CN1272436C - Synthesis and high-efficiency expression method of bivalent foot-and-mouth disease polypeptide vaccine - Google Patents

Abstract

The present invention relates to synthetic gene sequences of an A type and O type foot-and-mouth disease bivalent polypeptide vaccine and a synthesis method thereof. The synthetic gene sequences comprise the sequences disclosed in SEQ ID NO: 1 or SEQ ID NO: 2, and amino acid sequences disclosed in SEQ ID NO: 3 or SEQ ID NO: 4, wherein the codes of the amino acid sequences disclosed in SEQ ID NO: 3 or SEQ ID NO: 4 can be respectively deduced according to the two sequences disclosed in SEQ ID NO: 1 or SEQ ID NO: 2. The two sections of gene sequences are respectively connected with a green fluorescent protein gene in series so that the two sections of gene sequences become bivalent polypeptide vaccine fusion genes. The two sections of bivalent polypeptide vaccine fusion genes are respectively constructed into a prokaryotic expression vector and expressed into two bivalent polypeptide vaccine proteins, and the immunogenicity measurement of the two proteins indicates that the two sections of synthetic polypeptide vaccine genes have high immunogen activity. The vaccine can prevent A type foot-and-mouth disease and O type foot-and-mouth disease if livestock are immunized and injected with the vaccine, and the two sections of bivalent polypeptide vaccine fusion genes can be used for preparing and detecting an antigen of the A type foot-and-mouth disease and an antigen of the O type foot-and-mouth disease.

Description

Synthetic and the high-efficiency expression method of the two valency polypeptide vaccine genes of a kind of foot and mouth disease

1. technical field

The present invention relates to a kind of nucleotide sequence and synthetic method and the structure of the carrier that comprises the two valency polypeptide vaccine gene nucleotide series of above-mentioned foot and mouth disease and the method that efficiently expresses this section nucleotide coding polypeptide of the two valency polypeptide vaccine genes of foot and mouth disease of encoding.

2. background technology

Foot and mouth disease (foot-and-mouth disease, FMD) be by foot and mouth disease virus (Foot andmouth disease virus, FMDV) infect a kind of acute, the height contact that causes cloven-hoofed animal, heat generation, the crushing transmissible disease cause, with popular wide, propagating fast, sickness rate, high and celebrated (Liu Ji economizes, China animal doctor science and technology .1999,29 (3): 17-20).This is sick and to form global scale popular because main domestic animal such as pig, ox, sheep all can infect, and is classified as first of 16 kinds of category-A transmissible diseases by Food and Argriculture OrganizationFAO and World Organization for Animal Health (IEO).The hazardness of foot and mouth disease is very big, can cause the death of big area livestock, have a strong impact on the international trade of livestock industry production and animals and animal product, cause tremendous loss (Jiang Pengfei for agricultural, livestock industry, national economy, Scientia Agricultura Sinica .1999,32 (6): 93-100).That therefore, prevents, controls and eliminate foot and mouth disease seems particularly important.

The prevention foot and mouth disease, the injection aftosa vaccine is effective ways of preventing and treating foot and mouth disease.Because foot and mouth disease has different seroimmunity types, the vaccine between all types of can not provide cross protection, therefore, and prevention foot and mouth disease, the aftosa vaccines that are complementary with local popular Virus Type that adopt more.Foot and mouth disease has had now found that 7 kinds of seroimmunity types, and the hypotype more than 65.7 types is respectively A, O, C, Asia 1 type (Asia 1) and South Africa I, II, III type, and wherein general with A type and O type foot and mouth disease, China is promptly based on O type and A type.How sufficient amount being provided, and can effectively carrying out the vaccine of immunity, the susceptible host is carried out comprehensive immunity, is control and the main method of eradicating this disease.

At present, the traditional preparation process method of China's foot-and-mouth disease virus resistant vaccine is to adopt tissue culture method breeding foot and mouth disease virus, promptly utilize hamster kidney cell system (BHK) passage cell system, method to produce inactivated vaccine, also having a kind of method is to make attenuated vaccine by various method of attenuating.Though these two kinds of vaccines all have immunological competence preferably, but the security of preparation is relatively poor, because need cultivate a large amount of viruses in process of production, and this kind virus can be by brone infection, the danger that with contacted instrument of virus or vessel the poison that looses is arranged all in the production process.In case and traditional inactivated vaccine and attenuated vaccine deactivation or attenuation are incomplete, in extensive immunologic process to animal, minute quantity immunized animal morbidity be may cause and the pathogeny center and the media (Yi Jianzhong of disease popularity become, the Huanghai Sea is refined, Yang Zhijun, etc., Fudan Journal (natural science edition), 1997,36 (5): 23-27).Therefore, be badly in need of changing traditional vaccine production method, set up vaccine production new technology system safely and effectively.The effective aftosa vaccine of research and development new type of safe is with control and elimination foot and mouth disease.

The research that utilizes genetic engineering technique to carry out aftosa vaccine has been subjected to paying attention to widely, the vaccine gene research of being carried out at present comprises: unit price, the synthetic polypeptide vaccine gene of multivalence, subunit vaccine gene, and promptly the gene with the subunit in the virion-VP1 albumen (having immunogenicity) is used as the vaccine gene sequence; Also has report with nonstructural protein gene etc.What research was more at present is the synthetic peptide vaccine gene, and synthetic peptide is the little peptide that is similar to natural antigen of synthetic, and the vaccine safety of being made by this little peptide is good; Or with the dna sequence dna of the synthetic peptide of polyvalent as goal gene, express vaccine component by prokaryotic expression system.Owing to this method production vaccine directly is not prepared from by virus, do not relate to virus itself, there is not infectivity, so do not have the not problem of inactivation of viruses release, the composition existence that also can avoid some and specific immunity to have nothing to do.So can guarantee it is safe (Yang Yongqin, Wang Jiaju, Yunnan animal and veterinary, 1997,1:27-29; Zhao Kai, Zou Shiping, Zhang Zhenyu, etc. Chinese Journal of Immunology, 2002,18:89-92).Therefore, adopt the synthetic peptide vaccine of safety to carry out the foot and mouth disease control, be subjected to Chinese scholars and extensively pay attention to, synthetic peptide vaccine not only security is good, and produce with transport all very convenient.

Along with gene structure and virion space structure thereof to foot and mouth disease virus further are familiar with, find that VP1 albumen is the topmost antigen protein of FMDV, VP1 protein function district comprises the major antigen site of FMDV, particularly in the site 1, it is the major antigen district of proteic 141-160 amino acids of VP1 and 200-213 amino acids FMDV that residue sequence is formed, can produce neutralizing antibody by induced animal, it is the immunogenic major antigen determinant of the various hypotype FMDV of decision segment, (Yang Yongqin, Wang Jiaju, the Yunnan animal and veterinary, 1997,1:27-29; Dus Santos MJ, Vccine 2002,20:1141-1147).So utilize VP1 albumen or its antigenic determinant partly to become the main path of FMD new generation vaccine research.Abroad the someone finds that the 141-160 amino acids of VP1 of chemosynthesis and the peptide section of 200-213 amino acids can cause certain immune response (Kleid DG, Science, 1981,214 (1525): 1125-1129).

Chinese scholar is also studied aftosa synthetic peptide vaccine, (Zheng Zhaoxin, He Peifu, Yan Weiyao such as Zheng Zhaoxin, Deng, the virus journal, 1989,5 (1): 41-45) O type FMDV coding proteic 141-160 amino acids of VP1 and the series connection of 200-213 amino acids are the 20AA-14AA-20AA type, and link to each other with the sweet enzyme gene of beta galactose, at the fusion rotein of expression in escherichia coli, have very strong immunogenicity through the experimentation on animals proof, become recombinant vaccine safely and effectively.Easily build medium (Yi Jianzhong, the Huanghai Sea is refined, Yang Zhijun, Deng, Fudan Journal (natural science edition), 1997,36 (5): 23-27) A type FMDV coding proteic 141-160 amino acids of VP1 and the series connection of 200-213 amino acids are the 20AA-14AA-20AA type, ELISA proves through spot, and the fusion rotein of expression in escherichia coli has A type FMDV antigenic activity.Yet, up to the present do not appear in the newspapers as yet with O type and the two valency polypeptide vaccine aspects of A type FMDV coding VP1 albumen development.

The generation of China's foot and mouth disease is based on O type and A type foot and mouth disease virus, therefore, developing O-A type bivalent vaccine as early as possible, be used for border epidemic prevention and emergency stock, is control FMD problem demanding prompt solution (Zhang Yongguang, Wang Yonglu, etc. Chinese animal doctor's science and technology .1996,26 (5): 3-5).

3. summary of the invention

An object of the present invention is to provide a kind of synthetic method of nucleotide sequence and proteins encoded and the two valency polypeptide vaccine nucleotide sequences of this foot and mouth disease of the two valency polypeptide vaccine genes of foot and mouth disease of encoding.

In design, at first choose O58 strain system coding 141-160 amino acid and the amino acid whose nucleotide sequence of 200-213 from the O C-type virus C of China to the two valency polypeptide vaccines of foot and mouth disease, be 20 peptides of the coding O C-type virus C of O58, the nucleotide sequence of 14 peptides, then two sections nucleotide sequences be together in series.Another part selects the nucleotide sequence of A C-type virus C (A62 strain system) coding 20 peptides, 14 peptides to be in series.This placed in-line method helps to strengthen the immunogen activity of polypeptide vaccine.And then with the Nucleotide tandem sequence (sequence shown in SEQ ID NO:2) of this two portions nucleotide sequence series connection becoming A type (A62 system) encoding viral 20 peptides and 14 peptides and O type (O58 system) encoding viral 20 peptides and 14 peptides; Be with the O C-type virus C nucleotide sequence of 20 peptides of 20 peptides and 14 peptides and A C-type virus C coding and 14 peptides be together in series (sequence shown in SEQ ID NO:1) of encoding in addition, this serial connection method, can access and have purposes polypeptide vaccine more widely, A type foot and mouth disease can be prevented, O type foot and mouth disease can be prevented again.

In order to improve the stability of polypeptide vaccine, and be convenient to detect, also with the nucleotide sequence shown in the SEQ ID NO:2 and green fluorescence protein gene (reporter gene, nucleotide sequence GFP) be together in series (being sequence shown in the SEQ ID NO:6); In addition the nucleotide sequence of nucleotide sequence shown in the SEQ ID NO:1 and green fluorescence protein gene is together in series (being sequence shown in the SEQ ID NO:5).

Through design, synthesize the fragment of following each sequence respectively earlier, and then connect:

Segment A

058 strain is the amino acid whose encoding sequence of the proteic 141-160 of virus VP 1.

5’gtg?acc?aaa?gtg?aga?ggc?gat?ctg?cag?gtg?ctg?gcg?cag?aaa?gcg?gcacgc?tct?ctg?ccg

Fragment B

058 strain is the amino acid whose encoding sequence of the proteic 200-213 of virus VP 1

5’aga?cat?aaa?cag?aag?att?gtg?gca?cca?ggc?aaa?cgc?ctg?ctg

Fragment E

The A62 strain is the amino acid whose encoding sequence of the proteic 141-160 of virus VP 1

5’aac?gcg?ggc?cgt?cgc?ggc?gat?ctg?ggc?tct?ctg?gcg?gcg?cgt?gtg?gcgcag?ctg?ccg?gcg

Fragment F

The A62 strain is the amino acid whose encoding sequence of the proteic 200-213 of virus VP 1

cgc?cat?aaa?cag?cgt?att att?gcg?ccg?gcg?aaa?cag?ctg?ctg

Mode with O type and A type, A type and O type is together in series, as shown in Figure 1.Obtain the nucleotide sequence shown in SEQ ID NO:1 and the SEQ ID No:2 respectively.

Another object of the present invention is to make up the method that comprises the two valency polypeptide vaccine Prokaryotic Expression carriers of this foot and mouth disease and efficiently express this pair valency polypeptide vaccine genes encoding polypeptide.The two valency polypeptide vaccine genes of above-mentioned two foot and mouth disease are directly implemented into prokaryotic expression carrier or above-mentioned two foot and mouth disease pair valency polypeptide vaccine genes are connected with GFP (green fluorescent protein) gene, gene fusion construct, and these two kinds of fusion genes are building up in the prokaryotic expression carrier respectively.Adopt the gene fragment of synthetic these polypeptide of artificial synthesis, because these gene fragments are too small, thus also need they are connected with other protein gene, thus better fusion rotein of stability produced.At present, extensively adopting green fluorescent protein (GFP) gene is reporter gene, as it is connected with the vaccine polypeptide gene, thereby be built into fusion gene, its expression product may send green fluorescent, it is just very convenient therefrom to screen transformant, and two kinds of two valency polypeptide vaccine nucleotide sequences and GFP gene series system see SEQ ID NO:5 and SEQ ID NO:6 for details.SEQ ID NO:1 and GFP fusion gene nucleotides sequence are classified SEQ ID NO:5 as.SEQ IDNO:2 and GFP fusion gene nucleotides sequence are classified SEQ ID NO:6 as.

The immunogenicity determining that the aforementioned polypeptides vaccine protein is carried out shows that synthetic gene has immunogen activity preferably.Livestock may prevent two kinds of foot and mouth disease of A type and O type after immunity, detect A type and two kinds of foot-and-mouth disease antigens of O type but also may be used for preparation.

4. description of drawings

Fig. 1 synthetic original segments series system synoptic diagram

Fig. 2 synthetic original segments and concrete splicing synoptic diagram

Annular DNA chain after Fig. 3 connects with O type and A type

Annular DNA chain after Fig. 4 connects with A type and O type

Fig. 5 pUCm-F1 hysteresis plasmid electrophoresis detection result.

3 is pUCm-F1 hysteresis plasmid, and all the other are the PUCm-T plasmid

Fig. 6 pUcm-F1 double digestion and PCR checking

1 one NCoI/EcoRI digested plasmid pUCm-F1,2,3-PCR result, 4, DGL2000DNA Maker

Fig. 7 FMDV bivalent vaccine Prokaryotic Expression vector construction figure

Fig. 8 prokaryotic expression carrier pET-FM1 synoptic diagram

5. embodiment

The acquisition and the prokaryotic expression of the two valency polypeptide vaccine genes of embodiment 1. foot and mouth disease

1. the acquisition of the two valency polypeptide vaccine genes of foot and mouth disease:

Along with gene structure and virion space structure thereof to foot and mouth disease virus further are familiar with, find that VP1 albumen is the topmost antigen protein of FMDV, VP1 protein function district comprises the major antigen site of FMDV, particularly in the site 1, it is the major antigen district of proteic 141-160 amino acids of VP1 and 200-213 amino acids FMDV that residue sequence is formed, can produce neutralizing antibody by induced animal, it is the immunogenic major antigen determinant of the various hypotype FMDV of decision segment, (Yang Yongqin etc., 1997; Dus santos MJ, 2002).So utilize VP1 albumen or its antigenic determinant partly to become the main path of FMD new generation vaccine research.Abroad the someone finds that the 141-160 amino acids of VPI of chemosynthesis and the peptide section of 200-213 amino acids can cause certain immune response (Kleid DG Yansura DJ, Bachrach HI, Science, 1981,214 (1525): 1125-1129).Choose from 058 (GeneBank number: FDI 131469) of the O C-type virus C of China and the A62 strain system (GeneBank number: FDI 131666) of A C-type virus C, choose the 141-160 amino acid and the amino acid whose nucleotide sequence of 200-213 of coding foot and mouth disease A C-type virus C (A62 strain system), the nucleotide sequence that (20 peptides of the A C-type virus C of promptly encoding, the nucleotide sequence of 14 peptides) is in series; Another part is the 141-160 amino acid of coding O C-type virus C (058 strain system) and the nucleotide sequence that the amino acid whose nucleotide sequence of 200-213 (20 peptides of the O C-type virus C of promptly encoding, the nucleotide sequence of 14 peptides) is in series.This two portions nucleotide sequence connected again obtain A C-type virus C the encode Nucleotide tandem sequence (being sequence shown in the SEQ ID NO:2) of 20 peptides and 14 peptides of 20 peptides and 14 peptides and O C-type virus C of encoding; And O C-type virus C encode 20 peptides that 20 peptides and 14 peptides and A C-type virus C encode and the Nucleotide tandem sequence (being the sequence shown in the SEQ IDNO.1) of 14 peptides.Though the segmental nucleotide sequence of the coded polypeptide that designs is not very long, but still be difficult to the directly sequence of synthetic total length, so with its salvage.Synthetic by Shanghai Bo Ya biotech company.

Fragment 1

Be that virus 058 and A62 strain are that (058 derives from GenBankFDI 131469 to the VP1 protein gene sequence, A62 derives from GenBank FDI 131666) last non-existent sequence, in this work, be used for synthetic segmental cyclisation and amplimer, because its sequence 5 ' end and fragment 6 and fragment 16 complementations, 3 ' end and fragment 2 and fragment 11 complementations is so can make synthetic fragment become ring-type.

gaa?ttc?taa?tag?ctc?gag?gtc?gac?aag?ctt?acc?atg

EcoRI Sal?I?Hind?III Nco?I

Fragment 2

Be used for Segment A and be connected usefulness, wherein a part of sequence and fragment 1 complementation, another part and Segment A complementation with fragment 1.Be easy analysis, what show below is the complementary strand of fragment 2.

gtc?gac?aag?ctt?acc?atg gtg?acc?aaa

Sal?I Hind?III Nco?I

Fragment 3

Below shown in be the complementary sequence of fragment 3, fragment 3 is consistent with the 10-45 base sequence of Segment A as can be seen.

Gtg aga ggc gat ctg cag gtg ctg gcg cag aaa gcg (needing counter-rotating)

Fragment 4

The complementary strand that is used for junction fragment A and fragment B.Be depicted as the complementary sequence of fragment 4 below, back 15 base complementrities, another part sequence (37bp) and the complementation of fragment B header sequence of its a part of sequence (15bp) and Segment A

gca?cgc?tct?ctg?ccg-

Aga cat aaa cag aag att atg gca cca (needing counter-rotating)

Fragment 6

The complementary strand sequence that is used for junction fragment B and fragment 1.What below show is the complementary sequence of fragment 6, the 15bp sequence complementation of the 3 ' end of wherein a part of sequence and fragment B, 5 ' end 18bp sequence complementation of another part and fragment 1.

ggc?aaa?cgc?ctg?ctg-

Gaa ttc taa tag ctc gag (needing counter-rotating)

Fragment 11

The complementary strand sequence that is used for junction fragment E and fragment 1.What below show is the complementary sequence of fragment 11, the 18bp sequence complementation of 3 ' end of wherein a part of sequence and fragment 1,5 ' the end 9bp sequence complementation of another part and fragment E.

gtc?gac?aag?ctt?acc?atg-

Aac gcg ggc (needing counter-rotating)

Fragment 12

It is the complementary sequence of fragment E.What below show is the complementary sequence of fragment 12, the 10-46 base sequence complementation of sequence and fragment E.

Cgt cgc ggc gat ctg ggc tct ctg gcg gcg cgt gtg (needing counter-rotating)

Fragment 13

The complementary strand sequence that is used for junction fragment E and fragment F.What below show is the complementary sequence of fragment 13, the 15bp sequence complementation of the 3 ' end of wherein a part of sequence and fragment E, 5 ' the end 45bp sequence complementation of another part and fragment F.

gcg?cag?ctg?ccg?gcg-

Cgc cat aaa cag cgt att att gcg ccg (needing counter-rotating)

Fragment 14

The complementary strand sequence that is used for junction fragment F and Segment A.What below show is the complementary sequence of fragment 13, the 15bp sequence complementation of the 3 ' end of wherein a part of sequence and fragment F, 5 ' end 45bp sequence complementation of another part and Segment A.

gcg?aaa?cag?ctg?ctg-

Gtg acc aaa (needing counter-rotating)

Fragment 15

The complementary strand sequence that is used for junction fragment B and fragment E.What below show is the complementary sequence of fragment 15, the 15bp sequence complementation of the 3 ' end of wherein a part of sequence and fragment B, 5 ' the end 9bp sequence complementation of another part and fragment E.

ggc?aaa?cgc?ctg?ctg-

Aac gcg ggc (needing counter-rotating)

Fragment 16

The complementary strand sequence that is used for junction fragment F and fragment 1.What below show is the complementary sequence of fragment 16, the 15bp sequence complementation of the 3 ' end of wherein a part of sequence and fragment F, 5 ' end 18bp sequence complementation of another part and fragment 1.

gcg?aaa?cag?ctg?ctg-

Gaa ttc taa tag ctc gag (needing counter-rotating)

Normal chain, complementary strand are divided into several sections and synthesize, normal chain is 4 sections, coding be respectively 20 peptides, 14 peptides that virus O 58 strains are 20 peptides that immune site is arranged on the VP1 albumen, 14 peptides and A62 strain system, its length of nucleotides is two kinds of 60bp and 42bp, normal chain 5 ' is held whole phosphorylations; Complementary strand is convenient for synthetic, has designed a plurality of chains, wherein not only has and the complete corresponding segment of normal chain, and the segment that complementary relationship is being arranged with positive chain portion is also arranged.In addition according to the sequences Design of polypeptide gene primer, in order to the synthetic segment that increases, and on primer, added the recognition sequence of restriction enzyme.It is synthetic that polypeptide gene that designs and primer are transferred to DNA Synesis Company.

(1) small segment splicing:

The synthetic oligonucleotide fragment dissolves with distilled water, wherein is used for the about 800ng/ μ l of all being diluted to of synthetic gene, is used as the synthetic fragment dissolving of primer and is diluted to 80ng/nl.Splice by mode shown in Figure 2 then.

In Fig. 2, Segment A and B represent 20 peptides of O58 strain system and the normal chain of 14 peptides respectively, and E and F represent 20 peptides of A62 and the normal chain oligonucleotide fragment of 14 peptides respectively.1 representative be the normal chain oligonucleotide fragment of an artificial design, mainly providing enzyme cuts sequence and makes primer usefulness, its 5 ' hold phosphorylation equally, 2,3,4,6,11,12,13,14,15,16 Fudan Journals (natural science edition), 1997,36 (5): 23-27) A type FMDV coding proteic 141-160 amino acids of VP1 and the series connection of 200-213 amino acids are the 20AA-14AA-20AA type, ELISA proves through spot, the fusion rotein of expression in escherichia coli has A type FMDV antigenic activity.Yet, up to the present do not appear in the newspapers as yet with O type and the two valency polypeptide vaccine aspects of A type FMDV coding VP1 albumen development.

The generation of China's foot and mouth disease is based on O type and A type foot and mouth disease virus, therefore, developing O-A type bivalent vaccine as early as possible, be used for border epidemic prevention and emergency stock, is control FMD problem demanding prompt solution (Zhang Yongguang, Wang Yonglu, etc. Chinese animal doctor's science and technology .1996,26 (5): 3-5).

3. summary of the invention

An object of the present invention is to provide a kind of synthetic method of nucleotide sequence and proteins encoded and the two valency polypeptide vaccine nucleotide sequences of this foot and mouth disease of the two valency polypeptide vaccine genes of foot and mouth disease of encoding.

In design, at first choose O58 strain system coding 141-160 amino acid and the amino acid whose nucleotide sequence of 200-213 from the O C-type virus C of China to the two valency polypeptide vaccines of foot and mouth disease, be 20 peptides of the coding O C-type virus C of O58, the nucleotide sequence of 14 peptides, then two sections nucleotide sequences be together in series; Another part selects the nucleotide sequence of A C-type virus C (A62 strain system) coding 20 peptides, 14 peptides to be in series, this placed in-line method, help to strengthen the immunogen activity of polypeptide vaccine, and then with the Nucleotide tandem sequence (sequence shown in SEQ ID NO:2) of this two portions nucleotide sequence series connection becoming A type (A62 system) encoding viral 20 peptides and 14 peptides and O type (O58 system) encoding viral 20 peptides and 14 peptides; Or with the O C-type virus C nucleotide sequence of 20 peptides of 20 peptides and 14 peptides and A C-type virus C coding and 14 peptides be together in series (sequence shown in SEQ ID NO:1) of encoding, this serial connection method, can access and have purposes polypeptide vaccine more widely, A type foot and mouth disease can be prevented, O type foot and mouth disease can be prevented again.

Utilize primer sequence that above-mentioned connection product is carried out pcr amplification.The PCR reaction system: 10xPCR damping fluid 5 μ l, 10mmol/L dNTP 4 μ l, Pfu archaeal dna polymerase 2U uses fragment 1 respectively, fragment 16; Fragment 1, fragment 6 are as two pairs of primers, and primer concentration is 80ng/ μ l, and each adds 2 μ l, connect product O-A and A-O and add 1 μ l respectively, add water respectively to cumulative volume 50 μ l.The PCR program is: 95 ℃ of pre-sex change 5 minutes; 94 ℃ of sex change are 1 minute then, 65 ℃ of renaturation 1 minute, and 72 ℃ were extended 2 minutes, and circulated 30 times.

2. the structure of the two valency polypeptide vaccine gene prokaryotic carriers of foot and mouth disease

(1) clone of the two valency polypeptide vaccine genes of foot and mouth disease

Connecting product with O-A, mode is template, and with fragment 1, fragment 16 is as primer; Connecting product in the A-O mode is template, and with fragment 1, fragment 6 is as primer, and through pcr amplification, amplified production cuts out the band of 204bp through agarose gel electrophoresis, reclaims test kit (available from ancient cooking vessel state company) with the DNA purifying and reclaims purifying, uses T ₄Dna ligase (worker company is given birth in Shanghai), be connected with carrier pUCm-T Vector (worker company is given birth in Shanghai), 16 ℃ of connections are spent the night, and with the connection product of O-A, A-O mode, the cloning vector that obtains is respectively pUCm-F1 and pUCm-F2, and (pUCm-F1 is for connecting the carrier that product makes up in the O-A mode; PUCm-F2 is for connecting the carrier that product makes up in the A-O mode; ).

(2) transform

Connect product pUCm-F1 and pUCm-F2 by heat shock method transformed into escherichia coli DH5 α competent cell.

Transform with the colibacillary preparation of competence: single bacterium colony of picking DH5 α in 10ml liquid LB substratum, 37 ℃ of 250rpm overnight incubation.Get 1ml cultivation bacterium liquid and be added in the fresh LB substratum of 100ml, 37 ℃ of 300rpm cultivate about 3h to OD ₆₀₀Value is 0.5-0.6.Ice bath bacterium liquid 30min, 4 ℃ of centrifugal 5min of 6000rpm collect thalline.Discard supernatant, add the aseptic 0.1mol/L CaCl of 10ml ice bath ₂Suspended bacteria somatocyte in the solution, ice bath 15min.4 ℃ of centrifugal 5min of 6000rpm.Discard supernatant, thalline is resuspended in 2ml0.1mol/LCaCl ₂In the solution.Divide in the aseptic Eppendorf pipe of 1.5ml that installs to precooling (200 μ l/ pipe), the aseptic glycerine of adding 15% is standby in-70 ℃ of storages.Connect product and carry out the intestinal bacteria conversion by the following method: get ligation product pUCm-F1 and the pUCm-F2 of 1 μ l respectively, in 200 μ l DH5 α competent cell solution, behind the mixing, ice bath 30min.42 ℃ of water-bath thermal shock 90sec put 1-2min in the ice bath immediately.Add 800 μ l LB liquid nutrient mediums, 37 ℃ of 150rpm shaking tables are cultivated 1h.On the solid plate of additional AMP 50ug/mlLB, be coated with 40 μ l X-gal (20 μ g/ μ l) and 4 μ l IPTG (200 μ g/ μ l) solution.From 1ml transformed bacteria liquid, get 100 μ l bacterium liquid and coat on the flat board, air-dry.

Cultivated 16 hours for 37 ℃, occur blue look and white colony on the flat board, the picking white colony carries out the evaluation of recombinant clone.

(3) transformant is identified

At first cloning vector pUCm-F1 and pUCm-F2 are carried out the extraction of plasmid DNA.Prepare pUCm-F1 (pUCm-F2) vector plasmid DNA by (1989) alkaline process such as Sambrook.Picking contains the DH5 α bacterium colony of the carrier of pUCm-F1 and pUCm-F2 at random, is inoculated in 3ml respectively and contains in the LB bacteria culture medium of kantlex 100mg/L 37 ℃ of shaken over night.In the Eppendorf of 1.5ml pipe, the centrifugal 2min of 12000rpm repeats once, collects the 3ml thalline.

Add 100 μ l solution I (pH 8.0 for 25mmol/L glucose, 25mmol/LTris.Cl, 10mmol/L EDTA), concussion evenly.(0.2mmol/LNaOH 1%SDS), puts upside down centrifuge tube mixed content thing for several times, places 3min on ice to add 200 μ l solution II.

Add 150 μ l solution III (5mmol/L Potassium ethanoate 60ml, Glacial acetic acid 11.5ml, distilled water 28.5ml), mix, place on ice.The centrifugal 10min of 12000rpm gets supernatant and moves in the new Eppendorf pipe.Add equal-volume phenol: chloroform (1: 1), thorough mixing, the centrifugal 5min of 12000rpm gets supernatant.The dehydrated alcohol that adds 1/10 volume 3mol/L sodium-acetate (pH 5.2) and two volumes precooling is placed 30min for-20 ℃.

The centrifugal supernatant of abandoning, 70% ethanol of ice precooling is washed precipitation twice, fully dries up.Add 20-50 μ l TE (pH 8.0), dissolving pUCm-F1 and pUCm-F2 plasmid.

A. electrophoretic method is identified

With conversion bacterium colony carrier pUCm-F1 and the pUCm-F2 plasmid that extracts, by the size of the definite plasmid of electricity ice, the plasmid of extraction is greater than primary pUCm-T plasmid, and meeting the clone has candidate's plasmid comparison of goal gene to imagine according to the expection that plasmid increases, and sees Fig. 5.

B. enzyme is cut checking

With restriction enzyme NcoI and EcoRI pUCm-F1 and pUCm-F2 plasmid being carried out enzyme cuts, whether checking goal gene O-A, A-O have obtained the clone in the pUCm-T carrier, enzyme is cut product and is carried out electrophoresis, detection cut out fragment 204bp for goal gene (be O-A, A-O two valency polypeptide vaccine genes), see Fig. 6.

C. sequencing is identified plasmid

To contain the bacterial strain DH5 α that transforms plasmid pUCm-F1 and pUCm-F2 guarantees with glycerine and deposits, and hand in the order-checking of Hai Shenyou order-checking company, sequencing primer is the primer of the T7 promoter region on the pUCm-T plasmid.Sequencing result shows, goal gene O-A and A-O two fragment gene segments are correctly inserted among the carrier pUCm-T, two sections goal gene O-A and A-O nucleotide sequence are respectively SEQ ID NO 1 and SEQ ID NO 2, infer that in DNAMAN its aminoacid sequence is respectively SEQ ID NO 3 and SEQ ID NO 4.Qualification result shows that pUCm-F1 (pUCm-F2) carrier that has goal gene has imported among the type of production prokaryotic expression host bacterium DH5 α.

(4) structure of the two valency polypeptide vaccine gene prokaryotic carriers of foot and mouth disease

Process checks order, enzyme is cut and the PCR checking, obtain two valency polypeptide vaccine gene fragment O-A, A-O respectively with O58 (20 peptides-14 peptide)-A62 (20 peptides-14 peptide), A62 (20 peptides-14 peptide)-two kinds of mode of connection of O58 (20 peptides-14 peptide), cloned among the carrier pUCm-T pUCm-F2 that obtains containing the cloning vector pUCm-F1 of polypeptide vaccine gene fragment O-A respectively and contain polypeptide vaccine gene fragment A-O.From the fragment that cloning vector pUCm-F1 (pUCm-F2) cuts out the about 200bp of FMDV bivalent gene O-A (A-O), use T with restriction enzyme NcoI and EcoRI ₄Dna ligase, be connected with the linear fragment of the about 5200bp that passes through same digested plasmid pET28a (+) gained, the prokaryotic expression carrier pET-28fmv2 that obtains containing the prokaryotic expression carrier pET-28fmv1 of bivalent gene O-A and contain bivalent gene A-O, transform in the competence e. coli bl21, see Fig. 7.

(5) Protein Detection of the two valency polypeptide vaccine genetic expressions of foot and mouth disease

The abduction delivering of polypeptide gene and inclusion body preparation method are undertaken by pET technical specification (Novagen company):

With plasmid pET28fmv1 (pET28fmv2) transformed into escherichia coli BL21, carry out abduction delivering with IPTG, collect thalline, separate and purifying protein, use the SDS-PAGE electrophoresis, Coomassie brilliant blue R-250 dyeing, identify the molecular weight and the expression level of expression product, the result shows that expression product is present in the cell with the form of inclusion body, induce the climax that reached expression amount in 3 hours, the expression of recombinant proteins level accounts for about 20% of bacterial protein.The Westernblotting analysis revealed, this purifying protein that contains bivalent vaccine gene O-A and A-O genetic expression can react with FMDV O type and A type positive serum, illustrates to contain bivalent vaccine gene O-A and A-O expression of gene product has immunogen activity preferably.

The structure of embodiment 2.FMDV bivalent vaccine gene and GFP Prokaryotic Expression carrier

1.GFP the acquisition of gene and clone:

The GFP gene is with a kind of formal representation of fusion rotein, can be used as safely and effectively that reporter gene is used for procaryotic genetic transformation, contains the converting material of GFP expression cassette, can send green fluorescence under blue-light excited, is convenient to detect.

According to the nucleotide sequence of GFP on the GenBank #U55762, with plasmid

PEGFP-N1 (CLONTECH Laboratories Inc.#6085-1) is a template DNA, designs following a pair of primer:

Primer 5:5 ' GCG GAATTCATGGTGAGCAAGGGCGAGGAG 3 '

EcoR?I

Primer 6:5 ' C GTCGACTTACTTGTACAGCTCGTCCATGCC 3 '

Sal?I

Adopt alkaline process extraction plasmid pEGFP-N1 in a small amount,, increase with primer 5 and 6 as template.The PCR program is: 95 ℃ of pre-sex change 5 minutes; 94 ℃ of sex change are 1 minute then, 65 ℃ of renaturation 1 minute, and 72 ℃ were extended 3 minutes, and circulated 25 times.Get 10 μ l PCR products after reaction finishes and carry out the agarose gel electrophoresis detection.

Electrophoresis reclaims the fragment of the about 750bp of PCR product, uses T ₄DNALigase is connected with the pUCm-T carrier, obtains carrier pUCm-gfp.

With cloning vector pUCm-gfp transformed competence colibacillus bacillus coli DH 5 alpha, with blue hickie screening and cloning carrier, adopting in a small amount, alkaline process extracts plasmid pUCm-gfp, electrophoresis carries out plasmid DNA and detects, simultaneously with pcr amplification verify, restriction enzyme EcoR I/Sal I double digestion checking and Shanghai opens auspicious order-checking company sequence verification, proves that all goal gene GFP has been inserted among the carrier pUCm-T.

2.FMDV the structure of bivalent vaccine and GFP fusion gene and clone

Adopt a small amount of alkaline process to extract plasmid pUCm-F1 (pUCm-F2), with Nco I/EcoR I double digestion, electrophoresis detection also reclaims the fragment of about 200bp of purifying gained with the recovery test kit; Extract plasmid pUCm-gfp, with EcoR I/Sal I double digestion, electrophoresis detection also uses the recovery test kit to reclaim the about 750bp fragment of purifying; Extract plasmid pUCm-T,, reclaim the purifying linear fragment, about 2000bp with Nco I/Sal I double digestion.With three fragments of about 200bp, 750bp and about 2000bp of above gained, use T ₄Ligase enzyme connects, the cloning vector pUCm-FM2 that obtains containing the cloning vector pUCm-FM1 of bivalent gene O-A and GFP gene and contain bivalent gene A-O.With this carrier transformed competence colibacillus bacillus coli DH 5 alpha.With blue hickie screening and cloning carrier, adopting in a small amount, alkaline process extracts plasmid pUCm-FM1 (pUCm-FM2), electrophoresis carries out plasmid DNA and detects, simultaneously with pcr amplification verify, double digestion checking and order-checking company sequence verification, sequence is that SEQ ID NO 5 and SEQ ID NO 6. prove that after testing goal gene FMDV bivalent vaccine gene O-A and A-O and GFP fusion gene have been inserted among the carrier pUCm-T.

3. the construction of prokaryotic expression vector of two valency polypeptide vaccines of foot and mouth disease and GFP fusion gene

Adopt a small amount of alkaline process to extract plasmid pUCm-F1 (pUCm-F2), with Nco I/EcoR I double digestion, electrophoresis detection also reclaims the fragment of about 200bp of purifying gained with the recovery test kit; Extract plasmid pUCm-gfp, with EcoR I/Sal I double digestion, electrophoresis detection also uses the recovery test kit to reclaim the about 750bp fragment of purifying; Extract plasmid pET28a (+),, reclaim the purifying linear fragment, about 5200bp with Nco I/Sal I double digestion.With three fragments of the about 200bp of above gained, 750bp and about 5200bp, use T ₄Ligase enzyme connects, and obtains containing the prokaryotic expression carrier pET-FM1 of bivalent vaccine gene O-A and GFP fusion gene and contains bivalent vaccine gene A-O and the prokaryotic expression carrier pET-FM2 of GFP fusion gene.Expression vector is transformed respectively in the competence e. coli bl21, carry out the SDS-PAGE Protein Detection.Contain the clone bacterium BL21 of prokaryotic expression carrier pET-FM1 and pET-FM2, can on the kantlex substratum, grow, can under blue light, inspire green fluorescence again.Illustrate that carrier pET-FM1 and pET-FM2 contain bivalent vaccine gene O-A and GFP fusion gene and bivalent vaccine gene A-O and GFP fusion gene, see Fig. 8.

The immunogenic detection of embodiment 3. prokaryotic expression products

Two valency polypeptide that at first will build and the fusion gene abduction delivering of GFP also carry out protein purification (method is undertaken by the pET-28a of Novagen company (+) technical specification), detect the immunogenicity of expression product then.

1. purifying protein

The clone bacterium BL21 inoculum that will contain prokaryotic expression carrier pET-FM1 and pET-FM2 is centrifugal 15min under 4 ℃, 6500g condition, to collect thalline, removes supernatant.The resuspended precipitation of 1XIB damping fluid (20mmol/L Tris-HCl, pH 7.5,10mmol/L EDTA, 1% TritonX-100) with original fluid 1/10 volume.N,O-Diacetylmuramidase adds ultrasonic degradation: add N,O-Diacetylmuramidase to final concentration 100 μ g/mL, place 15min for 30 ℃.After the stirring sample buffer is placed ice bath, utilize ultrasonic apparatus (homemade new sesame board), 200-300W power, ultrasonic by 1 second, 3 seconds kinds mode is at interval carried out 60-90 time.Add proteinase inhibitor (PSMF) again.Under 4 ℃, the centrifugal 10min of 10000g.Remove supernatant, with the resuspended precipitation of 1XIB damping fluid of original fluid 1/10 volume.Above-mentioned steps repeats 2 times.Then, suspension is moved in the centrifuge tube of known heavy.At 4 ℃ of centrifugal 10min of 10000g.Thoroughly remove supernatant.Weigh, calculate output.

2. SDS-PAGE electrophoresis

The SDS-PAGE electrophoresis detection: the protein expressioning product to the clone bacterium BL21 that contains prokaryotic expression carrier pET-FM1 and pET-FM2 carries out the SDS-PAGE electrophoresis according to a conventional method, resolving gel concentration 8%, Coomassie brilliant blue R-250 dyeing, methyl alcohol-acetate decolouring.

The result shows, the purifying protein size of clone bacterium BL21 that contains prokaryotic expression carrier pET-FM1 and pET-FM2 promptly greater than the proteic size of GFP, is confirmed to be target protein greater than 30KD.

3. Western blotting analyzes

The preparation of solution

Electrotransfer damping fluid: contain the 39mmol/L glycine, 48mmol/L Tris.HCL (pH6.8), 037%SDS, 20% methyl alcohol.

Preparation 1000mL: take by weighing glycine 2.9g, Tris alkali 5.8g, SDS 0.37g, be dissolved in the 750mL redistilled water after, add 200mL methyl alcohol, be settled to 1000mL.

Washing lotion solution: 150mmol/L NaCL, 50mmol/L TrisHCL pH7.5;

Confining liquid: 10mL PBST+0.3g BSA;

0.5% amino black 10B dye liquor: take by weighing amino black 10B 0.5g, add methyl alcohol 45mL, ice ethanol 10mL, redistilled water 45mL;

The ethanol of amino black rinsing liquid: 45mL 95%, 5mL glacial acetic acid, 50mL deionized water;

Substrate solution (30mL): DAB (diaminobenzidine) and the 9mg CoCL of dissolving 15mg among the 30mL PBST ₂, add 10 μ L 30%H again ₂O ₂

Electrotransfer

Cut 6 and above-mentioned running gel filter paper of the same size and a NC film, and soak 3-5min with transfering buffering liquid.Successively sponge, 3 of filter paper, gel, NC film, 3 of filter paper, sponge are put well, fix with sieve tray then, insert in the electrotransfer groove, add transfering buffering liquid, determine gel at negative electrode, the NC film is in anode direction.Connect power supply, voltage is 50-100V, 4 ℃ of following electrophoresis 2-3h.Electrotransfer finishes, and takes out the NC film, with pencil or cut off one jiao of direction with label film.Downcut standard molecular weight Marker,, put the amino black dye liquor and contaminate 5min, take out the back with the rinsing liquid decolouring, take off to the greatest extent until blue background.All the other NC films wash with PBS, add the 10mL confining liquid and soak, and room temperature concussion 1-3h is to seal the not site of adsorbed proteins.

Immunology detection

After sealing finished, the NC film that conversion is contained the fusion rotein that bivalent vaccine gene O-A and A-O and GFP fusion gene express was with PBS rinsing liquid rinsing 4-5 time, 5min at every turn.

The NC film is gone in the plastics bag, and the FMDO type and the A type that add PBST dilution in 1: 800 respectively (are O or A type, more specifically) positive serum 10mL (0.1mL/cm ²), seal.37 ℃ slightly shake in conjunction with 1.5h, with PBST flushing 4-5 time, slowly shake at shaking table at every turn.Add the anti-pig IgG of rabbit (two is anti-) of dilution in 1: 800 then, jog is hatched 1h under the room temperature, takes out with PBST flushing 3-4 time each 10min.Anti-to remove unconjugated two.

The NC film is transferred to substrate solution, and room temperature lucifuge jog 5-10min observes the colour developing situation, waits when band occurring, changes PBST damping fluid termination reaction immediately over to.Room temperature preservation is taken a picture.

4. result

Analyze through Western blotting, contain the purifying protein that bivalent vaccine gene O-A and A-O and GFP fusion gene are expressed in prokaryotic expression carrier pET-FM1 and pET-FM2, can be discerned by O type and A type foot and mouth disease positive serum, prove that the expression product that contains bivalent vaccine gene O-A and A-O and GFP fusion gene has immunologic competence.

The information of SEQ ID NO 1

Sequence signature:

(A) (length): 204 bases

(B) type: nucleic acid

(C) chain: strand

(D) (topological framework): linearity

(1) molecule type: cDNA

(2) sequence description: SEQ ID NO 1:

(3)gtg?acc?aaa?gtg?aga?ggc?gat?ctg?cag?gtg?ctg?gcg?cag?aaa?gcg?gca?cgc?tct?ctg?ccg?aga?cat?aaa?cag

aag?att?gtg?gca?cca?ggc?aaa?cgc?ctg?ctg?aac?gcg?ggc?cgt?cgc?ggc?gat?ctg?ggc?tct?ctg?gcg?gcg?cgt

gtg?gcg?cag?ctg?ccg?gcg?cgc?cat?aaa?cag?cgt?att?att?gcg?ccg?gcg?aaa?cag?ctg?ctg

The information of SEQ ID NO 2

Sequence signature:

(A) (length): 204 bases

(B) type: nucleic acid

(C) chain: strand

(D) (topological framework): linearity

Sequence description: SEQ ID NO 2:

aac?gcg?ggc?cgt?cgc?ggc?gat?ctg?ggc?tct?ctg?gcg?gcg?cgt?gtg?gcg?cag?ctg?ccg?gcg?cgc

cat?aaa?cag?cgt?att?att?gcg?ccg?gcg?aaa?cag?ctg?ctg?gtg?acc?aaa?gtg?aga?ggc?gat?ctg?cag

gtg?ctg?gcg?cag?aaa?gcg?gca?cgc?tct?ctg?ccg?aga?cat?aaa?cag?aag?att?gtg?gca?cca?ggc

aaa?cgc?ctg?ctg

(4)

The information of SEQ ID NO 3

Sequence signature:

(A) (length): 68 amino acid

(B) type: polypeptide

(C) chain: strand

(D) (topological framework): linearity

Sequence description: SEQ ID NO 3:

1 V T K V R G D L Q V L A Q K A A R S L P

21 R H K Q K I V A P G K R L L N A G R R G

D L G S L A A R V A Q L P A R H K Q R I

61 I A P A K Q L L

The information of SEQ ID NO 4

Sequence signature:

(A) (length): 68 amino acid

(B) type: polypeptide

(C) chain: strand

(D) (topological framework): linearity

Sequence description: SEQ ID NO4:

1 N A G R R G D L G S L A A R V A Q L P A

21 R H K Q R I I A P A K Q L L V T K V R G

D L Q V L A Q K A A R S L P R H K Q K I

61 V A P G K R?L?L

The information of SEQ ID NO5

Sequence signature:

(A) (length): 924 bases

(B) type: nucleic acid

(C) chain: strand

(D) (topological framework): linearity

Sequence description: SEQ ID NO 5:

1 GTGACCAAAG?TGAGAGGCGA?TCTGCAGGTG?CTGGCGCAGA?AAGCGGCACG?CTCTCTGCCG

61 AGACATAAAC?AGAAGATTGT?GGCACCAGGC?AAACGCCTGC?TGAACGCGGG?CCGTCGCGGC

121 GATCTGGGCT?CTCTGGCGGC?GCGTGTGGCG?CAGCTGCCGG?CGCGCCATAA?ACAGCGTATT

181 ATTGCGCCGG?CGAAACAGCT?GCTGATGGTG?AGCAAGGGCG?AGGAGCTGTT?CACCGGGGTG

241 GTGCCCATCC?TGGTCGAGCT?GGACGGCGAC?GTAAACGGCC?ACAAGTTCAG?CGTGTCCGGC

301 GAGGGCGAGG?GCGATGCCAC?CTACGGCAAG?CTGACCCTGA?AGTTCATCTG?CACCACCGGC

361 AAGCTGCCCG?TGCCCTGGCC?CACCCTCGTG?ACCACCCTGA?CCTACGGCGT?GCAGTGCTTC

421 AGCCGCTACC?CCGACCACAT?GAAGCAGCAC?GACTTCTTCA?AGTCCGCCAT?GCCCGAAGGC

481 TACGTCCAGG?AGCGCACCAT?CTTCTTCAAG?GACGACGGCA?ACTACAAGAC?CCGCGCCGAG

541 GTGAAGTTCG?AGGGCGACAC?CCTGGTGAAC?CGCATCGAGC?TGAAGGGCAT?CGACTTCAAG

601 GAGGACGGCA?ACATCCTGGG?GCACAAGCTG?GAGTACAACT?ACAACAGCCA?CAACGTCTAT

661 ATCATGGCCG?ACAAGCAGAA?GAACGGCATC?AAGGTGAACT?TCAAGATCCG?CCACAACATC

721 GAGGACGGCA?GCGTGCAGCT?CGCCGACCAC?TACCAGCAGA?ACACCCCCAT?CGGCGACGGC

781 CCCGTGCTGC?TGCCCGACAA?CCACTACCTG?AGCACCCAGT?CCGCCCTGAG?CAAAGACCCC

841 AACGAGAAGC?GCGATCACAT?GGTCCTGCTG?GAGTTCGTGA?CCGCCGCCGG?GATCACTCTC

901 GGCATGGACG?AGCTGTACAA?GTAA

(italicized item is that the positive body portion of O-A type FMD bivalent vaccine gene is the GFP gene)

The information of SEQ ID NO 6

Sequence signature:

(A) (length): 924 bases

(B) type: nucleic acid

(C) chain: strand

(D) (topological framework): linearity

Sequence description: SEQ ID NO 6:

1 AACGCGGGCC?GTCGCGGCGA?TCTGGGCTCT?CTGGCGGCGC?GTGTGGCGCA

GCTGCCGGCG

61 CGCCATAAAC?AGCGTATTAT?TGCGCCGGCG?AAACAGCTGC?TGGTGACCAA

AGTGAGAGGC

121 GATCTGCAGG?TGCTGGCGCA?GAAAGCGGCA?CGCTCTCTGC?CGAGACATAA

ACAGAAGATT

181 GTGGCACCAG?GCAAACGCCT?GCTGATGGTG?AGCAAGGGCG?AGGAGCTGTT

CACCGGGGTG

241 GTGCCCATCC?TGGTCGAGCT?GGACGGCGAC?GTAAACGGCC?ACAAGTTCAG

CGTGTCCGGC

301 GAGGGCGAGG?GCGATGCCAC?CTACGGCAAG?CTGACCCTGA?AGTTCATCTG

CACCACCGGC

361 AAGCTGCCCG?TGCCCTGGCC?CACCCTCGTG?ACCACCCTGA?CCTACGGCGT

GCAGTGCTTC

421 AGCCGCTACC?CCGACCACAT?GAAGCAGCAC?GACTTCTTCA?AGTCCGCCAT

GCCCGAAGGC

481 TACGTCCAGG?AGCGCACCAT?CTTCTTCAAG?GACGACGGCA?ACTACAAGAC

CCGCGCCGAG

541 GTGAAGTTCG?AGGGCGACAC?CCTGGTGAAC?CGCATCGAGC?TGAAGGGCAT

CGACTTCAAG

601 GAGGACGGCA?ACATCCTGGG?GCACAAGCTG?GAGTACAACT?ACAACAGCCA

CAACGTCTAT

661 ATCATGGCCG?ACAAGCAGAA?GAACGGCATC?AAGGTGAACT?TCAAGATCCG

CCACAACATC

721 GAGGACGGCA?GCGTGCAGCT?CGCCGACCAC?TACCAGCAGA?ACACCCCCAT

CGGCGACGGC

781 CCCGTGCTGC?TGCCCGACAA?CCACTACCTG?AGCACCCAGT?CCGCCCTGAG

CAAAGACCCC

841 AACGAGAAGC?GCGATCACAT?GGTCCTGCTG?GAGTTCGTGA?CCGCCGCCGG

GATCACTCTC

901 GGCATGGACG?AGCTGTACAA?GTAA

(italicized item is an A-O type FMD bivalent vaccine gene, and positive body portion is the GFP gene)

Claims (9)

1. encode a kind of nucleotide sequence of foot and mouth disease bivalent vaccine, it is characterized in that: this section nucleotide sequence is made of two portions series connection: a part is the 141-160 amino acid and the amino acid whose nucleotide sequence of 200-213 of coding foot and mouth disease A C-type virus C, the nucleotide sequence that 20 peptides of the A C-type virus C of promptly encoding, the nucleotide sequence of 14 peptides are in series; Another part is the 141-160 amino acid and the amino acid whose nucleotide sequence of 200-213 of coding O C-type virus C, the nucleotide sequence of 20 peptides, 14 peptides of O C-type virus C of promptly the encoding nucleotide sequence that is in series, this two portions nucleotide sequence is connected again becomes A C-type virus C encode 20 peptides and 14 peptides and O C-type virus C encode 20 peptides and 14 peptides, is the sequence shown in the SEQ ID NO:2; Or O C-type virus C encode 20 peptides and 14 peptides and 20 peptides of A C-type virus C coding and the Nucleotide tandem sequence of 14 peptides, be the sequence shown in the SEQ ID NO:1.

2. one section aminoacid sequence of inferring according to the nucleotide sequence of the described coding foot and mouth disease of claim 1 bivalent vaccine, it is characterized in that: aminoacid sequence is a sequence shown in SEQ ID NO:3 or the SEQ ID NO:4.

3. one kind makes up the method for nucleotide sequence according to claim 1, it is characterized in that: the amino acid whose nucleotide sequence series connection of at first will encode foot and mouth disease A C-type virus C 141-160 amino acid and 200-213; And the 141-160 amino acid of coding O C-type virus C and the amino acid whose nucleotide sequence series connection of 200-213, and then series connection becomes A C-type virus C encode 20 peptides and the 14 peptide nucleotide sequences of 20 peptides and 14 peptides and O C-type virus C of encoding and connects; Or encode 20 peptides and 14 peptides of O C-type virus C are connected with 20 peptides of A C-type virus C coding and the nucleotide sequence of 14 peptides.

4. prokaryotic expression carrier that comprises the described nucleotide sequence of claim 1.

5. prokaryotic expression carrier, the placed in-line nucleotide sequence that comprises nucleotide sequence shown in the SEQ ID NO:2 and green fluorescent protein GFP gene, be sequence shown in the SEQ ID NO:6, or the nucleosides in series acid sequence of nucleotide sequence shown in the SEQ ID NO:1 and green fluorescent protein GFP gene, be sequence shown in the SEQ ID NO:5.

6. prokaryotic expression carrier as claimed in claim 4, it is characterized in that: this carrier is pET28fmv1 or pET28fmv2.

7. prokaryotic expression carrier as claimed in claim 5, it is characterized in that: this carrier is pET-FM1 or pET-FM2.

8. the method for the prokaryotic expression carrier production foot and mouth disease bivalent vaccine of any described nucleotide sequence that contains the foot and mouth disease bivalent vaccine that utilizes claim 4-7, it is characterized in that: any described prokaryotic expression carrier of claim 4-7 is transformed in the engineering bacteria, carry out abduction delivering, the recombinant protein of extract then, purifying being expressed.

9. the purposes of the nucleotide sequence coded polypeptide of the two valency polypeptide vaccines of the described foot and mouth disease of claim 1, it is characterized in that: this polypeptide is as the application of preparation prevention O type and two kinds of aftosa vaccines of A type.

Images