CN1274008A

CN1274008A - Exoteric expression of hay bacillus cecropi and its method

Info

Publication number: CN1274008A
Application number: CN 00102740
Authority: CN
Inventors: 徐庆; 郭丽华; 陈章良
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2000-03-03
Filing date: 2000-03-03
Publication date: 2000-11-22

Abstract

The DNA gene fragment of cecropin LCI is biologically synthesized by the codon preferable to plant and on the basis of the amino acid sequence of LCI. The built-up plasmid pBVAB16 can effectively express LCI in colibacillus DH5 alpha, which is 8.7% of total colibacillus protein. The colibacillus goes through centrifugal processing, ultrasonic breaking, thermal deposition, ion exchange, hydrophobing and liquid-phase chromatography to obtain purified LCI, which can kill the rice hoja blanca bacterium G and be used for breeding and preparing bacterial fertilizer.

Description

The vivoexpression of subtilis cecropin and method thereof

The vivoexpression of subtilis cecropin of the present invention and method thereof belong to the modern biotechnology field.

Prior art:

Before nineteen sixty, people have just carried out physiological and biochemical research widely to the antagonistic action of microorganism, and all kinds of antagonistic substances are put into different categories, and very big contribution is made in the development of medicine and pharmacology.In recent years people (survey article has Klaenhammer to the mechanism of action that separates the peptide antibiotics obtain from lactobacillus and molecule genetics research expansion very extensive, T.R. (1993) .Genetics of bacteriocins producedby lactic acid bacteria.FEMS Microbiol Rev 12,39-86. and Jack, R.W., Tagg, J.R.﹠amp; Ray, B. (1995) .Bacteriocins of gram-positive bacteria.Microbiol Rev 59,171-200.).Because they are that with other microbiotic difference they can cause the resistance of microorganism hardly,, but do not find have spoilage organism to produce the phenomenon of resistance such as the history in existing 50 years of sanitas of nisin (nisin) as food.Therefore peptide antibiotics will have huge applications prospect (Breukink, E., Wiedemann, I., van Kraaij, C., Kuipers, O.P., Sahl, H.G.﹠amp at grocery trade and pharmaceutical sector from now on; De Kruijff, B. (1999) .Use ofthe Cell Wall Precursor Lipid II by a Pore-Forming Peptide Antibiotic.Science 287,2361-2364.).

Cecropin LCI is our laboratory isolated basic polypeptide from the nutrient solution of subtilis AO14, and molecular weight is 5.4 kDa.(Pseudomonassolanacearum T62 T64) has the obvious suppression effect with pepper ralstonia solanacearum bacterium (Pseudomonas solanacearum PE1) to rice leaf spot bacteria (Xanthomonas oryzae pv.oryzaestrain G.) paddy rice streak germ (Xanthomonas campestris pv.oryzea S2) potato bacterial wilt bacterium (Pseudomonas solanacearum POl) tobacco ralstonia solanacearum for it.Its whole aminoacid sequences are:

AIKLVQSPNG?NFAASFVLDG?TKWIFKSKYY?DSSKGYWVGI?YEVWDRK

By retrieval, do not find similar albumen or the gene of cecropin sequential structure therewith to international gene and Protein Data Bank (Genbank and Swiss-port).This result delivers (Liu Jinyuan, Chen Zhangliang, the primary structure of antimicrobial polypeptide LCI, natural science progress, 1994,4 (3): 365-367).

The subtilis antagonism is wide, and antagonistic substance changes various.We are domestic report in the last few years also the time to the research of the antibacterial protein of subtilis, research aspect molecular biology still deeply (is not kindly helped secure the success of such as suffering, Qin Shulian, Jin Jing, Zhang Yingchun, Xu Kun, the purification of the mould worry biocontrol strain of apple antibacterial protein and part character preliminary study, the Laiyang Agricultural College journal, 1999,16 (1).Grandson builds, and subtilis B-903 bacterial strain antibiotics is to the restraining effect of plant pathogenic fungi, Plant Pathology, 1995,25 (1): 69～72).

The purpose of invention

Utilize the anti-phytopathogen and the disease and pest gene in plant, animal and insect source to carry out the disease-resistant crops breeding in extensive studies, and when obtaining many achievements, research derives from the disease-resistant gene of antagonistic microbe and is applied to plant genetic engineering at present also fewer.

The strong subtilis of several antagonistic abilities (Bacillus subtilis) has just been isolated from big Tanaka in this laboratory since nineteen ninety, and separation and purification goes out several growth in vitro to plant pathogenic fungi and pathogenetic bacteria inhibiting polypeptide and protein are arranged.Further clone these disease-resistant genes, utilize their different mechanism of action and the possible synergy that produces, it is imported plant simultaneously, be hopeful the render transgenic plant and promptly obtain the broad-spectrum antimicrobial ability and again the resistance of single pathogenic bacteria is strengthened.Have broad-spectrum antimicrobial, can be used for food and medicinal industry equally based on biological gene engineering to the nontoxic peptide antibiotics of people and animals.

Separating and the special anti-microbial type polypeptide of purifying, they are carried out researching and analysing of physio-biochemical characteristics and 26S Proteasome Structure and Function, mainly is illustrating of antagonism mechanism, and this has important theory and using value at plant genetic engineering and plant pathology field.Structure and the function of illustrating polypeptide will depend on the clone of this polypeptide gene and external expression to a great extent, thereby, laid basic substance for obtaining the antibiotic farm crop of transgenosis simultaneously for other genes involved, the research gene expression and regulation that clones this polypeptide provides the molecular biology basis.

The content and the scheme of invention

1. according to synthetic its gene of existing LCI aminoacid sequence.

2. intermediate carrier pBC7 is arrived in the LCI gene clone.

3. expression vector pBVAB16 is arrived in the LCI gene clone.

4.LCI the abduction delivering of cecropin in intestinal bacteria.

5. the separation and purification of the LCI of Biao Daing.

6. the fungicidal activity of the LCI of Biao Daing detects.

7. the LCI of Biao Daing is to the restraining effect of in-vitro transcription.

Advantage and effect

Recombinant expression vector pBV AB16 is changed in the bacillus coli DH 5 alpha, and through 42 ℃ of high temperature inductions, the expression amount of LCI reaches the highest in the time of 5 hours, and through the scanning analysis to running gel, the expression amount of LCI accounts for colibacillary total protein content 8.7%.

Cecropin LCI is the outer plasmid-encoded rrna synthetic peptide chains that discharge of born of the same parents, has lower molecular weight, positively charged and thermostability.

The LCI of purifying can kill rice leaf spot bacteria (Xanthomonas oryzae pv.oryzae) bacterial strain G specially, and the LCI minimal effective concentration is 2.5 μ g/ml, and survival rate was 10 under the LCI at 0.13mg/ml of this bacterium handled ^-3

LCI contains with the similar conservative sequential structure of other bacteriocin, and they mainly are the second bacterioid elements of milk-acid bacteria.It is active that the secondary structure of LCI by inference and the in-vitro transcription of LCI suppress, and can infer tentatively that LCI enters in the bacterial body, suppressed the transcribing activity of RNA and cause bacterium death.Be different from other bacteriocin and can only kill gram-positive microorganism, this feature that LCI can kill Gram-negative bacteria will help the application of rrna synthetic bacteriocin at the genetically engineered breeding for disease resistance greatly, and this gene is expected at first to be applied to the production of Resistant breeding and special efficacy bacterial manure.

Description of drawings

Fig. 1 .LCI gene order and corresponding amino acid sequence thereof.A: L-Ala, I: Isoleucine, K: Methionin, L: leucine, V: Xie Ansuan, Q: glutamine, S: Serine, P: proline(Pro), N: l-asparagine, G: glycine, F: phenylalanine, D: aspartic acid, T: Threonine, W: tryptophane, Y: tyrosine, E: L-glutamic acid, R: arginine.The zone of underscore is the fragment of chemosynthesis.

The restraining effect that Fig. 2 .LCI grows to rice leaf spot bacteria (Xanthomonas oryzaepv.oryzae) bacterial strain G under different concns.The concentration of LCI is 0 μ g/ml (●); 0.6 μ g/ml (O); 2.5 μ g/ml (△); 4.9 μ g/ml (▲); 9.8 μ g/ml (■).

Fig. 3 .LCI kills the mensuration of ability to rice leaf spot bacteria (Xanthomonas oryzae pv.oryzae) bacterial strain G.Two concentration of LCI are 0.13mg/ml (●) and 0.066mg/ml (■).

Fig. 4 .LCI different concns is to the influence to in-vitro transcription.The concentration of LCI: the 1st road is not for adding the contrast of LCI, the 2nd road 0.11mg/ml, the 3rd road 0.22mg/ml, the 4th road 0.39mg/ml.

The secondary structure of Fig. 5 .LCI and with the comparison of other bacteriocin peptide sequence.Conservative region all represented in square frame among the figure, underscore, shade and black matrix.CF：Chou-Fasman；GOR：Garnier-Osguthorpe-Robson。

Embodiment

1, the chemosynthesis of LCI gene and clone thereof

Cecropin LCI results from the nutrient solution of subtilis (Bacillus subtilis) A014.It is made up of 47 amino acid altogether, contains 6 Methionins, 1 arginine and 3 tryptophanes.According to the aminoacid sequence of LCI, use the codon of plant materials preference, add two restriction enzyme sites of initial sum terminator codon and ClaI and Hind III, synthetic the DNA gene fragment (seeing Fig. 1 .) of LCI.Four underlined nucleic acid fragments be with dna synthesizer ABI381A (LKB) with solid phase phosphoramidite method synthetic:

1.?5′atatcgatggctatcaagctggtgcagtccccaaacggcaacttcgccgct?3′

2.?5′acttgaagatccacttagtaccgtccagcacgaaggaagcggcgaagttgc?3′

3.?5′taagtggatcttcaagtccaaatactatgactccagcaagggctactgggt?3′

4.?5′cgaagcttacttgcggtcccacacctcgtagatgccgacccagtagccctt?3′

Each segment contains 51 nucleotide residues.They are with 16% the acrylamide gel electrophoresis purifying that contains 8M urea.The glue section that contains dna segment immerses in the 0.5M NaCl solution spends the night, and then supernatant liquor is further purified through DEAE-Sepharose, desalination, lyophilize.Each dna segment with the 200pmol balanced mix after in water-bath 85 ℃ the heating 5 minutes, then cools down is to room temperature.Add dNTP and T4DNA polymerase again, fill and lead up reaction at 37 ℃.

2, the structure of LCI expression vector

Synthetic LCI gene fragment is through Cla I and Hind III double digestion, with the T4 dna ligase it is connected on the pBluescript II KS plasmid that these same two kinds of enzymes were handled, through transformed into escherichia coli DH5 α and screening, obtain containing the cloned plasmids pBC7 of LCI gene.This plasmid confirms to contain correct LCI gene through sequential analysis.

The pBC7 plasmid is mended flat after Cla I enzymic digestion with the big segment of DNA polymerase I Klenow, then with BamH I digestion, the agarose with 2% reclaims the LCI gene fragment.Plasmid pBV220 mends flat after EcoRI digestion with the big segment of DNA polymerase I Klenow, then with BamH I digestion.After being connected to the LCI gene fragment in the pBV220 plasmid,, make plasmid pBVAB16 through transformed into escherichia coli DH5 α and screening.

3. the extraction of the LCI of overexpression and purifying

The bacillus coli DH 5 alpha that contains plasmid pBVAB16 activates in the LB liquid nutrient medium, and wherein penbritin content is 50mg/l, inoculum size by 1% inserts in the fresh substratum of the same race, cultivated 2.5 hours for 30 ℃, then 42 ℃ of inducing culture are 5 hours, and rotating speed is 200rpm.

The intestinal bacteria of abduction delivering are used 50mM Tris-HCl after centrifugal 4000rpm reclaimed in 10 minutes, the pH7.8 damping fluid is washed twice, ultrasonication 400W is 30 times in the ice bath, and each 15 seconds, 10 seconds at interval, 60 ℃ were heated 20 minutes, and centrifugal 20 minutes of 10000rpm removes precipitation.And after ion exchange liquid phase chromatogram CM-Sepharose Fast Flow C26/20 with 0～0.6M NaCl linear gradient elution.The active chromatographic peak that obtains adds 4M ammonium sulfate furnishing 2M, add 0.5M, the potassium primary phosphate furnishing 50mM of pH6.5 carries out linear elution with hydrophobic interaction liquid chromatography Phenyl-Superose HR5/5 with 1.7～0M ammonium sulfate after little worry, and the main peak that obtains is the LCI of purifying.The freeze-drying after PD-10Sephadex G-25M (Pharmacia) desalination of this LCI sample, be stored in-20 ℃ standby.Determine the purity of LCI with Tris-tricine SDS-PAGE electrophoresis.The concentration of LCI is measured by 280nm ultraviolet absorption method and Lowry method.The expression amount of LCI is determined the SDS-PAGE gel analysis of coomassie brilliant blue staining by thin layer chromatography scanner.

Because pBV AB16 plasmid has following characteristics, make LCI in intestinal bacteria, obtain expressing efficiently: 1, to contain the SD sequence in the plasmid, be right after multiple clone site thereafter, if be positioned at 3～11 Nucleotide places, initiator codon AUG upstream, 3 ' terminal sequence complementation with 16s rRNA can promote proteinic efficient translation; 2, P _RAnd P _LTwo promotor series connection, and P _LSuppressed by CI albumen, can induce its expression, thereby strengthened stability and the intensity expressed by variation of temperature; 3, the transcription termination signal from colibacillary rrB ribosomal gene has strong termination, can avoid reading over of codon, helps the stable of plasmid-host system.

Utilize the heat-staple characteristic of LCI, the LCI of overexpression can extract from the cell suspension of ultrasonic disruption in E.coli, and the way with hot water bath precipitates most of protein receptor thermal distortion, thereby obtains electrophoretically pure LCI with CM-Sepharose Fast Flow and Phenyl-Superose HR5/5 or MonoS liquid chromatography purifying at an easy rate.Expression amount by TLCS DETERMINATION LCI is 8.7% of an e. coli total protein amount.The LCI electrophoresis apparent molecular weight of expressing is 3.5kDa.

Should be noted that in the precipitation that the cell debris of centrifugal removal and 60 ℃ of thermal treatment produce, bacteriostatic activity is arranged all, that is to say have quite a few LCI not to be recycled to.If these precipitations wash twice again with damping fluid, merge washings, be hopeful to improve yield.

4.LCI anti-microbial activity detect

1,96 orifice plate turbidity colorimetrys determine that the antibacterial ratio of LCI is alive:

(Xanthomonas oryzae pv.oryzea strain G) is indicator with rice leaf spot bacteria, with it with the LB liquid nutrient medium activation (200rpm that spends the night, 28 ℃) after, get 20 μ l, add the fresh LB substratum of 100 μ l, the LCI aqueous solution of 20 μ l different concns (from 1.1mg/ml LCI, with two times of method dilutions eight times), add 96 orifice plates, repeat twice.The unrestraint contrast is for to change 20 μ l LCI liquid into 20 μ l deionized waters, and blank is 120 μ l LB substratum and 20 μ l deionized waters.96 orifice plates are 28 ℃ of cultivations in incubator.Every one hour, on micro-spectrophotometer (Microplate AutoreaderEL310, BIO-TEK INSTRUMENTS), measure the optical density(OD) of each sample well down in the light of 540nm.

Can determine that by the different growth curve of pathogenetic bacteria Xanthomonas oryzae pv.oryzae G the bacteriostatic minimum concentration of LCI is 2.5 μ g/ml (seeing Fig. 2 .).

2, dull and stereotyped diffusion process is analyzed the antimicrobial spectrum of LCI:

On the LB culture medium flat plate, pour the tested bacterium of 1ml activatory (comprising Xanthomonas oryzaepv.oryzea strain G) into and cultivate suspension liquid, be coated with flatly, remove excess liquid after 3 minutes, dry.Difference Dropwise 5 μ l LCI solution on the different positions of flat board, the corresponding damping fluid of 5 μ l in 28 ℃ of incubated overnight, is observed the inhibition zone size for contrast.Another method is with 5 μ l LCI solution, and the corresponding damping fluid of 5 μ l drips respectively on the same line of flat board earlier for contrast, treat that drop disappears after, dip in transfering loop and to get the good bacterium liquid of activation along the standardized straight line in the position of two drops.A flat board can be measured several different bacteriums simultaneously.28 ℃ of incubated overnight, the observation inhibition zone.Experiment finds that LCI has special restraining effect to Xanthomonas oryzae pv.oryzae G.

3, the sterilizing ability of LCI test

The activatory X.oryzae pv.oryzae strain G that will spend the night is diluted to 0.035OD 600nm with the LB liquid nutrient medium.After the LCI of little worry degerming sample (0.53mg/ml) is done a doubling dilution, mix with the dilution bacterium liquid of 300 μ l with the amount of 100 μ l respectively and Eppendorf tube in, at room temperature deposit.Every the regular hour, take out 20 μ l mixing in the LB liquid nutrient medium of 980 μ l, then take out 100 μ l and be applied on the LB agar plate, 28 ℃ of incubated overnight.By can determine the sterilizing ability of LCI to the clone's number that on flat board, forms.From Fig. 3. LCI is not a killing bacteria immediately as can be seen, and the number of bacterium approximately begins to descend after adding LCI half an hour, and the decline process lasted till eight hours.Rice leaf spot bacteria (X.oryzaepv.oryzae strain G) all shows general consistent responsive trend to two concentration 0.13mg/ml (●) and the 0.066mg/ml (■) of LCI, and under high LCI concentration, the survival rate of this bacterium is approximately 10 ^-3

Modification after the LCI of expression in escherichia coli may not transcribe, but natural LCI is then possible, and also this modification tends to give cecropin more living features.Also be difficult to now in addition illustrate whether the methionine(Met) that is increased in the N end can influence the sterilization idiocratic of LCI.

Rice leaf spot bacteria X.oryzae pv.oryzae G is a Gram-negative bacteria, and the bacteriocin that gram-positive microorganism produces under usual conditions only has effect to gram-positive microorganism.Present known plant pathogenetic bacteria mostly is a Gram-negative bacteria, so this feature that LCI can kill Gram-negative bacteria will help the application of rrna synthetic bacteriocin at the genetically engineered breeding for disease resistance greatly.

5.LCI inhibition experiment to in-vitro transcription

Measure the possible transcriptional repression activity of LCI with Riboprobe Combination System (Promega) and SP6 polymerase.The in-vitro transcription analysis contains in the reaction system of 20 μ l: 40mM Tris-HCl, pH7.5,6mM MgCl ₂The 2mM spermidine, 10mM NaCl, 10mM DTT, 500 μ M each ATP, GTP, CTP and UTP, 40 U Recombinant RNasin Ribonuclease inhibitor, 0.5 μ g pGEMExpress Positive Control Template, 20 U SP6 polymerases were 37 ℃ of reactions 80 minutes.The LCI that in different reactions, adds different amounts.Reaction product is observed the resultant quantity of RNA under the UV-light of 254nm behind 1% agarose (containing 0.5 μ g/ml ethidium bromide) electrophoresis.As shown in Figure 4, three different concns of LCI: the 2nd road 0.11mg/ml, the 3rd road 0.22mg/ml and the 4th road 0.39mg/ml show the influence of RNA synthetic with respect to the contrast that does not add LCI (the 1st road), and when 0.39mg/ml concentration, the synthetic of RNA almost is suppressed entirely.

6.LCI sequential analysis

Sequence to LCI is searched at " nr " lane database with BLAST software by http://www.ncbi.nlm.nih.gov site, and the result does not find similar polypeptide or gene.The secondary structure of LCI is determined with Chou-Fasman (CF) and two kinds of methods analysts of Garnier-Osguthorpe-Robson (GOR) by GCG software.The calculating molecular weight of LCI is its calculating iso-electric point pI=10.25 of 5595.12 Da.As shown in Figure 5, can find according to the secondary structure of prediction with the contrast of other bacteriocin aminoacid sequence, the structure that in the N of LCI holds the 23rd the peptide section of tryptophane, may contain a β sheet, and the C end to peptide chain may form the parents' structure that can cross over plasma membrane after this tryptophane, just like bacteriocin piscicocins V1.The complementary action of peptide segment structure is very important for its activity in the bacteriocin, resembles lactococcin G, and the activity of plantaricin A and plantaricin S requires its alpha the same with beta chain synergy.

The primary structure of cecropin LCI and the bacterium of many other kinds have three place's something in common, wherein also comprise lantibiotics.The conserved sequence YGNGV of first, second bacterioid element structure in LCI is incomplete, and it has only NG in identical position.With reference to the position of tryptophane in the peptide chain, the glycine that can find the tenth is very conservative, shown in the square frame of Fig. 5.It is not always the case in many bacteriocins, as lactacinF and lacticin 481 or the like.The second, the residue of tryptophane is counted content and is not waited from 1 to 4 in the bacteriocin, and great majority contain 2 to 3, and their distribution but is regular, although be not very rigorous.Any one tryptophane in bacteriocin divercin V41 loses activity bacteriocin through N-bromine succinyl-amination meeting, therefore infers that 3 tryptophanes among the LCI do not play person's important function equally to its fungicidal activity.Three, the 28th to 30 KYY structure in the LCI peptide chain also exists at bacteriocin enterocin I (enterocin L50A), is then containing similar structure KFY at bacteriocin enterocin L50B.KYY and similar structures thereof also have in some other bacteriocin, and just not at the middle part of peptide chain, but at the N end regions, what replace the KYY structure in this position simultaneously is the Isoleucine residue.

According to these features, the bacteriocin of inferring the pediocin family of the second bacterioid element in LCI and the milk-acid bacteria is the most similar, they are curvacin A (sakacin A), divercin V41, enterocin I (L50A), enterocin L50B, pediocin PA-1 (AcH) and sakacin P.

Claims

1, a kind of vivoexpression of subtilis cecropin and method thereof is characterized in that described method comprises: the chemosynthesis and the clone thereof of (1) cecropin LCI gene; (2) structure of cecropin LCI expression vector; (3) extraction and the purifying of the cecropin LCI of overexpression; (4) anti-microbial activity of cecropin LCI detects; (5) cecropin LCI is to the inhibition experiment of in-vitro transcription; (6) sequential analysis of cecropin LCI.

2, according to the chemosynthesis and the clone thereof of the cecropin LCI gene described in the claim 1. (1), the DNA gene of cecropin LCI that it is characterized in that synthetic, gene order and corresponding amino acid sequence figure thereof are as follows: Cla I start  codon A-I-K-L-V-Q-S-P-N-G Atatcgatg gct atc aag ctg gtg cag tcc cca aac ggcTatagctac cga tag ttc gac cac gtc agg ggt ttg ccg

N?-?F?-?A?-?A?-?S?-?F?-?V?-?L?-?D?-?G

aac?ttc?gcc?gct?tcc?ttc?gtg?ctg?gac?ggt

ttg?aag?cgg?cga?agg?aag?cac?gac?ctg?cca

T?-?K?-?W?-?I?-?F?-?K?-?S?-?K?-?Y?-?Y

ac t?aag?tgg?atc?ttc?aag?tcc?aaa?tac?tat

tga?ttc?acc?tag?aag?ttc?agg?ttt?atg?ata

D?-?S?-?S?-?K?-?G?-?Y?-?W?-?V?-?G?-?I

gac?tcc?agc?aag?ggc?tac?tgg?gtc?ggc?atc

ctg?agg?tcg? ttc?ccg?atg?acc?cag?ccg?tag

stop

Y?-?E?-?V?-?W?-?D?-?R?-?K codon

tac?gag?gtg?tgg?gac?cgc?aag?taagcttcg

atg?ctc?cac?acc?ctg?gcg?ttc?attcgaagc

▲

Hind?III

3, structure according to the cecropin LCI expression vector described in the claim 1. (2), it is characterized in that synthetic LCI gene fragment is through Cla I and Hind III double digestion, with the T4 dna ligase it is connected on the pBluescript II KS plasmid that these same two kinds of enzymes were handled, through transformed into escherichia coli DH5 α and screening, obtain containing the cloned plasmids pBC7 of LCI gene, this plasmid confirms to contain correct LCI gene through sequential analysis, the pBC7 plasmid is mended flat with the big segment of DNA polymerase I Klenow after Cla I enzymic digestion, then with BamH I digestion, agarose with 2% reclaims the LCI gene fragment, plasmid pBV220 mends flat with the big segment of DNA polymerase I Klenow after EcoR I digestion, then with BamH I digestion, after being connected to the LCI gene fragment in the pBV220 plasmid, through transformed into escherichia coli DH5 α and screening, make plasmid pBVAB16.

4, according to extraction and the purifying of the overexpression cecropin LCI described in the claim 1. (3), it is characterized in that:

The bacillus coli DH 5 alpha that contains plasmid pBVAB16 activates in the LB liquid nutrient medium, and wherein penbritin content is 50mg/l, inoculum size by 1% inserts in the fresh substratum of the same race, cultivated 2.5 hours for 30 ℃, then 42 ℃ of inducing culture are 5 hours, and rotating speed is 200rpm;

The intestinal bacteria of abduction delivering are after centrifugal 4000rpm reclaimed in 10 minutes, use 50mM Tris-HCl, the pH7.8 damping fluid is washed twice, ultrasonication 400W is 30 times in the ice bath, each 15 seconds, 10 seconds at interval, 60 ℃ were heated 20 minutes, centrifugal 20 minutes of 10000rpm, remove precipitation, and after ion exchange liquid phase chromatogram CM-Sepharose Fast Flow C26/20 with 0～0.6M NaCl linear gradient elution, the active chromatographic peak that obtains adds 4M ammonium sulfate furnishing 2M, add 0.5M, the potassium primary phosphate furnishing 50mM of pH6.5, little worry back is carried out linear elution with hydrophobic interaction liquid chromatography Phenyl-Superose HR5/5 with 1.7～0M ammonium sulfate, the main peak that obtains is the LCI of purifying, the freeze-drying after PD-10 Sephadex G-25M desalination of this LCI sample, be stored in-20 ℃ standby, determine the purity of LCI with Tris-tricine SDS-PAGE electrophoresis, the concentration of LCI is measured by 280nm ultraviolet absorption method and Lowry method, and the expression amount of LCI is determined the SDS-PAGE gel analysis of coomassie brilliant blue staining by thin layer chromatography scanner;

Because the pBVAB16 plasmid has following characteristics, make LCI in intestinal bacteria, obtain expressing efficiently: 1, to contain the SD sequence in the plasmid, be right after multiple clone site thereafter, if be positioned at 3～11 Nucleotide places, initiator codon AUG upstream, 3 ' terminal sequence complementation with 16s rRNA can promote proteinic efficient translation; 2, P _RAnd P _LTwo promotor series connection, and P _LSuppressed by CI albumen, can induce its expression, thereby strengthened stability and the intensity expressed by variation of temperature; 3, the transcription termination signal from colibacillary rrB ribosomal gene has strong termination, can avoid reading over of codon, helps the stable of plasmid-host system;

Utilize the heat-staple characteristic of LCI, the LCI of overexpression can extract from the cell suspension of ultrasonic disruption in E.coli, and the way with hot water bath precipitates most of protein receptor thermal distortion, thereby obtain electrophoretically pure LCI with CM-Sepharose Fast Flow and Phenyl-Superose HR5/5 or MonoS liquid chromatography purifying at an easy rate, expression amount by TLCS DETERMINATION LCI is 8.7% of an e. coli total protein amount, and the LCI electrophoresis apparent molecular weight of expression is 3.5kDa.

5, the anti-microbial activity according to the cecropin LCI described in the claim 1. (4) detects, and it is characterized in that the anti-microbial activity detection of cecropin LCI comprises:

(1), 96 orifice plate turbidity colorimetrys determine that the antibacterial ratio of LCI is alive:

With rice leaf spot bacteria Xanthomonas oryzae pv.oryzea strain G is indicator, with it with the activation of spending the night of LB liquid nutrient medium, 200rpm, then gets 20 μ l by 28 ℃, add the fresh LB substratum of 100 μ l, the LCI aqueous solution of 20 μ l different concns is promptly from 1.1mg/ml LCI, with two times of method dilutions eight times, add 96 orifice plates, repeat twice; The unrestraint contrast is for to change 20 μ l LCI liquid into 20 μ l deionized waters, blank is 120 μ l LB substratum and 20 μ l deionized waters, 96 orifice plates are 28 ℃ of cultivations in incubator, every one hour, at micro-spectrophotometer Microplate AutoreaderEL310, on the BIO-TEK INSTRUMENTS, measure the optical density(OD) of each sample well down in the light of 540nm;

Can determine that by the different growth curve of pathogenetic bacteria Xanthomonas oryzae pv.oryzae G the bacteriostatic minimum concentration of LCI is 2.5 μ g/ml;

(2), dull and stereotyped diffusion process is analyzed the antimicrobial spectrum of LCI:

On the LB culture medium flat plate, pour the tested bacterium of 1ml activatory into, comprise Xanthomonas oryzaepv.oryzea strain G, cultivate suspension liquid, be coated with flat, remove excess liquid after 3 minutes, dry, difference Dropwise 5 μ l LCI solution on the different positions of flat board, the corresponding damping fluid of 5 μ l is contrast, in 28 ℃ of incubated overnight, observation inhibition zone size, another method is with 5 μ l LCI solution, the corresponding damping fluid of 5 μ l drips respectively on the same line of flat board earlier for contrast, after treating that drop disappears, dip in transfering loop and to get the good bacterium liquid of activation along the standardized straight line in the position of two drops, a flat board can be measured several different bacteriums simultaneously, 28 ℃ of incubated overnight, observation inhibition zone, experiment find that LCI has special restraining effect to Xanthomonas oryzaepv.oryzae G;

(3), the sterilizing ability of LCI test

The activatory X.oryzae pv.oryzae strain G that will spend the night is diluted to 0.035OD 600nn with the LB liquid nutrient medium, through the LCI of little worry degerming sample, concentration is 0.53mg/ml, after doing a doubling dilution, be mixed in the Eppendorf tube with the amount of 100 μ l and the dilution bacterium liquid of 300 μ l respectively, at room temperature deposit, every the regular hour, take out 20 μ l mixing in the LB liquid nutrient medium of 980 μ l, then taking out 100 μ l is applied on the LB agar plate, 28 ℃ of incubated overnight, by can determine the sterilizing ability of LCI to the clone's number that on flat board, forms, from Fig. 3. LCI is not a killing bacteria immediately as can be seen, the number of bacterium approximately begins to descend after adding LCI half an hour, and the decline process lasted till that rice leaf spot bacteria X.oryzae pv.oryzae strain G showed general consistent responsive trend to two concentration 0.13mg/ml (●) of LCI with 0.066mg/ml (■) eight hours, under high LCI concentration, the survival rate of this bacterium is approximately 10 ^-3

6, according to the inhibition experiment of the cecropin LCI described in the claim 1. (5), it is characterized in that in-vitro transcription:

Measure the possible transcriptional repression activity of LCI with Riboprobe Combination System (Promega) and SP6 polymerase, the in-vitro transcription analysis contains in the reaction system of 20 μ l: 40mM Tris-HCl, pH7.5,6mM MgCl ₂, 2mM spermidine, 10mM NaCl, 10mM DTT, 500 μ M each ATP, GTP, CTP and UTP, 40 U Recombinant RNasin Ribonuclease inhibitor, 0.5 μ g pGEMExpress Positive Control Template, 20 U SP6 polymerases 37 ℃ of reactions 80 minutes, add the LCI of different amounts in different reactions, reaction product is through 1% agarose, contain 0.5 μ g/ml ethidium bromide, behind the electrophoresis, the resultant quantity of observation RNA under the UV-light of 254nm.

7, according to the sequential analysis of the cecropin LCI described in the claim 1. (5), it is characterized in that:

Sequence to LCI is searched at " nr " lane database with BLAST software by http://www.ncbi.nlm.nih.gov site, and the result does not find similar polypeptide or gene; The secondary structure of LCI determines that with Chou-Fasman (CF) and two kinds of methods analysts of Garnier-Osguthorpe-Robson (GOR) the calculating molecular weight of LCI is 5595.12Da, its calculating iso-electric point pI=10.25 by GCG software; As shown in Figure 5, can find according to the secondary structure of prediction with the contrast of other bacteriocin aminoacid sequence, the structure that in the N of LCI holds the 23rd the peptide section of tryptophane, may contain a β sheet, and the C end to peptide chain may form the parents' structure that can cross over plasma membrane after this tryptophane, just like bacteriocin piscicocins V1, the complementary action of peptide segment structure is very important for its activity in the bacteriocin, resemble lactococcin G, the activity of plantaricin A and plantaricin S requires its alpha the same with beta chain synergy;

The primary structure of cecropin LCI and the bacterium of many other kinds have three place's something in common, wherein also comprise lantibiotics; The conserved sequence YGNGV of first, second bacterioid element structure in LCI is incomplete, and it has only NG in identical position; With reference to the position of tryptophane in the peptide chain, the glycine that can find the tenth is very conservative, and shown in the square frame of Fig. 5, it is not always the case in many bacteriocins, as lactacinF and lacticin 481 or the like; The second, the residue of tryptophane is counted content and is not waited from 1 to 4 in the bacteriocin, and great majority contain 2 to 3, and their distribution but is regular, although be not very rigorous; Any one tryptophane in bacteriocin divercin V41 loses activity bacteriocin through N-bromine succinyl-amination meeting, therefore infers that 3 tryptophanes among the LCI do not play person's important function equally to its fungicidal activity; Three, the 28th to 30 KYY structure in the LCI peptide chain also exists at bacteriocin enterocin I, then containing similar structure KFY at bacteriocin enterocin L50B, KYY and similar structures thereof also have in some other bacteriocin, just not at the middle part of peptide chain, but at the N end regions, what replace the KYY structure in this position simultaneously is the Isoleucine residue;

According to these features, infer that the bacteriocin of the pediocin family of the second bacterioid element in LCI and the milk-acid bacteria is the most similar, they are curvacin A, divercin V41, enterocin I, enterocin L50B, pediocinPA-1 and sakacin P.