, O-antigen gene [Lei Wang.et al (2001) " Sequence analysis of four Shigella boydii O-antigen loci:implicationfor Escherichia coli and Shigella relationships " .Infection andImmunity, 11:6923-6930 bunch between galF and gnd gene; Lei Wang and Peter Reeves (2000) " TheEscherichia coli O111 and Salmonella enterica O35 gene clusters:geneclusters encoding the same colitose-containing O antigen are highlyconserved " .Journal of Bacteriology.182:5256-5261].The O-antigen gene bunch contains three genoids: sugared synthesis path gene, glycosyltransferase gene, oligosaccharide unit treatment gene.The required nucleoside diphosphate monose of enzymic synthesis O-antigen of wherein sugared synthesis path genes encoding; Thereby the enzyme of glycosyltransferase gene coding forwards nucleoside diphosphate monose and other molecule to and makes monose aggregate into oligosaccharide unit on the monose; The oligosaccharide unit treatment gene comprises transhipment enzyme gene and pol gene, and they transfer to the bacterium inner membrance outside with oligosaccharide unit, and repolymerization becomes polysaccharide.Glycosyltransferase gene and oligosaccharide unit treatment gene only are present in the gene cluster of carrying these genes.The difference of monose in the O-antigen, between monose between the difference of link button and the oligosaccharide unit difference of link button constituted the antigenic diversity of O-, and the composition of monose, the link button between monose and the link button between the oligosaccharide unit are by the Gene Handling in the O-antigen gene bunch, so the O-antigen gene bunch has determined O-antigenic synthetic, has also determined the antigenic diversity of O-.
Because O-antigen is extremely strong antigen, be one of important paathogenic factor of Shigellae, it has extremely strong diversity again simultaneously, and this enlightens us can study a kind of Shigellae and good, highly sensitive method of the antigenic specificity of O-thereof of detecting quickly and accurately.With surperficial polysaccharide is that the serology immune response of target has been used to somatotype and the evaluation to bacterium always since the thirties in last century, is unique means of identifying pathogenic bacterium.This diagnostic method needs a large amount of antiserum(antisera)s, and the antiserum(antisera) general classes is incomplete, quantity not sufficient, and also there are some difficulties in a large amount of antiserum(antisera)s in preparation with in storing.On the other hand this method length consuming time, sensitivity is low, loss is high, poor accuracy, so, generally believe that now this traditional serology detection method will be that the modern molecular biology method replaces.1993, Luk, J.M.C et.al has identified the O-antigen [Luk of Salmonellas with the specific nucleotide sequence of Salmonellas (S.enterica) O-antigen gene bunch by PCR method, J.M.C.et.al. (1993) " Selective amplification ofabequose and paratose synthase genes (rfb) by polymerase chain reactionfor identification of S.enterica major serogroups (A; B; C2; andD) ", J.Clin.Microbiol.31:2118-2123].Luk, the method for et.al is with corresponding to Salmonellas serotype E 1, D1 obtains the oligonucleotide special to the Salmonellas of different serotypes after the nucleotide sequence of the CDP-abequose in the A, the O-antigen of B and C2 and the synthetic gene of CDP-tyvelose is arranged.1996, Paton, the A.W et.al serotype [" Molecularmicrobiological investigation of an outbreak of Hemolytic-UremicSyndrome caused by dry fermented sausage contaminated with Shiga-liketoxin producing Escherichiacoli " .J.Clin.Microbiol.34:1622-1627] of having identified the toxogenic E.coli O111 of a strain at the oligonucleotide that comes from the wbdI gene of the O-antigen-specific of E.coli O111, but afterwards studies show that Paton, the usefulness of A.W et.al comes from the oligonucleotide of wbdI gene and identifies that the method for the serotype of E.coli O111 has false positive results to occur.Bastin D.A.and Reeves, P.R. think, this is because the wbdI gene is sugared synthesis path gene [the Bastin D.A.andReeves of a supposition, P.R. (1995) Sequence and analysis of the O antigen gene (rfb) cluster of Escherichia coli O111.Gene 164:17-23], and have this sugar in the antigenic structure of the O-of other bacterium, so sugared synthesis path gene is not a high special for O-antigen yet.
Shigellae has 46 kinds of serotypes, intestinal bacteria have 166 kinds of different O-antigens, the two sibship is very near, and it is that intestinal bacteria and Shigellae are total that 12 kinds of O-antigens are arranged, wherein Shigella bogdii 11 types just have identical O-antigen [Ewing with intestinal bacteria O105, W.H. (1986) " Edwardsand Ewing ' s identification of the Enterobacteriaceae " .ElsevierScience Publishers, Amsterdam, The Netherlands; T.cheasty, et al. (1983) " Antigenic relationships between the enteroinvasive Escherichiacoli antigens O28ac; O112ac; O124, O136, O143; O144; O152 and O164 andShigella O antigens " J.clin Microbiol, 17 (4): 681-684], traditional serotype method can not be distinguished them.
Summary of the invention
The Nucleotide that the purpose of this invention is to provide a kind of O-antigen-specific to Shigella bogdii 11 types and intestinal bacteria O105, it is the Nucleotide in the O-antigen gene bunch of Shigella bogdii 11 types, is the special Nucleotide that comes from glycosyltransferase gene and transhipment enzyme gene and pol gene.
A time purpose of the present invention has provided the full length nucleotide sequence of the O-antigen gene bunch of Shigella bogdii 11 types.
Another object of the present invention has provided the gene of the O-antigen gene bunch that constitutes Shigella bogdii 11 types: the gene of transhipment enzyme is the wzx gene or with wzx the gene of identity function is arranged; Pol gene is the wzy gene or with wzy the gene of identity function is arranged; Glycosyltransferase gene comprises orf5, orf7, orf8, orf9, orf10 gene; Sugar synthesis path gene comprises rmlB, rmlD, rmlA, rmlC.
Another purpose of the present invention has provided oligonucleotide, and the gene that they come from encoding glycosyl transferring enzyme in the O-antigen gene bunch of Shigella bogdii 11 types respectively comprises orf5, orf7, orf8, orf9, orf10 gene; The gene that coming from coding transhipment enzyme be the wzx gene or with wzx the gene of identity function, the gene that comes from the coding polysaccharase are arranged is the wzy gene or with wzy the gene of identity function is arranged; They are the oligonucleotide in the said gene, and length is at 10-20nt; They are special to the O-antigen of Shigella bogdii 11 types and intestinal bacteria O105; Especially the oligonucleotide of listing in the table one, they are high specials to the O-antigen of Shigella bogdii 11 types and intestinal bacteria O105, and these oligonucleotide are also reconfigurable, and the oligonucleotide after the combination also is a high special to the O-antigen of Shigella bogdii 11 types and intestinal bacteria O105.
The above-mentioned oligonucleotide that a further object of the present invention provides can be used as primer and is used for nucleic acid amplification reaction, perhaps be used for hybridization as probe, perhaps be used to make gene chip or microarray, thereby detect and identify O-antigen and detection and evaluation Shigella bogdii 11 types and the intestinal bacteria O105 of Shigella bogdii 11 types and intestinal bacteria O105 by these methods.
An also purpose of the present invention has provided the method for the complete sequence of the O-antigen gene bunch that separates Shigella bogdii 11 types.Can obtain the complete sequence of the O-antigen gene bunch of other bacteriums according to present method operation, the complete sequence of the gene cluster of the bacterium of other polysaccharide antigens that also can obtain to encode.
The present invention is by the following technical solutions for achieving the above object:
The present invention is to the Nucleotide of the O-antigen-specific of Shigella bogdii 11 types and intestinal bacteria O105, and it is the isolating Nucleotide shown in SEQ ID NO:1,13367 bases of total length; The base that perhaps has one or more insertions, disappearance or replacement keeps the Nucleotide of the SEQ IDNO:1 of described isolating functional nucleotide simultaneously.
The Nucleotide of aforesaid O-antigen-specific to Shigella bogdii 11 types and intestinal bacteria O105, it is by 11 genomic constitutions, all between galF gene and gnd gene.
The Nucleotide of aforesaid O-antigen-specific to Shigella bogdii 11 types and intestinal bacteria O105, wherein said gene comprises: transhipment enzyme gene comprises the wzx gene or with wzx the gene of identity function is arranged; Pol gene comprises the wzy gene or with wzy the gene of identity function is arranged; Glycosyltransferase gene comprises orf5, orf7, orf8, orf9, orf10 gene; Wherein said orf5 gene is the Nucleotide of 4667 to 5410 bases among the SEQID NO:1; The wzy gene is the Nucleotide of 5432 to 6460 bases among the SEQ ID NO:1; The orf7 gene is the Nucleotide of 6468 to 7310 bases among the SEQ ID NO:1; The orf8 gene is the Nucleotide of 7310 to 8446 bases among the SEQ ID NO:1; The orf9 gene is the Nucleotide of 8443 to 9327 bases among the SEQ ID NO:1; The orf10 gene is the Nucleotide of 9344 to 10327 bases among the SEQ ID NO:1; The wzx gene is the Nucleotide of 10367 to 11794 bases among the SEQ ID NO:1.
The Nucleotide of aforesaid O-antigen-specific to Shigella bogdii 11 types and intestinal bacteria O105 wherein comes from described wzx gene, wzy gene or glycosyltransferase gene orf5, orf7, orf8, orf9, orf10 gene; Or the oligonucleotide in the sugared synthesis path gene; And their mixing or their reorganization.
The Nucleotide of aforesaid O-antigen-specific to Shigella bogdii 11 types and intestinal bacteria O105, the oligonucleotide that wherein comes from the orf5 gene is to being: the Nucleotide of 4882 to 4900 bases among the SEQ ID NO:1 and the Nucleotide of 5283 to 5300 bases; The Nucleotide of 5116 to 5133 bases among the SEQ ID NO:1 and the Nucleotide of 5386 to 5403 bases; The Nucleotide of 4681 to 4697 bases among the SEQ ID NO:1 and the Nucleotide of 5373 to 5390 bases; The oligonucleotide that comes from the wzy gene is to being: the Nucleotide of 5620 to 5638 bases among the SEQ IDNO:1 and the Nucleotide of 5980 to 5998 bases; The Nucleotide of 5517 to 5536 bases among the SEQ IDNO:1 and the Nucleotide of 6323 to 6341 bases; The Nucleotide of 5439 to 5457 bases among the SEQ IDNO:1 and the Nucleotide of 5831 to 5847 bases; The oligonucleotide that comes from the orf7 gene is to being: the Nucleotide of 6578 to 6596 bases among the SEQ ID NO:1 and the Nucleotide of 7014 to 7032 bases; The Nucleotide of 6664 to 6682 bases among the SEQ ID NO:1 and the Nucleotide of 6882 to 6899 bases; The Nucleotide of 6717 to 6735 bases among the SEQ ID NO:1 and the Nucleotide of 6977 to 6995 bases; The oligonucleotide that comes from the orf8 gene is to being: the Nucleotide of 7502 to 7520 bases among the SEQ ID NO:1 and the Nucleotide of 7974 to 7992 bases; The Nucleotide of 8019 to 8036 bases among the SEQ ID NO:1 and the Nucleotide of 8372 to 8391 bases; The Nucleotide of 7376 to 7394 bases among the SEQ ID NO:1 and the Nucleotide of 8219 to 8237 bases; The oligonucleotide that comes from the orf9 gene is to being: the Nucleotide of 8674 to 8691 bases among the SEQ ID NO:1 and the Nucleotide of 9200 to 9218 bases; The Nucleotide of 8814 to 8832 bases among the SEQ ID NO:1 and the Nucleotide of 9139 to 9157 bases; The Nucleotide of 8543 to 8560 bases among the SEQ ID NO:1 and the Nucleotide of 9053 to 9070 bases; The oligonucleotide that comes from the orf10 gene is to being: the Nucleotide of 9727 to 9745 bases among the SEQ ID NO:1 and the Nucleotide of 10308 to 10325 bases; The Nucleotide of 9784 to 9802 bases among the SEQ ID NO:1 and the Nucleotide of 10015 to 10033 bases; The Nucleotide of 9430 to 9457 bases among the SEQ ID NO:1 and the Nucleotide of 10220 to 10239 bases; The oligonucleotide that comes from the wzx gene is to being: the Nucleotide of 10484 to 10502 bases among the SEQ ID NO:1 and the Nucleotide of 10748 to 10765 bases; The Nucleotide of 10599 to 10617 bases among the SEQ ID NO:1 and the Nucleotide of 11509 to 11527 bases; The Nucleotide of 10997 to 11015 bases among the SEQ ID NO:1 and the Nucleotide of 11692 to 11710 bases.
The Nucleotide of aforesaid O-antigen-specific to Shigella bogdii 11 types and intestinal bacteria O105 is detecting the application of expressing the antigenic bacterium of O-, identify other polysaccharide antigen of the O-antigen of bacterium and bacterium in diagnosis.
The recombinant molecule of the Nucleotide of aforesaid O-antigen-specific to Shigella bogdii 11 types and intestinal bacteria O105, and can provide the O-antigen of expressing Shigella bogdii 11 types and intestinal bacteria O105 by inserting to express, and become bacterial vaccine.
The application of the Nucleotide of aforesaid O-antigen-specific to Shigella bogdii 11 types and intestinal bacteria O105, wherein, it is used for PCR, is used for hybridization and fluoroscopic examination or is used to make gene chip or microarray, the bacterium in human body and the environment as probe as primer.
The separation method of the Nucleotide of aforesaid O-antigen-specific to Shigella bogdii 11 types and intestinal bacteria O105 wherein, comprises the steps:
(1) genomic extraction: 37 ℃ of incubated overnight Shigellaes in the LB substratum, centrifugal collecting cell, with Tris-HCl (pH8.0) and EDTA re-suspended cell, 37 ℃ of incubations add N,O-Diacetylmuramidase cracking bacterium after 20 minutes, add Proteinase K and SDS degrade proteins, add RNase again and remove RNA; Use equal-volume phenol and isopyknic phenol then: chloroform: enzyme and albumen is wherein removed in primary isoamyl alcohol (25: 24: 1) extracting, removes remaining phenol with isopyknic ether extracting again; With 2 times of volume ethanol deposit D NA, wash DNA with 70% ethanol after rolling out DNA with glass yarn, at last DNA is resuspended among the 30ulTE, genomic dna detects by 0.4% agarose gel electrophoresis;
(2) by the O-antigen gene in Long pcr amplification Shigella bogdii 11 types bunch: at first according to the JumpStart sequences Design upstream primer (#1523-ATT GTG GCT GCA GGG ATC AAA GAA AT) that often is found in O-antigen gene bunch promoter region, again according to the gnd gene design downstream primer (#1524-TAG TCG CGT GNG CCT GGA TTA AGT TCG C) in O-antigen gene bunch downstream; With the Expand Long Template PCR method of Boehringer Mannheim company amplification O-antigen gene bunch, the PCR response procedures was as follows: 94 ℃ of pre-sex change 2 minutes; 94 ℃ of sex change are 10 seconds then; Annealed 30 seconds for 60 ℃, 68 ℃ were extended 15 fens, and carried out 30 circulations like this; At last, continue to extend 7 fens at 68 ℃, obtaining length is the PCR product of 13367 bases; Merge 6 pipe long PCR products, and with the Wizard PCR Preps purification kit purified pcr product of Promega company;
(3) member O-antigen gene bunch library: make up O-antigen gene bunch library with the Novagen DNaseI shot gun method that is modified, reaction system is a 300ng PCR purified product, 0.9ul 0.1M MnCl
2, the DNaseI of the 1mg/ml of 1ul dilution in 1: 2000, reaction is carried out at room temperature; Select the dna fragmentation size after the suitable reaction times is cut enzyme to concentrate between the 1kb-3kb, then add 2ul 0.1M EDTA termination reaction, merge the same reaction system of 4 pipes, use isopyknic phenol and phenol respectively: chloroform: primary isoamyl alcohol (25: 24: 1) extracting once, after using twice of isopyknic ether extracting again, with the dehydrated alcohol deposit D NA of 2.5 times of volumes, and wash precipitation, be resuspended at last in the 18ul water with 70% ethanol; In this mixture, add 2.5ul dNTP (1mMdCTP subsequently, 1mMdGTP, 1mMdTTP, 10mMdATP), the T4DNA polysaccharase of 1.25ul100mM DTT and 5 units, 11 ℃ 30 minutes, enzyme is cut product mend into flush end, after 75 ℃ of termination reactions, add the Tth archaeal dna polymerase of 5 units and corresponding damping fluid thereof and system is expanded as 80ul, make the 3 ' end of DNA add the dA tail, this mixture is through chloroform: after primary isoamyl alcohol (24: 1) extracting and the ether extracting with 3 * 10 of Promega company
-3The pGEM-T-Easy carrier connect 24 hours in 16 ℃, cumulative volume is 90ul, 10 * the buffer of 9ul and the T4DNA ligase enzyme of 25 units are wherein arranged, connect mixture with the dehydrated alcohol precipitation at last, be dissolved in after 70% ethanol is washed and obtain connecting product in the 30ul water, preparation method with the electric transformed competence colibacillus cell of Bio-Rad company prepares the competence e.colidh5, get after 2-3ul connects product and 50ul competence bacillus coli DH 5 alpha mixes, forward in the electric shock cup of 0.2cm of Bio-Rad company and shock by electricity, voltage is 2.5 kilovolts, time is 5.0 milliseconds-6.0 milliseconds, the SOC substratum that adds 1ml after the electric shock immediately in cup makes the bacterium recovery, then bacterium is coated in and contains penbritin, 37 ℃ of incubated overnight on the LB solid medium of X-Gal and IPTG obtain blue white bacterium colony next day.With the white colony that obtains promptly the white clone forward on the LB solid medium that contains penbritin and cultivate, extract plasmid and cut the segmental size of evaluation insertion wherein with the EcoRI enzyme from each clone simultaneously, the white that obtains clone has constituted the O-antigen gene bunch library of Shigella bogdii 11 types;
(4) to the cloning and sequencing in the library: from the library, select insert 120 clones of fragment more than 700bp by Shanghai biotechnology company limited with ABI377 type automatic dna sequencer to unidirectional order-checking of insertion fragment in cloning, make sequence reach 80% fraction of coverage, the sequence of residue 20% is again according to the sequences Design primer that has obtained, these two pairs of primers, as follows: 5 '-GCATGGGTTACTGTACTAGC-3 ' and 3 '-AATGGCATCAATACCCGC-5 ' and 5 '-TGGCGGTATTGAGAGAGT-3 ' and 3 '-TTACAGGCTACTTCTCTTC-5 '; Direct PCR and from the genomic dna of Shigella bogdii 11 types again to the order-checking of PCR product, thus all sequences of O-antigen gene bunch obtained.
(5) splicing of nucleotide sequence and analysis: the Pregap4 and the splicing of Gap4 software of the Staden package software package of publishing with Britain Camb MRC (Medical ResearchCouncil) Molecular Biology Lab and edit all sequences, thus obtain the Nucleotide full length sequence (seeing sequence list) of the O-antigen gene bunch of Shigella bogdii 11 types.The quality of sequence is mainly guaranteed by two aspects: 1) genome of Shigella bogdii 11 types is done 6 Long PCR reactions, mix these products then to produce the library.2), guarantee high-quality fraction of coverage more than 3 to each base.After obtaining the nucleotide sequence of Shigella bogdii 11 type O-antigen genes bunch, with American National biotechnology information science center (TheNational Center for Biotechnology Information, NCBI) orffinder finds gene, find the reading frame of 11 openings, determine also that with the function of finding the reading frame that these are open what gene they are with the genetic comparison among the blast groupware and the GenBank, finish gene annotation with the Artemis software at Britain sanger center again, do accurate comparison between DNA and protein sequence with Clustral W software, obtain the structure of the O-antigen gene bunch of Shigella bogdii 11 types at last;
(6) screening of specific gene: at wzx, wzy, orf5, orf7, orf8, orf9, the orf10 gene design primer in the O-antigen gene of Shigella bogdii 11 types bunch; Respectively designed three pairs of primers in each gene, every pair of primer is distributed in the different places in the corresponding gene, to guarantee its specificity; Is that template is carried out PCR with these primers with the genomes of 166 strain intestinal bacteria and 43 strain Shigellaes, all primers all obtain positive findings in intestinal bacteria O105, the correct band of any size does not all increase in other groups, promptly do not obtaining any PCR product band in the array mostly, though in the minority group, obtain PDR product band, but its size does not meet the expection size, so the O-antigen of wzx, wzy, orf5, orf7, orf8, orf9, orf10 gene pairs Shigella bogdii 11 types all is high special.
First aspect just of the present invention provides the full length nucleotide sequence of the O-antigen gene bunch of Shigella bogdii 11 types, its complete sequence shown in SEQ ID NO:1,13367 bases of total length; The base that perhaps has one or more insertions, disappearance or replacement keeps the Nucleotide of the SEQ ID NO:1 of described isolating functional nucleotide simultaneously.Obtained the structure (listing) of the O-antigen gene bunch of Shigella bogdii 11 types by method of the present invention in figure one, it is altogether by 11 genomic constitutions, all between galF gene and gnd gene.
Second aspect of the present invention provides the gene in the O-antigen gene bunch of Shigella bogdii 11 types, promptly transports enzyme gene (wzx gene or the gene of identity function arranged with wzx); Pol gene (wzy gene or the gene of identity function arranged with wzy); Glycosyltransferase gene comprises orf5, orf7, orf8, orf9, orf10 gene; Special sugared synthesis path gene in the bacterial polysaccharides antigen comprises rmlB, rmlD, rmlA, rmlC gene, and their zero positions in O-antigen gene bunch and final position and nucleotide sequence all are listed in the table 4.The invention particularly relates to glycosyltransferase gene, transhipment enzyme gene and pol gene, because sugared synthesis path gene is that the gene of synthetic nucleosides bisphosphate monose is common, common by indication to more exocellular polysaccharide now, O-antigen to bacterium is not very special, and the glycosyltransferase gene that the present invention relates to, transhipment enzyme gene and pol gene are high specials to the O-antigen of Shigella bogdii 11 types and intestinal bacteria O105.
The 3rd aspect of the present invention, wzx gene in the O-antigen gene bunch that comes from Shigella bogdii 11 types is provided or the gene, wzy gene of identity function is arranged or the gene and the glycosyltransferase gene of identity function are arranged with wzy with wzx, the oligonucleotide that comprises orf5, orf7, orf8, orf9, orf10 gene, they are any one section oligonucleotide in these genes.But, be that the oligonucleotide of listing in the table one is right preferentially by usefulness, also listed in Table 1 these oligonucleotide to the position in O-antigen gene bunch and with these oligonucleotide to being the size of the product of the PCR reaction done of primer, the annealing temperature in these PCR reaction free lists is carried out.These primers are being to obtain expecting the product of size in the pcr amplification that carries out of template with Shigella bogdii 11 types and intestinal bacteria O105 only, and are all not obtain expecting the product of size in the pcr amplification that carries out of template the 166 strain intestinal bacteria listed with table two and 43 strain Shigellaes.In more detail, with these oligonucleotide to being that PCR that primer is done is reflected at and does not all obtain spawn in most of bacteriums, though in some bacterium, obtained PCR product band, but its size does not meet the expection size, this is that this problem can be avoided by being PCR with intragenic other primer because primer is attached to genomic other position and causes.So, can determine these primers promptly the listed oligonucleotide of table one be high special to Shigella bogdii 11 types and intestinal bacteria O105 and their O-antigen.
Other aspects of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
As used herein, " oligonucleotide " is meant the gene that derives from the encoding glycosyl transferring enzyme in the O-antigen gene bunch, the gene of coding transhipment enzyme and intragenic one section nucleic acid molecule of coding polysaccharase, they can change on length, generally change in 10 to 20 Nucleotide scopes.More precisely these oligonucleotide are to come from orf5 gene (nucleotide position is 4667 to 5410 bases from SEQ ID NO:1), wzy gene (nucleotide position is 5432 to 6460 bases from SEQ ID NO:1), orf7 gene (nucleotide position is 6468 to 7310 bases from SEQ ID NO:1), orf8 gene (nucleotide position is 7310 to 8446 bases from SEQ ID NO:1), orf9 gene (nucleotide position is 8443 to 9327 bases from SEQ IDNO:1), orf10 gene (nucleotide position is 9344 to 10327 bases from SEQ ID NO:1), wzy gene (nucleotide position is 10367 to 11794 bases from SEQ ID NO:1).Coming from above intragenic oligonucleotide all is high special to Shigella bogdii 11 types (SEQ ID NO:1) and intestinal bacteria O105.
In addition, the antigenic gene cluster of the different O-of the coding of two genetic resemblances produces new O-antigen by gene recombination or sudden change sometimes, thereby produces new bacteria types, new mutant strain.In this environment, need filter out many specificitys that oligonucleotide is detected with raising with recombination hybridization.Therefore, the invention provides a whole set of many mixtures to oligonucleotide, they come from glycosyltransferase gene; Come from transhipment enzyme and pol gene, comprise the wzx gene or the gene, wzy gene of identity function arranged or the gene of identity function is arranged with wzy with wzx; Also come from sugared synthesis path gene.The mixture of these genes is special to a special bacterial polysaccharides antigen, is special thereby make this cover oligonucleotide to the polysaccharide antigen of this bacterium.More particularly, the mixture of these oligonucleotide is to come from glycosyltransferase gene, wzx gene or the gene, wzy of identity function arranged or with wzy oligonucleotide and the combination that comes from the oligonucleotide in the sugared synthesis path gene in the gene of identity function are arranged with wzx.
On the other hand, the present invention relates to the evaluation of oligonucleotide, they can be used for detecting the O-antigen of expressing the antigenic bacterium of O-and identifying bacterium in diagnosis.
The present invention relates to a kind of antigenic method of one or more bacterial polysaccharideses that detects in the food, these antigens can make sample can with the oligonucleotide specific hybrid of following at least one gene, these genes are: (i) gene of the encoding glycosyl transferring enzyme gene of transhipment enzyme and polysaccharase of (ii) encoding comprises the wzx gene or the gene, wzy gene of identity function is arranged or with wzy the gene of identity function is arranged with wzx.At least one oligonucleotide can be hybridized with at least one more than one such gene specific of expressing the special antigenic bacterium of O-under the situation of condition permission, and these bacteriums are Shigella bogdii 11 types or intestinal bacteria O105.Available PCR method detects, more can with behind the Nucleotide mark in the inventive method as probe by hybridization such as southern-blot or fluoroscopic examination, perhaps by antigen and bacterium in gene chip or the microarray assay sample.
The present inventor considers following situation: when one special oligonucleotide detects when invalid, the mixture of oligonucleotide can with the target region specific hybrid with test sample.Therefore the invention provides a cover oligonucleotide and be used for detection method of the present invention.Here said oligonucleotide is meant the gene that comes from the encoding glycosyl transferring enzyme, the gene of coding transhipment enzyme and the gene of polysaccharase, comprises the wzx gene or the gene, wzy gene of identity function is arranged or with wzy the oligonucleotide of the gene of identity function is arranged with wzx.This cover oligonucleotide is special to the O-antigen of a special bacterium, and this special bacterium O-antigen is expressed by Shigella bogdii 11 types or intestinal bacteria O105.
On the other hand, the present invention relates to a kind of antigenic method of one or more bacterial polysaccharideses that detects in the movement, these antigens can make sample can with the oligonucleotide specific hybrid of following at least one gene, these genes are: (i) gene of the encoding glycosyl transferring enzyme gene of transhipment enzyme and polysaccharase of (ii) encoding comprises the wzx gene or the gene, wzy gene of identity function is arranged or with wzy the gene of identity function is arranged with wzx.At least one oligonucleotide can be expressed more than one such gene specific hybridization of the special antigenic bacterium of O-with at least one under the situation of condition permission.These bacteriums are Shigella bogdii 11 types or intestinal bacteria O105.Oligonucleotide among available the present invention is made the method test sample of primer by PCR, also can with behind the oligonucleotide molecules mark among the present invention as probe by hybridization such as southern-blot or fluoroscopic examination, perhaps by antigen and bacterium in gene chip or the microarray assay sample.
General a pair of oligonucleotide may with same gene recombination also can with different gene recombinations, but must have in them an oligonucleotide can specific hybrid to the distinguished sequence of special antigenic type, another oligonucleotide can be hybridized in non-specific zone.Therefore, when the oligonucleotide in the special polysaccharide antigen gene cluster is reconfigured, can select specific gene mixture hybridization in a pair of oligonucleotide and the polysaccharide antigen gene cluster at least, perhaps select many mixture hybridization oligonucleotide and specific gene.Even even when all genes were all unique in the specific genes bunch, this method also can be applied to discern the nucleic acid molecule of the gene mixture in this gene cluster.Therefore the invention provides a whole set of is used to detect the many to oligonucleotide of the inventive method, many here is that the gene of the gene that comes from the encoding glycosyl transferring enzyme, coding transhipment enzyme and polysaccharase comprises the wzx gene or the gene, wzy gene of identity function arranged or with wzy the gene of identity function is arranged with wzx to oligonucleotide, this cover oligonucleotide is special to a special bacterial polysaccharides, and this cover oligonucleotide may be the Nucleotide of necessary gene during sugar synthesizes.
On the other hand, the present invention also relates to the antigenic method of one or more bacterial polysaccharideses in the sample that a kind of detection comes from patient.One or more bacterial polysaccharides antigens in the sample can make sample can with a specific hybrid in a pair of oligonucleotide in following at least one gene, these genes are: (i) gene of the encoding glycosyl transferring enzyme gene of transhipment enzyme and polysaccharase of (ii) encoding comprises the wzx gene or the gene, wzy gene of identity function is arranged or with wzy the gene of identity function is arranged with wzx.Under the situation of condition permission at least one oligonucleotide can with sample at least one express more than one such gene specific hybridization of the special antigenic bacterium of O-, these bacteriums are Shigella bogdii 11 types or intestinal bacteria O105.Oligonucleotide among available the present invention is made the method test sample of primer by PCR, also can will pass through hybridization as probe behind the oligonucleotide mark among the present invention, perhaps by gene chip, perhaps antigen and the bacterium in the microarray assay sample.
In more detail, method described above can be understood as when oligonucleotide when being used, it is not to derive from glycosyltransferase gene, wzx gene or with wzx the gene, wzy gene of identity function arranged or have on the sequence of gene of identity function with wzy that one of them oligonucleotide molecules can hybridize to one.In addition, when two oligonucleotide can both be hybridized, they may be hybridized in same gene and also may hybridize on the different genes.Also promptly, when cross reaction goes wrong, can select the mixture of oligonucleotide to detect the blended gene so that the specificity of detection to be provided.
The present inventor believes that the present invention is not necessarily limited to the above nucleotide sequence coded specific O-antigen of carrying, and is widely used in detecting all expression O-antigens and identifies the antigenic bacterium of O-.And because O-antigen is synthetic and the similarity of other polysaccharide antigens (as bacterium born of the same parents exoantigen) between synthesizing, the inventor believes that method of the present invention and molecule also are applied to these other polysaccharide antigen.
The present invention discloses the full length sequence of the O-antigen gene bunch of Shigella bogdii 11 types first, and can from the sequence of this total length gene cluster of not cloned, produce recombinant molecule, can produce the O-antigen of expressing Shigella bogdii 11 types by inserting to express, and become useful vaccine.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should understand these embodiment only is used to the present invention is described and is not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: the condition described in the laboratory manual (NewYork:Cold Spring Harbor Laboratory Press, 1989).Embodiment 1: genomic extraction: 37 ℃ of incubated overnight Shigellaes in the LB of 5mL substratum, centrifugal collecting cell.With 500ul 50mM Tris-HCl (pH8.0) and 10ul 0.4M EDTA re-suspended cell, 37 ℃ of incubations 20 minutes, the N,O-Diacetylmuramidase that adds 10ul 10mg/ml then continues insulation 20 minutes, the Proteinase K, the 15ul 10%SDS that add 3ul 20mg/ml afterwards, 50 ℃ of incubations 2 hours, the RNase that adds 3ul 10mg/ml again, 65 ℃ 30 minutes.Add equal-volume phenol extracting mixture, get supernatant liquor and use isopyknic phenol again: chloroform: primary isoamyl alcohol (25: 24: 1) extracting twice, get supernatant liquor again with isopyknic ether extracting to remove remaining phenol.Supernatant liquor rolls out DNA and washes DNA with 70% ethanol with glass yarn with 2 times of volume ethanol deposit D NA, at last DNA is resuspended among the 30ul TE, and genomic dna detects by 0.4% agarose gel electrophoresis.
Embodiment 2: by the O-antigen gene in pcr amplification Shigella bogdii 11 types bunch: the O-antigen gene of Shigella bogdii 11 types is bunch by the Long pcr amplification.At first according to the JumpStart sequences Design upstream primer (#1523-ATT GTG GCT GCA GGGATC AAA GAA AT) that often is found in O-antigen gene bunch promoter region, again according to the gnd gene design downstream primer (#1524-TAG TCG CGT GNG CCT GGA TTA AGT TCG C) in O-antigen gene bunch downstream.With the Expand Long Template PCR method of Boehringer Mannheim company amplification O-antigen gene bunch, the PCR response procedures was as follows: 94 ℃ of pre-sex change 2 minutes; 94 ℃ of sex change are 10 seconds then, 60 ℃ of annealing 30 seconds, and 68 ℃ were extended 15 fens, and carried out 30 circulations like this.At last, continue to extend 7 fens at 68 ℃, obtain the PCR product, the agarose gel electrophoresis with 0.8% detects the size and the specificity thereof of PCR product.Merge 6 pipe long PCR products, and with the Wizard PCR Preps purification kit purified pcr product of Promega company.
Embodiment 3: make up O-antigen gene bunch library:
At first be the acquisition that connects product: make up O-antigen gene bunch library with the Novagen DNaseI shot gun method that is modified.Reaction system is a 300ng PCR purified product, 0.9ul 0.1M MnCl
2, the DNaseI of the 1mg/ml of 1ul dilution in 1: 2000, reaction is carried out at room temperature.Enzyme is cut the dna fragmentation size is concentrated between the 1kb-3kb, then adds 2ul 0.1M EDTA termination reaction.Merge the same reaction system of 4 pipes, use isopyknic phenol and phenol respectively: chloroform: primary isoamyl alcohol (25: 24: 1) extracting once, use twice of isopyknic ether extracting again after, with the dehydrated alcohol deposit D NA of 2.5 times of volumes, and wash precipitation with 70% ethanol, be resuspended at last in the 18ul water.In this mixture, add 2.5uldNTP (1mMdCTP subsequently, 1mMdGTP, 1mMdTTP, 10mMdATP), the T4DNA polysaccharase of 1.25ul 100mM DTT and 5 units, 11 ℃ 30 minutes, enzyme is cut product mend into flush end, after 75 ℃ of termination reactions, add the Tth archaeal dna polymerase of 5 units and corresponding damping fluid thereof and system is expanded as 80ul, 70 ℃ were reacted 20 fens, made the 3 ' end of DNA add the dA tail.This mixture is through the equal-volume chloroform: after primary isoamyl alcohol extracting and the extracting of equal-volume ether with 3 * 10 of Promega company
-3The pGEM-T-Easy carrier connect 24 hours in 16 ℃, cumulative volume is 90ul.10 * the buffer of 9ul and the T4DNA ligase enzyme of 25 units are wherein arranged.Use the dehydrated alcohol precipitation of the 3M NaAc (pH5.2) of 1/10 volume and 2 times of volumes to be connected mixture at last, wash precipitation with 70% ethanol again, be dissolved in after the drying and obtain connecting product in the 30ul water.
Next is the preparation of competent cell: the method that provides with reference to Bio-Rad company prepares the competent cell bacillus coli DH 5 alpha.Get a ring bacillus coli DH 5 alpha list bacterium colony in the LB of 5ml substratum, 180rpm cultivated after 10 hours, got in the LB substratum that the 2ml culture is transferred to 200ml, and 37 ℃ of 250rpm thermal agitations are cultivated OD600 about 0.5, ice bath cooling was 20 minutes then, in centrifugal 15 minutes of 4 ℃ of 4000rpm.Confide all supernatant liquor, dispel thalline, in centrifugal 15 minutes of 4 ℃ of 4000rpm with the deionization aqua sterilisa 200ml of cold ice precooling.Deionization aqua sterilisa 100ml with cold ice precooling dispelled thalline again, in centrifugal 15 minutes of 4 ℃ of 4000rpm.With 10% glycerine suspension cell of cold ice precooling, centrifugal 10 minutes of 4 ℃ of 6000rpm abandon supernatant liquor, precipitate 10% glycerine suspension cell with the precooling of 1ml ice at last, are competent cell.The competent cell that makes is packed as 50ul one pipe ,-70 ℃ of preservations.
Be electric transformed competence colibacillus cell at last: get after 2-3ul connects product and 50ul competence bacillus coli DH 5 alpha mixes, forward in the electric shock cup of 0.2cm of Bio-Rad company and shock by electricity, voltage is 2.5 kilovolts, and the time is 5.0 milliseconds-6.0ms millisecond.The SOC substratum that adds 1ml after the electric shock immediately in cup makes the bacterium recovery.Immediately bacterium is coated in 37 ℃ of inversion incubated overnight on the LB solid medium that contains penbritin, X-Gal and IPTG then, obtains blue white bacterium colony next day.With the white colony that obtains promptly the white clone forward on the LB solid medium that contains penbritin and cultivate, from each clone, extract plasmid and cut the segmental size of evaluation insertion wherein simultaneously, obtain the O-antigen gene bunch library that white clone group constitutes Shigella bogdii 11 types with the EcoRI enzyme.
Embodiment 4: to the cloning and sequencing in the library: from the library, select insert 120 clones of fragment more than 700bp by Shanghai biotechnology company limited with ABI377 type automatic dna sequencer to unidirectional order-checking of insertion fragment in cloning, make sequence reach 80% fraction of coverage.Residue 20% sequence is again according to the sequences Design primer that has obtained, direct PCR and from the genomic dna of Shigella bogdii 11 types again to the order-checking of PCR product, thus obtain all sequences of O-antigen gene bunch.We have designed two pairs of primers in Shigella bogdii 11 types, and are as follows:
5 '-GCATGGGTTACTGTACTAGC-3 ' and 3 '-AATGGCATCAATACCCGC-5 '
5 '-TGGCGGTATTGAGAGAGT-3 ' and 3 '-TTACAGGCTACTTCTCTTC-5 '
Embodiment 5: the splicing of nucleotide sequence and analysis: the Pregap4 and the splicing of Gap4 software of the Staden package software package of publishing with Britain Camb MRC (Medical ResearchCouncil) Molecular Biology Lab and edit all sequences, thus obtain the Nucleotide full length sequence (seeing sequence list) of the O-antigen gene bunch of Shigella bogdii 11 types.The quality of sequence is mainly guaranteed by two aspects: 1) genome of Shigella bogdii 11 types is done 6 Long PCR reactions, mix these products then to produce the library.2), guarantee high-quality fraction of coverage more than 3 to each base.After obtaining the nucleotide sequence of Shigella bogdii 11 type O-antigen genes bunch, with American National biotechnology information science center (TheNational Center for Biotechnology Information, NCBI) orffinder finds gene, find the reading frame of 11 openings, determine also that with the function of finding the reading frame that these are open what gene they are with the genetic comparison among the blast groupware and the GenBank, finish gene annotation with the Artemis software at Britain sanger center again, do accurate comparison between DNA and protein sequence with Clustral W software, obtain the structure of the O-antigen gene bunch of Shigella bogdii 11 types at last, as shown in table 3.
By retrieving and relatively, finding that orf 1 and the rmlB gene of Shigella boydii and Escherichia coli K12 all have 97% homogeny in 297 amino acid whose sequences, show the homology that height is arranged between them.So can determine orf 1 is the rmlB gene.Orf 2 has 98% homogeny with the rmlD gene of Shigella boydii in 299 amino acid whose sequences, aminoacid sequence with the rmlD gene of Escherichiacoli K12 also has 95% homogeny in addition, shows the homology that height is arranged between them.So, can determine that orf 2 is rmlD genes.Orf 3 has 97% homogeny with the rmlA gene of Shigella boydii and Escherichia coli K12 in 292 amino acid whose sequences, show the homology that height is arranged between them.So, can determine that orf3 is the rmlA gene.The rmlC gene of orf4 and Shigella boydii and Escherichia coli K12 has 86% homogeny in 179 amino acid whose sequences, show the homology that height is also arranged between them.So, can determine that orf 4 is rmlC genes.In addition, in Shigellae and intestinal bacteria, rmlB, rmlD, rmlA, rmlC are four genes that synthesize rhamnosyl specially, in the antigenic structure of the O-of Shigella bogdii 11 types rhamnosyl are arranged also, and be very identical.Orf6 and colibacillary wzy gene have 25% homogeny in 317 aminoacid sequences, learn that by the Eisenberg algorithm orf6 has 10 potential transmembrane domains in addition, to other O-antigen polysaccharase similar secondary structure is arranged, so determine that orf6 is exactly the wzy gene, called after wzy.The glycosyltansferase gene of Orf7 and Enterococcus faecalis has 27% homogeny in 238 amino acid, be a glycosyltransferase gene, called after orf7.The glycosyltansferase gene of orf9 and shigella flexneri has 48% homogeny in 289 aminoacid sequences, 69% similarity is so determine that orf9 is a glycosyltransferase gene, called after orf9.The glycosyltansferase gene of Orf11 and shigella boydii has 57% homogeny in 468 aminoacid sequences, 76% similarity, and algorithm [Eisenberg by people such as Eisenberg, D, Schwarz, E.etal (1984) .Analysis of membrane and surfaceprotein sequences with the hydrophobic moment plot.J.Mol.Biol.179:125-142] find that orf11 has 12 potential transmembrane domains, it and many wzx protein similars, and about 50 amino acid whose conservative motifs are arranged at the proteic aminoterminal of wzx, so can determine orf11 is the wzx gene, called after wzx.O-antigenic structure according to Shigella bogdii 11 types also needs 3 glycosyltransferase genes, orf5, orf8 as can be known, orf10 and known array do not have obvious homology, but have the feature of glycosyltransferase, are three glycosyltransferases, called after orf5, orf8, orf10.
Embodiment 6: the screening of specific gene.At wzx, wzy, orf5, orf7, orf8, orf9, orf10 gene design primer in the O-antigen gene of Shigella bogdii 11 types bunch, the position of these genes in nucleotide sequence sees Table 1.
Table 1 has been listed glycosyltransferase gene and oligosaccharide unit treatment gene and intragenic primer and PCR data in the O antigen gene bunch of Shigella bogdii 11 types.Glycosyltransferase gene, transhipment enzyme gene and pol gene and their function corresponding and the size of the O antigen gene bunch of Shigella bogdii 11 types in table, have been listed.In each gene, we have respectively designed three pairs of primers, and the difference that every pair of primer is distributed in the corresponding gene is local to guarantee its specificity.In table, also listed position and the size of each primer in SEQ IDNO:1.Is that template carry out PCR with listed corresponding annealing temperature in the table with the genomes of all bacterium in the table two with every pair of primer, has obtained corresponding PCR product, and its size is also listed in the table.
Mdh (malate dehydrogenase) gene is to be present in all colibacillary genomes and a gene of high conservative, so we according to the mdh gene design primer #101 (TTC ATC CTAAAC TCC TTA TT) and #102 (TAA TCG CAG GGG AAA GCA GG), extract genome then from 166 strain intestinal bacteria, method as previously mentioned.With this to primer from the colibacillary genome of 166 strains PCR with identification of escherichia coli and detect its genomic quality.
Table 2 is 166 strain intestinal bacteria and 43 strain Shigellaes and their sources that are used to screen specific gene, and for the convenience that detects, we are divided into one group with their every 8-10 bacterium, and 27 groups altogether, all list in the table in their source.
The genomic dna that contains Shigella bogdii 11 types in the 25th group is as positive control.Do template with every group of bacterium, be PCR by following condition with every pair in the table one primer: 94 ℃ of pre-sex change after 2 minutes, 94 ℃ of sex change 15 seconds, annealing temperature is because of the difference different (with reference to table one) of primer, annealing time is 50 seconds, and 72 ℃ were extended 2 fens, and carried out 30 circulations like this.Continue to extend 10 fens at 72 ℃ at last, reaction system is 25ul.After reaction finishes, get the 10ulPCR product and detect the fragment that amplifies by 0.8% agarose gel electrophoresis.
For wzx, wzy, orf5, orf7, orf8, orf9, orf10 gene, each gene all has 1 to 3 pair of primer detected, every pair of primer has obtained also all obtaining onesize specificity band the correct band of expection size in the 18th group except be PCR in the 25th group after.After being template PCR with the genomic dna of each bacterium in the 18th group, find only in intestinal bacteria O105, to have obtained positive findings.In more detail, each of each gene all obtains expecting the correct PCR product band of size to primer more than in intestinal bacteria O105.It is reported that the O-antigenic structure of Shigella bogdii 11 types and intestinal bacteria O105 is the same, our result has confirmed this point from another side.In addition, all primers are the correct band of any size that all do not increase in other groups, that is to say, do not obtaining any PCR product band in the array mostly, though in the minority group, obtain PCR product band, but its size does not meet the expection size, so wzx, wzy, orf5, orf7, orf8, orf9, orf10 gene pairs Shigella bogdii 11 types and intestinal bacteria O105 and O-antigen thereof all are high specials.
At last, from Shigella bogdii 11 types, screen gene by PCR: wzx, wzy and four glycosyltransferase genes to the O-antigen high special of Shigella bogdii 11 types and intestinal bacteria O105.And the oligonucleotide of these intragenic any one section 10-20nt is special to the O-antigen of Shigella bogdii 11 types and intestinal bacteria O105, and the primer in especially above-mentioned each gene is that oligonucleotide is high special to detecting the back confirmation through PCR to Shigella bogdii 11 types and intestinal bacteria O105.These all oligonucleotide all can be used for Shigella bogdii 11 types and the intestinal bacteria O105 in the human body and environment rapidly and accurately, and can identify their O-antigen.
Table 3 is structural tables of the O-antigen gene bunch of Shigella bogdii 11 types, in table, listed the structure of the O-antigen gene bunch of Shigella bogdii 11 types, altogether by 11 genomic constitutions, each gene box indicating, and in square frame, write the title of gene, numeral be the order of the open reading frame (orf) in the O-antigen gene bunch.Two ends at O-antigen gene bunch are galF gene and gnd gene, and these two not responsible O-of gene are antigenic synthetic, and we are just with the increase full length sequence of O-antigen gene bunch of their one section sequences Design primer.
Table 4 is location tables of the gene in the O-antigen gene bunch of Shigella bogdii 11 types, in table, listed the accurate position of all open reading frame in complete sequence in the O-antigen gene bunch of Shigella bogdii 11 types, at the underscoring of the initiator codon and the terminator codon of each open reading frame.
Sequence list
SEQUENCE LISTING
＜110〉Nankai University
＜120〉to the Nucleotide of the O-antigen-specific of Shigella bogdii 11 types and intestinal bacteria O105
＜130〉to the Nucleotide of the O-antigen-specific of Shigella bogdii 11 types and intestinal bacteria O105
<160>1
<170>PatentIn version 3.1
<210>1
<211>13367
<212>DNA
<213>Shigella boydii
<400>1
ctcctggtaa ctcacgcgtc caagaacgcg gtcgaaaacc acttcgacac ctcttatgaa 60
ttagaatctc tccttgaact gcgcgtgaag cgtcaactgc tggccgaagt acagtccatt 120
tgcccgccgg gcgtgaccat tatgaacgtg cgtcagggcg aacctttagg tttaggccac 180
tccattttat gtgcacgacc cgccattggt gacaatccat ttgtcgtggt gctgccagac 240
gttgtgatcg atgacgccag cgccgacccg ctgcgctaca accttgcagc catgattgcg 300
cgcttcaacg aaacgggccg tagccaggtg ctggcaaaac gtatgccagg tgacctctct 360
gaatactctg tcatccagac caaagagccg ctggatcgcg aaggcaaagt cagccgcatt 420
gttgaattta tcgaaaaacc ggatcagccg cagacgctgg actcagacat catggccgta 480
ggtcgttatg tgctttctgc cgatatttgg ccggaacttg aacgcacgca gccaggggca 540
tggggacgta ttcagctgac agatgccatc gctgaactgg cgaaaaaaca gtccgttgat 600
gcaatgctga tgactggtga cagctacgac tgcggtaaaa aaatgggcta tatgcaggcg 660
tttgtgaagt atggactacg caacctgaaa gaaggggcga agttccgcaa aggtattgag 720
aagctgttaa gcgaataatg aaaatctgac cggatgtaac ggttgataag aaaattataa 780
cggcagtgaa gattcgtggc gaaagtaatt tgttgcgaat tttcctgccg ttgttttata 840
taaacaatca gaataacaac gagttagcaa taggattttt gtcaaagttt tccaggattt 900
tccttgtttc cagagcggat tggtaagaca attagcgttt gaatttttcg ggtttagcgc 960
gagtgggtaa cgctcgtcac atcgtaggca tgcatgcagt gctctggtag ctgtaaagcc 1020
aggggcggta gcgtgcatta atacctctat taatcaaact gagagccgct tatttcacag 1080
catgctctga agtaatatgg aataaattaa gtgaaaatac ttgttactgg tggcgcagga 1140
tttattggtt ctgctgtagt tcgtcacatt ataaataata cgcaggatag tgttgttaat 1200
gtcgataaat taacgtacgc cggaaacctg gaatcacttg ctgatgtttc tgattccgaa 1260
cgctatgttt ttgaacatgc ggatatttgc gatgcagctg taatggcacg gatttttgct 1320
cagcatcagc cggatgcagt gatgcacctg gctgctgaaa gccatgtgga ccgttcaatt 1380
acaggtcctg cggcatttat tgaaaccaat attgttggta catatgtcct tttggaagcc 1440
gctcgcaatt actggtctgc tcttgatagc gacaagaaaa atagcttccg ttttcatcat 1500
atttctactg acgaagtcta tggttatttg cctcatcctg acgaggtgaa taatacagaa 1560
gaattaccct tatttactga gacaacagct tacgcgccaa gcagccctta ttccgcatcc 1620
aaagcatcca gcgatcattt agtccgcgcg tggaaacgta cctatggttt accgaccatt 1680
gtgactaatt gttcgaataa ctacggtcct tatcactttc cggaaaaatt gattccacta 1740
gtaattctta atgctctgga aggtaaggca ttacctattt atggcaaagg ggatcaaatt 1800
cgcgactggc tgtatgttga agatcatgca cgtgcgttat ataccgtcgt aaccgaaggt 1860
aaagcgggtg aaacttataa cattggtgga cacaacgaaa agaaaaacat cgatgtagtg 1920
ctcactattt gtgatttgtt ggatgagatt gtaccgaaag agaaatctta ccgcgagcaa 1980
attacttatg ttgccgatcg tccgggacac gatcgccgtt atgccattga tgctgagaag 2040
attgctcgcg aattgggatg gaaaccacag gaaacgtttg agagcgggat tcggaagaca 2100
gtggaatggt acctgtccaa tacaaaatgg gttgataatg tgaaaagtgg tgcctatcaa 2160
tcgtggattg aacagaacta tgagggccgc cagtaatgaa tattctcctt ttcggcaaaa 2220
cagggcaggt aggttgggaa ctacagcgtg ctctggcacc tttgggtaat ttgattgctc 2280
ttgatgttca ctccactgat tattgtggtg attttagtaa tcctgaaggt gtggctgaaa 2340
ccgtcaaaaa aattcgccct gatgttattg ttaatgctgc ggctcatacc gcagtagata 2400
aggctgagtc agaacccgaa tttgcacaat tactcaatgc gaccagcgtt gaatcaattg 2460
caaaagcggc taatgaagtt ggggcctggg taattcatta ctcaactgac tacgtatttc 2520
cgggaaccgg tgaaatacca tggctggaga cggatgcaac cgcaccgcta aatgtttacg 2580
gtgaaaccaa gttagccgga gaaaaagcgt tacaggaaca ttgcgcgaag catcttattt 2640
tccgtaccag ctgggtatac gcaggtaaag gaaataactt cgccaaaacg atgttgcgtc 2700
tggcaaaaga gcgtgaagaa ttagcggtta ttaacgatca gtttggtgca ccaacgggtg 2760
ctgagctgct ggctgattgt acggcacatg ctattcgtgt tgcactgaaa aaaacagaag 2820
tcgcaggctt gtaccatttg gtagctagtg gtaccacaac ctggtacgat tatgctgcgc 2880
tggtttttga agaggcgcgc aaagcaggca ttccccttgt actcaacaag ctcaacgcag 2940
taccaacaac tgcctatcct acaccagctc gtcgtccaca taactctcgc cttaatacag 3000
aaaaatttca gcagaacttt gcgcttgtct tgcctgactg gcaggttggc gtgaaacgaa 3060
tgctcaacga attatttacg actacagcaa tttaatagtt tttgcatctt gttcgtgatg 3120
gtggagcaag atgaattaaa aggaatgatg aaatgaaaac gcgtaaaggt attattttag 3180
cgggtggttc tggtacacgt ctttatcctg tgacgatggc cgtcagtaaa cagctgttac 3240
cgatttatga taaaccgatg atctattacc cgctttctac actgatgtta gcgggtattc 3300
gcgatattct gattatcagt acgccacagg atactcctcg ttttcaacaa ctgctgggtg 3360
acgggagcca gtgggggcta aatcttcagt acaaagtaca accgagtccg gatggtcttg 3420
cgcaggcgtt tattatcggt gaagagttta ttggtggtga tgattgtgct ttggttcttg 3480
gtgacaatat cttctacggt cacgatctgc cgaagttaat ggacgtagct gttaacaaag 3540
aaagtggtgc aacggtattt gcctatcacg ttaatgatcc tgaacgctac ggtgtcgttg 3600
agtttgataa aaacggtacg gcgatcagcc tggaagaaaa accgctacaa ccaaaaagta 3660
attatgcggt aaccgggctt tatttttatg ataacgacgt tgtcgaaatg gcgaaaaatc 3720
ttaagccttc tgcccgcggt gaactggaaa ttaccgatat taaccgtatt tatatggaac 3780
aggggcgttt atccgttgcc atgatggggc gtggatatgc atggctggac acgggaacac 3840
atcaaagtct tattgaagca agcaacttca ttgcaacaat tgaagaacgt caggggctga 3900
aagtatcctg cccggaagaa attgcttacc gtaaaggatt tattgattct gagcaggtga 3960
aagtattagc tgaaccgctg aaaaaaaatg cttatggtca gtacctacta aaaatgattg 4020
aaggttatta ataaaatgaa cgtaattaaa actgaaattc ctgatgtgtt aatttttgag 4080
ccgaaagttt ttggtgatga gcgtggtttc tttatggaaa gctttaatca gaaagttttc 4140
gaagaggctg taggacgtaa ggttgaattt gttcaggata accattcgaa gtctagtaaa 4200
ggtgttttac gcgggctgca ttatcagtta gaaccttatg cgcaagggaa attggtacgt 4260
tgcgttgttg gtgaggtttt tgatgtagct gttgatattc gtaaatcgtc gcctaccttt 4320
ggtaaatggg ttggggtgaa tttatctgct gagaataagc ggcaattgtg gatacctgaa 4380
ggatttgcac atggtttttt ggtgctgagt gaaacggcgg agtttttgta taagacgact 4440
aattattatc atcctgaaag tgatagggga attatttggg atgattcctt cattaatatc 4500
caatggcctt atgctgagtg cattatttta tctgacaaag ataaacatca gcctagatta 4560
tctagataat taatataacc taggtttttt attgttattc atgagctatc tttatgaatg 4620
gttgagtttc ccaatttaaa acagattaat ttgtcaaggt caaaatatgt gtaaaattgt 4680
ggtgtataca gctattacag ggaattatga taatattaag cccctgtcat acgttaatac 4740
caactttgat tatttgtgtt ttacagacta tgaatataca ggtgttattc ctgagccttg 4800
gaaacagatt cgaatgccac cagcgaagtg gtgtaataag gacttggcac gatatattaa 4860
aatgaatgtg catgagattt tacctaatta tgaagctagt gtttggattg atggaaatat 4920
agacattatc aacaatattg agggtttggt ttttgatgcc ttaaaaaaag ggggggcctc 4980
atcataccaa cattggggcc gaaataatat taatgaggaa atgattgagt gtgcaaaaat 5040
tggatacgat agtattttta ttcttttgaa acaaatgaaa caatatggta atgaaggttt 5100
catctcaaac gaactgtatg aaacaaatgt tttgattaga gatcatacta atagcagtat 5160
ttctgaattc tctaaaattt ggtgggagca atatatgcag tatggtaaac gagatcaata 5220
cgcctttact tatgctgcgt ggaaatctgg actaaatatt cataatttag gacgacatga 5280
ccctagattt attaaaaaat atttttcata ttttccacat aaaaatggga aaagcataaa 5340
agtatatagg ataaaacaat taattaataa aataaccaat cgtattacgc tcagaattat 5400
taaaatataa cagtatgaag gtttatttat aatggtttac ggttttctat ggtgtctatg 5460
ttttctatta agtttgttta ataataacag ttattttaaa tattatatta cactatgtat 5520
aataatggtt ctttggtttt tggcttcctt taggggggca ggagttgatg gtgattatgc 5580
aaattatatt gagtacataa atgatgctca aagtattgga tattcttata gaggtggtta 5640
tttttttgat tggatagtta atttttttgt ttatattggc ttgcctgcca catatgtttt 5700
tgcagtatat gcacttgcca taccgataaa aataaaatta tttcaaaagt tttcattatt 5760
atcttcttct atattactcg gttatgttgg tttttttatt tatctgcatg attttactca 5820
aattagagct ggcttagctg ttggtattgc tttttggggg atttattatt acgcatatca 5880
gaataaaata aaggcagtaa tactattttt tgcgagttgc tttattcatc catcgctcat 5940
atttcttgtg gcctttgtat gctttaataa attcttgtct aataaattat tagtggtcac 6000
actgatgata agtattattt tatgtataat aaatgcaaat acatttatag tacagaaaat 6060
agttgattta agtggcagtg cagatcttga tttatattat cgcttggcag ttgatggtca 6120
gattattaaa acatttggag catttccatt actgaattta tttatatcga tagtatcact 6180
gtattatttg aataatatag caagagaaaa tgctttactt tcaatcttta ttaagatgct 6240
tttgttttcg caaatttcat ggttcctttt ctctcccata cctgtattag ctgcacgaat 6300
aagtcagatt tttttattct caattgtctt tgttttgccg catttatctg taaagctatt 6360
taatcagcca ataactatac cagcactata tagctttgtg ggttttttag cctttattat 6420
tatagccgaa ttaatgcatc catatcagtt aggattttga tacataaatg aagataacta 6480
tcttggtagt gctttataat aaaaaattta aagaaagccc aacattacag acaatattga 6540
gtgaaaaaca taccttgaaa aaaatgaatg ttgaactctg tattcatgac aattcaccca 6600
attcgcaatt agatgagtgt tatattagtg agatgaagga atttgtaaaa tgttattata 6660
cacacacacc agaaaatatg acattaagag agatatataa taatataatt aataccttaa 6720
aatacaatac ttatctttgt ttgatggatg atgatactag tttaccacag tccttcttta 6780
atgaggtaat aagtgctatc aataaaaatc cagatattga gttaattgta ccacgagtta 6840
tcgttaatga taagctttat agtccacata aaagttattc atttataaat agaccaacat 6900
ttagggatat taaaggaata cagaagtcca ggaacatgtc ggctataaat agtgggatgg 6960
taatcaaatc aaattttttt aaacgttgtg ggtttaaata tcctgaatat acaagttatt 7020
atgggacgga taaggctttt tttgatcatt atctaaaata taatcaagaa tattatgttt 7080
tagatattga tataaatcat gatgtaagta accatccaca taataaagat gatgtacgtt 7140
attcacagat tatttcatct gtgaatttct tttggatgca acatttaaaa ggaaactatg 7200
cgcttaagtt tttatacata atttatatta tattatatcg tatcaaacta tccatactca 7260
ggaaaaattt aatttttatt aaatcaatag tatctctagg taataaataa tgaaaaataa 7320
tagctataaa gtatttcctt tttattttcc tcaattttat gcaacgaaag aaaatgatat 7380
gtggtggggg aaaggtttta ctgattggga actggtaaaa aaagctcaag cagtacatca 7440
atctcagtca caacctcgta ttcctctaaa tggctattat gatcagtctg atccagtagt 7500
aataaaaaaa caatcaaaat tagcaagtga atatggaata gatggtttta atttctatca 7560
ctactggttt gatggtactg tgttgctaga taaacctatg caaaatttat ataatgataa 7620
aagtatcgat atagaatatt tctttacatg ggctaatgaa acatggacaa ggcagtgggt 7680
tggacgcccg caagatctac taataaagca agaacataaa gtggatataa atatatggaa 7740
tgaacactat gaatatttga ggaaattttt tcttgacgat aggtatttaa aaatcaataa 7800
ttcacctgtg ctttgcatat atagacctga acttttaaaa tcgttaagag aatgggtggc 7860
tttttttaat aataaagcaa agtgtgatgg atttgatggc atacatttga tcgcattacg 7920
agcatacagt attgcaaatg cagattctgt ttataaatat tttgataaaa ttgttaactt 7980
tcaacctaga tttgcaataa acactcattt aaaaaaatcg agtccactaa agaaattaat 8040
tgaaagcact ctaaggattg ctccagagtg gcttcagttg cagcttgtaa gaataataaa 8100
aaataagaga gcaacttata atcattataa atatagtgat tatatacaat caatgaaaaa 8160
cgacgtaacg gaatataaag gtaagccaat ataccccgtt gtttttcctg actgggataa 8220
tgccccaaga tataaagaaa atgcaacttt tttttgtgaa tcttcagcat ttgattttga 8280
aaaagcattg aatatcgctt gtgatattac gagaaatcat gatgacaagc tgatatttat 8340
taatgcttgg aatgaatggt ctgaaggagc atatttagaa ccagatgaaa tgtacaaata 8400
ttctaattta gaaattatta aaaaagtatt tcaggataag agatgaaacg cattgctatt 8460
ttattagcag catataatgg cgctcgatgg ttagaagagc aaattagctc aatcctacaa 8520
caaacgaatg ttgaggttac tatatatgtt agtattgatc tgtcaaatga tgaaacttat 8580
ttattagttt caaagttggc tttaaaggaa cctaggatca taattcttcc ctatggtgat 8640
atatatggag gggctgcaaa gaatttttac cggttaattt gtgaagtcga ctatgaaaat 8700
tatgattata tagctttgtc tgatcaggac gacgtatggc gaaaaaacaa actagaacgt 8760
gcatgtgagt ttttaaaaaa taacgatttt tattctagta atgtcatcgc attttgggaa 8820
aatgggaaac aagcactaat aactaagtca caagataagg ttgcatttga tcattttttt 8880
gaatcggcag ggccaggttg tacatttgtt tttaagagag aatatgctct tcaactcaag 8940
cgtttcttga tgataaataa acatgccatg gatgtagaac ttcatgactg gttgatttac 9000
gcatttgcac gagaaaataa cttaaaatgg catattgatt cgtatccggg aatgtattat 9060
cgacaacata aaaataacca agtaggagca aataattcac taaaagcaat tattaaaaga 9120
attcgactta taaagtccgg atggtatagg aatgaaataa taaagatatt aaatttattt 9180
gaacaaagtg atattccctt tagagataac ctttgtaata aaaattactt tacctcatta 9240
tttctcttaa aatatattta tatgataaga cgaaagagaa aagatagagc atttttagtt 9300
ttaatgatta tttttggtct tttttaactt ataggaatat tcaatgaatt ttgtatcgtt 9360
agaaaacatg attagcgata ttaggggttt tataccagaa cttgcaattc atgattttga 9420
cctcattgtc ggtattccaa gaagtgggat gattccagca tatacaattg gattgtattt 9480
aaatattgat gttacagatg tttcttcttt tgtgaaaaat gtaccattgc aaagaggaat 9540
ttctagggaa aaaccaacta gccttaagct gcctcaagac gcaaaaaaaa tactattagt 9600
ggatgatagt tatacaacag gaaaatcgttagctaatact ctaggcaaaa ttcctatgga 9660
acttaggaat cgcattgtat cttttgcatt gtataccaca gacagagaaa atcataattt 9720
agatatgttt atacgggtag taaaataccc acgtgtgttc gaatggaata ttctgaatca 9780
taacattatt ggcaatagtt gcttagatat agacggtgtg ttatgtatgg atcctacaga 9840
tgatgataat gatgatggac aaaaatatat aactttcctt gaaaatgcga aaccaaaatt 9900
tattccaaaa gtgaaaataa agtatcttgt tacaaacagg ttggaaaaat atagaactca 9960
taccgagaaa tggttatcta aaaataatgt taaatatgag caattaataa tgttagatct 10020
taaaacaaaa gaagaaagaa taagatctgg acttcattcc acacataagg ctaaatttta 10080
taaacattct ggttgttcac tttttattga aagtgatgtt aaacaagcat atgaaataat 10140
gatgcaaagt ggtttgccgg tatattgtat tgatgacaat acaatgtata aaccaggtat 10200
gacaaaatat tttataaagc aacctagcaa tgcattaaaa aaaatcattc tctggttacc 10260
aatactaata tataaaaata ttcctaagcc atatcagaaa attattcggc gtttgataaa 10320
aaaataaaaa gaaccaagtc atatggcttg gttctttgct gataaattac ctttttttaa 10380
tttttgtttg caatgtttta ataagtttcc tgctttctga tatgggcaat agaagcagta 10440
aataaatggt tccaccgatt gctgataaaa caaaaagaga tttaatgtca gatgcgaaat 10500
gaactctaac atttgatatt aatatgaagc ttatagcagc agatataaat agtggataag 10560
tttttttaaa tatgcttaaa atatttgatt ttattgtttt catcgtgaat ataatacatg 10620
gaataaaatg tattgcattt gcaatgaaat aatattttgc aagatcaaca attccgcaat 10680
ggatgcccac cataaatgat accgcagtta atatagttcc ctggatgcct aaaagaagca 10740
aaatacctgt tttcccttga gacatgaaaa tagtgccagt ggtgcttagc accgactgta 10800
ttattgcagt gggggcaagc caaactaata tatccgcaga cagaatccat tgttctccaa 10860
aaacaacttg aatgaaaagt ttgtttaagc tagtaattac tgtaactaat ggtaaagtaa 10920
taaaccaaat aatatagatt gtatttaaat aaatatcatt tatttctttg taattatttt 10980
tcttctggct taatatagga tataaagaac gattagcaat aaaagtcaaa gatgagagtg 11040
ggaatagcat aatccgataa gctaaattat aagatccaag tatagatgct gacatatact 11100
taccgatcag aaaactatca agatttctgg caaaaaaatt aattatatta aaaagagaaa 11160
gttgtgaggt aaaacgaaat atttctttta aatgatttat cacatgtcta ggtttgcctt 11220
taggtctcca tggggatact atccataaca gtactgcaga gctcaaagaa ttaagcagag 11280
attgaaatac cagactatat attccaaagc tattattagc taatataata gctaataaaa 11340
gagacaaagc agctgaaaat acttcaattt tagaaataat aaaaaatttc gattctcttt 11400
caagcatagc tagatgcaat gatgaagagc cggaaataat aaaactaaaa gatagcaaag 11460
gtaaaacaat tagtagttta ggttgattgt acaaatgtga tataaagggg gtaagtgttg 11520
taataataat aaataccaaa aagcctaaca aaaaattaag ccaaaaaacg gcacttttag 11580
tttcatcttg caattgttct ttttgtataa ttgctgctga ggtccctaaa tctcgaaata 11640
aactagcaaa attcattaca acaccagcca ttgccatgat gccgtattca tttggtggta 11700
ttattcttgc taaataaaca atgcttatta gctgagttag tattttgaaa acttgtgaaa 11760
aagtattcca ttttaaatta ttgaaaatgc tcatgtttta atctcactgt tccgattttt 11820
aaattatacc tgaactgtta gaatgctaca atatttttga ttattgatac taatctctat 11880
attattgata ccacattggc gattagtttg agtatgttac tacaggcgat ataattttat 11940
atctaccttg gcttggcgat ttattatttg ttgttaacag aatacctttg taatttatat 12000
taactgtata tatctatttc ttttatcgtt gaatcaaaat ctgacaggag taaacaatgt 12060
caaagcaaca gatcggcgtc gtcggcatgg cagtgatggg gcgcaacctt gcgctcaaca 12120
tcgaaagccg tggttatacc gtctctattt tcaaccgttc ccgtgaaaag acggaagaag 12180
tgattgccga aaatccaggc aagaaactgg ttccttacta tacggtgaaa gagtttgttg 12240
aatctctgga aacgcctcgt cgcatcctgt tagtggtgaa agcaggtgca ggcacggatg 12300
ctgctattga ttccctcaaa ccatatctcg ataaaggcga catcatcatt gatggtggta 12360
acaccttctt ccaggacacc attcgtcgta atcgtgagct ttctgcagaa ggctttaact 12420
tcattggtac cggtgtttcc ggcggtgaag aaggtgcgct gaaaggtcct tccattatgc 12480
ctggtgggca gaaagaagcc tatgaactgg ttgcaccgat cctgaccaaa atcgccgcag 12540
tggctgaaga cggtgagcca tgcgttacct atattggtgc cgatggtgca ggtcattatg 12600
tgaagatggt tcacaacggt attgaatacg gtgatatgca actgattgcc gaagcctatt 12660
ctctgctaaa aggtggcctg aaccttacca acgaagaact ggcacagacc tttaccgagt 12720
ggaataacgg tgaactgagc agctacctga tcgacatcac caaagacatc ttcactaaaa 12780
aagatgaaga cggtaactac ttggttgatg tgattctgga tgaagcggct aacaaaggta 12840
ccggtaaatg gaccagccag agtgcgctgg atctcggcga accgctgtcg ctgattaccg 12900
agtctgtgtt tgcacgttat atctcgtctc tgaaagatca gcgtgttgcc 9cgtctaaag 12960
ttctctctgg tccgcaagcg cagccagcag gcgataaagc tgagtttatc gagaaagttc 13020
gccgtgcgct gtatctgggc aaaatcgttt cttacgctca gggcttctct cagctgcgtg 13080
ctgcgtctga agagtacaac tgggatctga actacggtga aatcgcgaag attatccgtg 13140
ctggctgcat catccgtgcg cagttcctgc agaaaatcac cgatgcttat gccgaaaatc 13200
cgcagatcgc taacctgctg ctggctcctt acttcaagca aattgccgat gactaccagc 13260
aggcgctgcg cgatgtcgtc gcttatgcag tacagaacgg tatcccggtt ccgaccttcg 13320
ccgctgcggt tgcctattac gatagctacc gtgccgctgt tctgcct 13367
Glycosyltransferase gene in the table one Shigella bogdii 11 type O antigen genes bunch and oligosaccharide unit treatment gene and wherein primer and PCR data
| Gene | Function | The base position of gene | Forward primer | Reverse primer | PCR product length | Produce the group number of correct big or small electrophoresis band | The annealing temperature of PCR (℃) |
| Orf5 | Glycosyltransferase | 4667 to 5410 | #159 (4882 to 4900) | #160 (5283 to 5300) | 419bp | 0 * | 60 |
| #5 (5116 to 5133) | #6 (5386 to 5403) | 288bp | 0 * | 45 | |||
| #7 (4681 to 4697) | #8 (5373 to 5390) | 710bp | 0 * | 48 | |||
| Wzy | Polysaccharase | 5432 to 6460 | #161 (5620 to 5638) | #162 (5980 to 5998) | 379bp | 0 * | 60 |
| #1 (5517 to 5536) | #2 (6323 to 6341) | 825bp | 0 * | 45 | |||
| #3 (5439 to 5457) | #4 (5831 to 5847) | 409bp | 0 * | 48 | |||
| orf7 | Glycosyltransferase | 6468 to 7310 | #163 (6578 to 6596) | #164 (7014 to 7032) | 455bp | 0 | 55 |
| #183 (6664 to 6682) | #184 (6882 to 6899) | 236bp | 0 | 50 | |||
| #185 (6717 to 6735) | #186 (6977 to 6995) | 279bp | 0 | 50 | |||
| Orf8 | Glycosyltransferase | 7310 to 8446 | #165 (7502 to 7520) | #166 (7974 to 7992) | 491bp | 0 ** | 60 |
| #121 (8019 to 8036) | #122 (8372 to 8391) | 373bp | 0 * | 50 | |||
| #123 (7376 to 7394) | #124 (8219 to 8237) | 862bp | 0 * | 48 | |||
| orf9 | Glycosyltransferase | 8443 to 9327 | #167 (8674 to 8691) | #168 (9200 to 9218) | 545bp | 0 | 50 |
| #187 (8814 to 8832) | #188 (9139 to 9157) | 344bp | 0 | 50 | |||
| #189 (8543 to 8560) | #190 (9053 to 9070) | 528bp | 0 | 55 |
| orf10 | Glycosyltransferase | 9344 to 10327 | #169 (9727 to 9745) | #170 (10308 to 10325) | 589bp | 0 | 55 |
| #191 (9784 to 9802) | #192 (10015 to 10033) | 250bp | 0 | 55 | |||
| #193 (9430 to 9457) | #194 (10220 to 10239) | 810bp | 0 | 50 | |||
| Wzx | The transhipment enzyme | 10367 to 11794 | #171 (10484 to 10502) | #172 (10748 to 10765) | 282bp | 0 ** | 55 |
| #157 (10599 to 10617) | #158 (11509 to 11527) | 929bp | 0 * | 50 | |||
| #119 (10997 to 11015) | #120 (11692 to 11710) | 714bp | 0 * | 45 |
*In all groups, obtain the band of 1 wrong size
*In all groups, all obtain the band of 2 wrong sizes
Table two 166 strain intestinal bacteria and 43 strain Shigellaes and their source
| Group number | The bacterial strain that contains in this group | The source |
| 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 | Wild-type e. coli O1, O2, O3, O10, O16, O18, O39 wild-type e. coli O40, O41, O48, O49, O71, O73, O88, O100 wild-type e. coli O102, O109, O119, O120, O121, O125, O126, O137 wild-type e. coli O138, O139, O149, O7, O5, O6, O11, O12 wild-type e. coli O13, O14, O15, O17, O19ab, O20, O21, O22 wild-type e. coli O23, O24, O25, O26, O27, O28, O29, O30 wild-type e. coli O32, O33, O34, O35, O36, O37, O38, O42 wild-type e. coli O43, O44, O45, O46, O50, O51, O52, O53 wild-type e. coli O54, O55, O56, O57, O58, O59, O60, O61 wild-type e. coli O62, O63, O64, O65, O66, O68, O69, O70 wild-type e. coli O74, O75, O76, O77, O78, O79, O80, O81 wild-type e. coli O82, O83, O84, O85, O86, O87, O89, O90 wild-type e. coli O91, O92, O95, O96, O97, O98, O99, O101 wild-type e. coli O112, O162, O113, O114, O115, O116, O117, O118 wild-type e. coli O123, O165, O166, O167, O168, O169, O170, O171 wild-type e. coli O172, O173, O127, O128, O129, O130, O131, O132, wild-type e. coli O133, O134, O135, O136, O140, O141, O142, O143 wild-type e. coli O144, O145, O146, O147, O148, O150, O151, O152 wild-type e. coli O153,0154, O155, O156, O157, O158, O159, O164 wild-type e. coli O160, O161, O163, O8, O9, O124, O111 wild-type e. coli O103, O104, O105, O106, O107, O108, O110 Shigella bogdii serotypes B 4, B5, B6, B8, B9, B11, B12, B14 Shigella bogdii serotypes B 1, B3, B7, B8, B10, B13, B15, B16, B17, B18 shigella dysenteriae serotype D1, D2, D3, D4, D5, D6, D7, D8 shigella dysenteriae serum D9, D10, D11, D12, D13 shigella flexneri F6a, F1a, F1b, F2a, F2b, F3, F4a, F4b, F5 (v:7) F5 (v:4) bacillus ceylonensis A D5, DR | IMVS a IMVS IMVS lMVS IMVS IMVS IMVS IMVS IMVS IMVS IMVS IMVS IMVS IMVS See b See c IMVS IMVS 1MVS IMVS IMVS See d See d See d See d See d See d |
| A.Institude of Medical and Veterinary Science, Anelaide, Australia b.O123 from IMVS; The rest from Statens Serum Institut, Copenhagen, Denmark is and 173 from Statens Serum Institut c.172, Copenhagen, Denmark, epidemiological study institute of the rest from IMVS d. China Preventive Medicial Science Institute | ||
Table 3 is structural tables of the O-antigen gene bunch of Shigella bogdii 11 types
Table 4 is location tables of the gene in the O-antigen gene bunch of Shigella bogdii 11 types
ctcctggtaa ctcacgcgtc caagaacgcg gtcgaaaacc acttcgacac ctcttatgaa 60
ttagaatctc tccttgaact gcgcgtgaag cgtcaactgc tggccgaagt acagtccatt 120
tgcccgccgg gcgtgaccat tatgaacgtg cgtcagggcg aacctttagg tttaggccac 180
tccattttat gtgcacgacc cgccattggt gacaatccat ttgtcgtggt gctgccagac 240
gttgtgatcg atgacgccag cgccgacccg ctgcgctaca accttgcagc catgattgcg 300
cgcttcaacg aaacgggccg tagccaggtg ctggcaaaac gtatgccagg tgacctctct 360
gaatactctg tcatccagac caaagagccg ctggatcgcg aaggcaaagt cagccgcatt 420
gttgaattta tcgaaaaacc ggatcagccg cagacgctgg actcagacat catggccgta 480
ggtcgttatg tgctttctgc cgatatttgg ccggaacttg aacgcacgca gccaggggca 540
tggggacgta ttcagctgac agatgccatc gctgaactgg cgaaaaaaca gtccgttgat 600
gcaatgctga tgactggtga cagctacgac tgcggtaaaa aaatgggcta tatgcaggcg 660
tttgtgaagt atggactacg caacctgaaa gaaggggcga agttccgcaa aggtattgag 720
aagctgttaa gcgaataatg aaaatctgac cggatgtaac ggttgataag aaaattataa 780
cggcagtgaa gattcgtggc gaaagtaatt tgttgcgaat tttcctgccg ttgttttata 840
taaacaatca gaataacaac gagttagcaa taggattttt gtcaaagttt tccaggattt 900
tccttgtttc cagagcggat tggtaagaca attagcgttt gaatttttcg ggtttagcgc 960
gagtgggtaa cgctcgtcac atcgtaggca tgcatgcagt gctctggtag ctgtaaagcc 1020
aggggcggta gcgtgcatta atacctctat taatcaaact gagagccgct tatttcacag 1080
catgctctga agtaatatgg aataaattaa gtgaaaatac ttgttactgg tggcgcagga 1140
tttattggtt ctgctgtagt tcgtcacatt ataaataata cgcaggatag tgttgttaat 1200
gtcgataaat taacgtacgc cggaaacctg gaatcacttg ctgatgtttc tgattccgaa 1260
Orf1's is initial
cgctatgttt ttgaacatgc ggatatttgc gatgcagctg ta
atggcacg gatttttgct1320
cagcatcagc cggatgcagt gatgcacctg gctgctgaaa gccatgtgga ccgttcaatt 1380
acaggtcctg cggcatttat tgaaaccaat attgttggta catatgtcct tttggaagcc 1440
gctcgcaatt actggtctgc tcttgatagc gacaagaaaa atagcttccg ttttcatcat 1500
atttctactg acgaagtcta tggttatttg cctcatcctg acgaggtgaa taatacagaa 1560
gaattaccct tatttactga gacaacagct tacgcgccaa gcagccctta ttccgcatcc 1620
aaagcatcca gcgatcattt agtccgcgcg tggaaacgta cctatggttt accgaccatt 1680
gtgactaatt gttcgaataa ctacggtcct tatcactttc cggaaaaatt gattccacta 1740
gtaattctta atgctctgga aggtaaggca ttacctattt atggcaaagg ggatcaaatt 1800
cgcgactggc tgtatgttga agatcatgca cgtgcgttat ataccgtcgt aaccgaaggt 1860
aaagcgggtg aaacttataa cattggtgga cacaacgaaa agaaaaacat cgatgtagtg 1920
ctcactattt gtgatttgtt ggatgagatt gtaccgaaag agaaatctta ccgcgagcaa 1980
attacttatg ttgccgatcg tccgggacac gatcgccgtt atgccattga tgctgagaag 2040
attgctcgcg aattgggatg gaaaccacag gaaacgtttg agagcgggat tcggaagaca 2100
gtggaatggt acctgtccaa tacaaaatgg gttgataatg tgaaaagtgg tgcctatcaa 2160
The termination orf2's of orf1 is initial
tcgtggattg aacagaacta tgagggccgc cag
taatgaa tattctcctt ttcggcaaaa 2220
cagggcaggt aggttgggaa ctacagcgtg ctctggcacc tttgggtaat ttgattgctc 2280
ttgatgttca ctccactgat tattgtggtg attttagtaa tcctgaaggt gtggctgaaa 2340
ccgtcaaaaa aattcgccct gatgttattg ttaatgctgc ggctcatacc gcagtagata 2400
aggctgagtc agaacccgaa tttgcacaat tactcaatgc gaccagcgtt gaatcaattg 2460
caaaagcggc taatgaagtt ggggcctggg taattcatta ctcaactgac tacgtatttc 2520
cgggaaccgg tgaaatacca tggctggaga cggatgcaac cgcaccgcta aatgtttacg 2580
gtgaaaccaa gttagccgga gaaaaagcgt tacaggaaca ttgcgcgaag catcttattt 2640
tccgtaccag ctgggtatac gcaggtaaag gaaataactt cgccaaaacg atgttgcgtc 2700
tggcaaaaga gcgtgaagaa ttagcggtta ttaacgatca gtttggtgca ccaacgggtg 2760
ctgagctgct ggctgattgt acggcacatg ctattcgtgt tgcactgaaa aaaacagaag 2820
tcgcaggctt gtaccatttg gtagctagtg gtaccacaac ctggtacgat tatgctgcgc 2880
tggtttttga agaggcgcgc aaagcaggca ttccccttgt actcaacaag ctcaacgcag 2940
taccaacaac tgcctatcct acaccagctc gtcgtccaca taactctcgc cttaatacag 3000
aaaaatttca gcagaacttt gcgcttgtct tgcctgactg gcaggttggc gtgaaacgaa 3060
The termination of orf2
tgctcaacga attatttacg actacagcaa tt
taatagtt tttgcatctt gttcgtgatg 3120
Orf3's is initial
gtggagcaag atgaattaaa aggaatgatg aa
atgaaaac gcgtaaaggt attattttag 3180
cgggtggttc tggtacacgt ctttatcctg tgacgatggc cgtcagtaaa cagctgttac 3240
cgatttatga taaaccgatg atctattacc cgctttctac actgatgtta gcgggtattc 3300
gcgatattct gattatcagt acgccacagg atactcctcg ttttcaacaa ctgctgggtg 3360
acgggagcca gtgggggcta aatcttcagt acaaagtaca accgagtccg gatggtcttg 3420
cgcaggcgtt tattatcggt gaagagttta ttggtggtga tgattgtgct ttggttcttg 3480
gtgacaatat cttctacggt cacgatctgc cgaagttaat ggacgtagct gttaacaaag 3540
aaagtggtgc aacggtattt gcctatcacg ttaatgatcc tgaacgctac ggtgtcgttg 3600
agtttgataa aaacggtacg gcgatcagcc tggaagaaaa accgctacaa ccaaaaagta 3660
attatgcggt aaccgggctt tatttttatg ataacgacgt tgtcgaaatg gcgaaaaatc 3720
ttaagccttc tgcccgcggt gaactggaaa ttaccgatat taaccgtatt tatatggaac 3780
aggggcgttt atccgttgcc atgatggggc gtggatatgc atggctggac acgggaacac 3840
atcaaagtct tattgaagca agcaacttca ttgcaacaat tgaagaacgt caggggctga 3900
aagtatcctg cccggaagaa attgcttacc gtaaaggatt tattgattct gagcaggtga 3960
aagtattagc tgaaccgctg aaaaaaaatg cttatggtca gtacctacta aaaatgattg 4020
The termination orf4's of orf3 is initial
aaggttat
ta ataaa
atgaa cgtaattaaa actgaaattc ctgatgtgtt aatttttgag4080
ccgaaagttt ttggtgatga gcgtggtttc tttatggaaa gctttaatca gaaagttttc 4140
gaagaggctg taggacgtaa ggttgaattt gttcaggata accattcgaa gtctagtaaa 4200
ggtgttttac gcgggctgca ttatcagtta gaaccttatg cgcaagggaa attggtacgt 4260
tgcgttgttg gtgaggtttt tgatgtagct gttgatattc gtaaatcgtc gcctaccttt 4320
ggtaaatggg ttggggtgaa tttatctgct gagaataagc ggcaattgtg gatacctgaa 4380
ggatttgcac atggtttttt ggtgctgagt gaaacggcgg agtttttgta taagacgact 4440
aattattatc atcctgaaag tgatagggga attatttggg atgattcctt cattaatatc 4500
caatggcctt atgctgagtg cattatttta tctgacaaag ataaacatca gcctagatta 4560
The termination of orf4
tctaga
taat taatataacc taggtttttt attgttattc atgagctatc tttatgaatg 4620
Orf5's is initial
gttgagtttc ccaatttaaa acagattaat ttgtcaaggt caaaat
atgt gtaaaattgt 4680
ggtgtataca gctattacag ggaattatga taatattaag cccctgtcat acgttaatac 4740
caactttgat tatttgtgtt ttacagacta tgaatataca ggtgttattc ctgagccttg 4800
gaaacagatt cgaatgccac cagcgaagtg gtgtaataag gacttggcac gatatattaa 4860
aatgaatgtg catgagattt tacctaatta tgaagctagt gtttggattg atggaaatat 4920
agacattatc aacaatattg agggtttggt ttttgatgcc ttaaaaaaag ggggggcctc 4980
atcataccaa cattggggcc gaaataatat taatgaggaa atgattgagt gtgcaaaaat 5040
tggatacgat agtattttta ttcttttgaa acaaatgaaa caatatggta atgaaggttt 5100
catctcaaac gaactgtatg aaacaaatgt tttgattaga gatcatacta atagcagtat 5160
ttctgaattc tctaaaattt ggtgggagca atatatgcag tatggtaaac gagatcaata 5220
cgcctttact tatgctgcgt ggaaatctgg actaaatatt cataatttag gacgacatga 5280
ccctagattt attaaaaaat atttttcata ttttccacat aaaaatggga aaagcataaa 5340
agtatatagg ataaaacaat taattaataa aataaccaat cgtattacgc tcagaattat 5400
The termination orf6's of orf5 is initial
taaaata
taa cagtatgaag gtttatttat a
atggtttac ggttttctat ggtgtctatg5460
ttttctatta agtttgttta ataataacag ttattttaaa tattatatta cactatgtat 5520
aataatggtt ctttggtttt tggcttcctt taggggggca ggagttgatg gtgattatgc 5580
aaattatatt gagtacataa atgatgctca aagtattgga tattcttata gaggtggtta 5640
tttttttgat tggatagtta atttttttgt ttatattggc ttgcctgcca catatgtttt 5700
tgcagtatat gcacttgcca taccgataaa aataaaatta tttcaaaagt tttcattatt 5760
atcttcttct atattactcg gttatgttgg tttttttatt tatctgcatg attttactca 5820
aattagagct ggcttagctg ttggtattgc tttttggggg atttattatt acgcatatca 5880
gaataaaata aaggcagtaa tactattttt tgcgagttgc tttattcatc catcgctcat 5940
atttcttgtg gcctttgtat gctttaataa attcttgtct aataaattat tagtggtcac 6000
actgatgata agtattattt tatgtataat aaatgcaaat acatttatag tacagaaaat 6060
agttgattta agtggcagtg cagatcttga tttatattat cgcttggcag ttgatggtca 6120
gattattaaa acatttggag catttccatt actgaattta tttatatcga tagtatcact 6180
gtattatttg aataatatag caagagaaaa tgctttactt tcaatcttta ttaagatgct 6240
tttgttttcg caaatttcat ggttcctttt ctctcccata cctgtattag ctgcacgaat 6300
aagtcagatt tttttattct caattgtctt tgttttgccg catttatctg taaagctatt 6360
taatcagcca ataactatac cagcactata tagctttgtg ggttttttag cctttattat 6420
The termination orf7's of orf6 is initial
tatagccgaa ttaatgcatc catatcagtt aggattt
tga tacataa
atg aagataacta6480
tcttggtagt gctttataat aaaaaattta aagaaagccc aacattacag acaatattga 6540
gtgaaaaaca taccttgaaa aaaatgaatg ttgaactctg tattcatgac aattcaccca 6600
attcgcaatt agatgagtgt tatattagtg agatgaagga atttgtaaaa tgttattata 6660
cacacacacc agaaaatatg acattaagag agatatataa taatataatt aataccttaa 6720
aatacaatac ttatctttgt ttgatggatg atgatactag tttaccacag tccttcttta 6780
atgaggtaat aagtgctatc aataaaaatc cagatattga gttaattgta ccacgagtta 6840
tcgttaatga taagctttat agtccacata aaagttattc atttataaat agaccaacat 6900
ttagggatat taaaggaata cagaagtcca ggaacatgtc ggctataaat agtgggatgg 6960
taatcaaatc aaattttttt aaacgttgtg ggtttaaata tcctgaatat acaagttatt 7020
atgggacgga taaggctttt tttgatcatt atctaaaata taatcaagaa tattatgttt 7080
tagatattga tataaatcat gatgtaagta accatccaca taataaagat gatgtacgtt 7140
attcacagat tatttcatct gtgaatttct tttggatgca acatttaaaa ggaaactatg 7200
cgcttaagtt tttatacata atttatatta tattatatcg tatcaaacta tccatactca 7260
The termination of the initial orf7 of orf8
ggaaaaattt aatttttatt aaatcaatag tatctctagg taataaata
a tgaaaaa
taa7320
tagctataaa gtatttcctt tttattttcc tcaattttat gcaacgaaag aaaatgatat 7380
gtggtggggg aaaggtttta ctgattggga actggtaaaa aaagctcaag cagtacatca 7440
atctcagtca caacctcgta ttcctctaaa tggctattat gatcagtctg atccagtagt 7500
aataaaaaaa caatcaaaat tagcaagtga atatggaata gatggtttta atttctatca 7560
ctactggttt gatggtactg tgttgctaga taaacctatg caaaatttat ataatgataa 7620
aagtatcgat atagaatatt tctttacatg ggctaatgaa acatggacaa ggcagtgggt 7680
tggacgcccg caagatctac taataaagca agaacataaa gtggatataa atatatggaa 7740
tgaacactat gaatatttga ggaaattttt tcttgacgat aggtatttaa aaatcaataa 7800
ttcacctgtg ctttgcatat atagacctga acttttaaaa tcgttaagag aatgggtggc 7860
tttttttaat aataaagcaa agtgtgatgg atttgatggc atacatttga tcgcattacg 7920
agcatacagt attgcaaatg cagattctgt ttataaatat tttgataaaa ttgttaactt 7980
tcaacctaga tttgcaataa acactcattt aaaaaaatcg agtccactaa agaaattaat 8040
tgaaagcact ctaaggattg ctccagagtg gcttcagttg cagcttgtaa gaataataaa 8100
aaataagaga gcaacttata atcattataa atatagtgat tatatacaat caatgaaaaa 8160
cgacgtaacg gaatataaag gtaagccaat ataccccgtt gtttttcctg actgggataa 8220
tgccccaaga tataaagaaa atgcaacttt tttttgtgaa tcttcagcat ttgattttga 8280
aaaagcattg aatatcgctt gtgatattac gagaaatcat gatgacaagc tgatatttat 8340
taatgcttgg aatgaatggt ctgaaggagc atatttagaa ccagatgaaa tgtacaaata 8400
The termination of the initial orf8 of orf9
ttctaattta gaaattatta aaaaagtatt tcaggataag ag
atgaaacg cattgctatt 8460
ttattagcag catataatgg cgctcgatgg ttagaagagc aaattagctc aatcctacaa 8520
caaacgaatg ttgaggttac tatatatgtt agtattgatc tgtcaaatga tgaaacttat 8580
ttattagttt caaagttggc tttaaaggaa cctaggatca taattcttcc ctatggtgat 8640
atatatggag gggctgcaaa gaatttttac cggttaattt gtgaagtcga ctatgaaaat 8700
tatgattata tagctttgtc tgatcaggac gacgtatggc gaaaaaacaa actagaacgt 8760
gcatgtgagt ttttaaaaaa taacgatttt tattctagta atgtcatcgc attttgggaa 8820
aatgggaaac aagcactaat aactaagtca caagataagg ttgcatttga tcattttttt 8880
gaatcggcag ggccaggttg tacatttgtt tttaagagag aatatgctct tcaactcaag 8940
cgtttcttga tgataaataa acatgccatg gatgtagaac ttcatgactg gttgatttac 9000
gcatttgcac gagaaaataa cttaaaatgg catattgatt cgtatccggg aatgtattat 9060
cgacaacata aaaataacca agtaggagca aataattcac taaaagcaat tattaaaaga 9120
attcgactta taaagtccgg atggtatagg aatgaaataa taaagatatt aaatttattt 9180
gaacaaagtg atattccctt tagagataac ctttgtaata aaaattactt tacctcatta 9240
tttctcttaa aatatattta tatgataaga cgaaagagaa aagatagagc atttttagtt 9300
The termination orf10's of orf9 is initial
ttaatgatta tttttggtct tttt
taactt ataggaatat tca
atgaatt ttgtatcgtt9360
agaaaacatg attagcgata ttaggggttt tataccagaa cttgcaattc atgattttga 9420
cctcattgtc ggtattccaa gaagtgggat gattccagca tatacaattg gattgtattt 9480
aaatattgat gttacagatg tttcttcttt tgtgaaaaat gtaccattgc aaagaggaat 9540
ttctagggaa aaaccaacta gccttaagct gcctcaagac gcaaaaaaaa tactattagt 9600
ggatgatagt tatacaacag gaaaatcgtt agctaatact ctaggcaaaa ttcctatgga 9660
acttaggaat cgcattgtat cttttgcatt gtataccaca gacagagaaa atcataattt 9720
agatatgttt atacgggtag taaaataccc acgtgtgttc gaatggaata ttctgaatca 9780
taacattatt ggcaatagtt gcttagatat agacggtgtg ttatgtatgg atcctacaga 9840
tgatgataat gatgatggac aaaaatatat aactttcctt gaaaatgcga aaccaaaatt 9900
tattccaaaa gtgaaaataa agtatcttgt tacaaacagg ttggaaaaat atagaactca 9960
taccgagaaa tggttatcta aaaataatgt taaatatgag caattaataa tgttagatct 10020
taaaacaaaa gaagaaagaa taagatctgg acttcattcc acacataagg ctaaatttta 10080
taaacattct ggttgttcac tttttattga aagtgatgtt aaacaagcat atgaaataat 10140
gatgcaaagt ggtttgccgg tatattgtat tgatgacaat acaatgtata aaccaggtat 10200
gacaaaatat tttataaagc aacctagcaa tgcattaaaa aaaatcattc tctggttacc 10260
aatactaata tataaaaata ttcctaagcc atatcagaaa attattcggc gtttgataaa 10320
The termination of orf10
aaaa
taaaaa gaaccaagtc atatggcttg gttctttgct gataaattac ctttttttaa10380
tttttgtttg caatgtttta ataagtttcc tgctttctga tatgggcaat agaagcagta 10440
aataaatggt tccaccgatt gctgataaaa caaaaagaga tttaatgtca gatgcgaaat 10500
gaactctaac atttgatatt aatatgaagc ttatagcagc agatataaat agtggataag 10560
tttttttaaa tatgcttaaa atatttgatt ttattgtttt catcgtgaat ataatacatg 10620
gaataaaatg tattgcattt gcaatgaaat aatattttgc aagatcaaca attccgcaat 10680
ggatgcccac cataaatgat accgcagtta atatagttcc ctggatgcct aaaagaagca 10740
aaatacctgt tttcccttga gacatgaaaa tagtgccagt ggtgcttagc accgactgta 10800
ttattgcagt gggggcaagc caaactaata tatccgcaga cagaatccat tgttctccaa 10860
aaacaacttg aatgaaaagt ttgtttaagc tagtaattac tgtaactaat ggtaaagtaa 10920
taaaccaaat aatatagatt gtatttaaat aaatatcatt tatttctttg taattatttt 10980
tcttctggct taatatagga tataaagaac gattagcaat aaaagtcaaa gatgagagtg 11040
ggaatagcat aatccgataa gctaaattat aagatccaag tatagatgct gacatatact 11100
taccgatcag aaaactatca agatttctgg caaaaaaatt aattatatta aaaagagaaa 11160
gttgtgaggt aaaacgaaat atttctttta aatgatttat cacatgtcta ggtttgcctt 11220
taggtctcca tggggatact atccataaca gtactgcaga gctcaaagaa ttaagcagag 11280
attgaaatac cagactatat attccaaagc tattattagc taatataata gctaataaaa 11340
gagacaaagc agctgaaaat acttcaattt tagaaataat aaaaaatttc gattctcttt 11400
caagcatagc tagatgcaat gatgaagagc cggaaataat aaaactaaaa gatagcaaag 11460
gtaaaacaat tagtagttta ggttgattgt acaaatgtga tataaagggg gtaagtgttg 11520
taataataat aaataccaaa aagcctaaca aaaaattaag ccaaaaaacg gcacttttag 11580
tttcatcttg caattgttct ttttgtataa ttgctgctga ggtccctaaa tctcgaaata 11640
aactagcaaa attcattaca acaccagcca ttgccatgat gccgtattca tttggtggta 11700
ttattcttgc taaataaaca atgcttatta gctgagttag tattttgaaa acttgtgaaa 11760
aagtattcca ttttaaatta ttgaaaatgc tcatgtttta atctcactgt tccgattttt 11820
aaattatacc tgaactgtta gaatgctaca atatttttga ttattgatac taatctctat 11880
attattgata ccacattggc gattagtttg agtatgttac tacaggcgat ataattttat 11940
atctaccttg gcttggcgat ttattatttg ttgttaacag aatacctttg taatttatat 12000
taactgtata tatctatttc ttttatcgtt gaatcaaaat ctgacaggag taaacaatgt 12060
caaagcaaca gatcggcgtc gtcggcatgg cagtgatggg gcgcaacctt gcgctcaaca 12120
tcgaaagccg tggttatacc gtctctattt tcaaccgttc ccgtgaaaag acggaagaag 12180
tgattgccga aaatccaggc aagaaactgg ttccttacta tacggtgaaa gagtttgttg 12240
aatctctgga aacgcctcgt cgcatcctgt tagtggtgaa agcaggtgca ggcacggatg 12300
ctgctattga ttccctcaaa ccatatctcg ataaaggcga catcatcatt gatggtggta 12360
acaccttctt ccaggacacc attcgtcgta atcgtgagct ttctgcagaa ggctttaact 12420
tcattggtac cggtgtttcc ggcggtgaag aaggtgcgct gaaaggtcct tccattatgc 12480
ctggtgggca gaaagaagcc tatgaactgg ttgcaccgat cctgaccaaa atcgccgcag 12540
tggctgaaga cggtgagcca tgcgttacct atattggtgc cgatggtgca ggtcattatg 12600
tgaagatggt tcacaacggt attgaatacg gtgatatgca actgattgcc gaagcctatt 12660
ctctgctaaa aggtggcctg aaccttacca acgaagaact ggcacagacc tttaccgagt 12720
ggaataacgg tgaactgagc agctacctga tcgacatcac caaagacatc ttcactaaaa 12780
aagatgaaga cggtaactac ttggttgatg tgattctgga tgaagcggct aacaaaggta 12840
ccggtaaatg gaccagccag agtgcgctgg atctcggcga accgctgtcg ctgattaccg 12900
agtctgtgtt tgcacgttat atctcgtctc tgaaagatca gcgtgttgcc gcgtctaaag 12960
ttctctctgg tccgcaagcg cagccagcag gcgataaagc tgagtttatc gagaaagttc 13020
gccgtgcgct gtatctgggc aaaatcgttt cttacgctca gggcttctct cagctgcgtg 13080
ctgcgtctga agagtacaac tgggatctga actacggtga aatcgcgaag attatccgtg 13140
ctggctgcat catccgtgcg cagttcctgc agaaaatcac cgatgcttat gccgaaaatc 13200
cgcagatcgc taacctgctg ctggctcctt acttcaagca aattgccgat gactaccagc 13260
aggcgctgcg cgatgtcgtc gcttatgcag tacagaacgg tatcccggtt ccgaccttcg 13320
ccgctgcggt tgcctattac gatagctacc gtgccgctgt tctgcct 13367
The above, it only is preferred embodiment of the present invention, be not that the present invention is done any pro forma restriction, every foundation technical spirit of the present invention all still belongs in the scope of technical solution of the present invention any simple modification, equivalent variations and modification that above embodiment did.
Claims (2)
1, a kind of oligonucleotide of the O-antigen-specific to Shigella bogdii 11 types and intestinal bacteria O105 is right, it is characterized in that its oligonucleotide is to being: the Nucleotide of 4882 to 4900 bases among the SEQ ID NO:1 and the Nucleotide of 5283 to 5300 bases; The Nucleotide of 5116 to 5133 bases among the SEQ ID NO:1 and the Nucleotide of 5386 to 5403 bases; The Nucleotide of 4681 to 4697 bases among the SEQ ID NO:1 and the Nucleotide of 5373 to 5390 bases; The Nucleotide of 5620 to 5638 bases among the SEQ ID NO:1 and the Nucleotide of 5980 to 5998 bases; The Nucleotide of 5517 to 5536 bases among the SEQ ID NO:1 and the Nucleotide of 6323 to 6341 bases; The Nucleotide of 5439 to 5457 bases among the SEQ ID NO:1 and the Nucleotide of 5831 to 5847 bases; The Nucleotide of 6578 to 6596 bases among the SEQ ID NO:1 and the Nucleotide of 7014 to 7032 bases; The Nucleotide of 6664 to 6682 bases among the SEQ ID NO:1 and the Nucleotide of 6882 to 6899 bases; The Nucleotide of 6717 to 6735 bases among the SEQ ID NO:1 and the Nucleotide of 6977 to 6995 bases; The Nucleotide of 7502 to 7520 bases among the SEQ ID NO:1 and the Nucleotide of 7974 to 7992 bases; The Nucleotide of 8019 to 8036 bases among the SEQ ID NO:1 and the Nucleotide of 8372 to 8391 bases; The Nucleotide of 7376 to 7394 bases among the SEQ ID NO:1 and the Nucleotide of 8219 to 8237 bases; The Nucleotide of 8674 to 8691 bases among the SEQ ID NO:1 and the Nucleotide of 9200 to 9218 bases; The Nucleotide of 8814 to 8832 bases among the SEQ ID NO:1 and the Nucleotide of 9139 to 9157 bases; The Nucleotide of 8543 to 8560 bases among the SEQ ID NO:1 and the Nucleotide of 9053 to 9070 bases; The Nucleotide of 9727 to 9745 bases among the SEQ ID NO:1 and the Nucleotide of 10308 to 10325 bases; The Nucleotide of 9784 to 9802 bases among the SEQ ID NO:1 and the Nucleotide of 10015 to 10033 bases; The Nucleotide of 9430 to 9457 bases among the SEQ ID NO:1 and the Nucleotide of 10220 to 10239 bases; The Nucleotide of 10484 to 10502 bases among the SEQ ID NO:1 and the Nucleotide of 10748 to 10765 bases; The Nucleotide of 10599 to 10617 bases among the SEQ ID NO:1 and the Nucleotide of 11509 to 11527 bases; The Nucleotide of 10997 to 11015 bases among the SEQ ID NO:1 and the Nucleotide of 11692 to 11710 bases.
2, the right application of the described oligonucleotide of claim 1, it is characterized in that, it is used for PCR as primer, perhaps is used for hybridization and fluoroscopic examination, makes gene chip or microarray confession detection Shigella bogdii 11 types and intestinal bacteria O105 type as probe.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031005357A CN1274824C (en) | 2003-01-20 | 2003-01-20 | Nucleotide specific to O-antigen of shigella boydii 11 and bacillus coli 0105 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031005357A CN1274824C (en) | 2003-01-20 | 2003-01-20 | Nucleotide specific to O-antigen of shigella boydii 11 and bacillus coli 0105 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1429831A CN1429831A (en) | 2003-07-16 |
| CN1274824C true CN1274824C (en) | 2006-09-13 |
Family
ID=4789843
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031005357A Expired - Fee Related CN1274824C (en) | 2003-01-20 | 2003-01-20 | Nucleotide specific to O-antigen of shigella boydii 11 and bacillus coli 0105 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1274824C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1307305C (en) * | 2003-12-22 | 2007-03-28 | 南开大学 | O-antigen specific nucleotide of E.coli 076 type |
-
2003
- 2003-01-20 CN CNB031005357A patent/CN1274824C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1429831A (en) | 2003-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1252268C (en) | Nucleotide specific against 0-antigen of colibacillus 0107 | |
| CN1249235C (en) | Nucleotide specific against o-antigen of colibacillus 0150 | |
| CN1274824C (en) | Nucleotide specific to O-antigen of shigella boydii 11 and bacillus coli 0105 | |
| CN1249234C (en) | Nucleotide specific to O-antigen of shigella boydii I and Bacillus coli 0149 | |
| CN1252267C (en) | Nucleotide | |
| CN1171999C (en) | Nucletide specific to O-antigen of shigella dysenteriae 8 | |
| CN1285728C (en) | Nucleotide to 0-antigen specificity of escherichia coli 0154 type | |
| CN1324134C (en) | O-antigen specific nucleotide of E.coli 081 type | |
| CN1252263C (en) | O-antigen specific nucleotide of E.coli 0138 type | |
| CN1252266C (en) | nucleotide and its use | |
| CN1274831C (en) | Nucleotide specific to O-antigen of shigella dysenteriae I and Bacillus coli 0121 | |
| CN1324133C (en) | O-antigen specific nucleotide of E.coli 071 type | |
| CN1285727C (en) | O-antigen specific nucleotide of E.coli 0139 type | |
| CN1262655C (en) | O-antigen specific nucleotide of E.coli 0144type | |
| CN1249237C (en) | Nucleotide peculiar to 0-antigen of 0132 type bacillus coli | |
| CN1274707C (en) | Nucleotide specific for escherichia coli 0159 O-antigen | |
| CN1274832C (en) | Nucleotide to 0-antigen specificity of Escherichia coli 0140 type | |
| CN1257277C (en) | Nucleotide peculiar to 0-antigen of 0155 type bacillus coli | |
| CN1234857C (en) | Nucleotide peculiar to 0-antigen of 051 type bacillus coli | |
| CN1261446C (en) | Nucleotide specific for escherichia coli 0141 O-antigen | |
| CN1256433C (en) | Nucleotide peculiar to 0-antige of 036 type bacillus coli | |
| CN1256344C (en) | Nucleotide peculiar to 0-antigen of 019 type bacillus coli | |
| CN1256438C (en) | Nucleotide peculiar to 0-antigen of 16 type Baoshi Sh.dysenterae | |
| CN1261445C (en) | Nucleotide specific for escherichia coli 0156 O-antigen | |
| CN1262558C (en) | Nucleotide specific for escherichia coli 0151 O-antigen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20060913 Termination date: 20150120 |
|
| EXPY | Termination of patent right or utility model |