CN1264861C - Receptor targeting chimeric toxin with junctional sequence - Google Patents

Abstract

The present invention relates to chimeric protein which is connected by a joint sequence and is composed of a toxin molecule and a guiding molecule. More specifically, the present invention relates to chimeric toxin which is connected by a simple joint sequence from 5 to 15 peptide and is composed of diphtheria toxin used as a cell toxic agent part and an epidermal growth factor used as a guiding part and a preparation method and the application thereof for being used as a tumor therapy agent.

Description

The receptor-directed sex-mosaicism toxin that has joint sequence

The present invention relates to connect the chimeric protein of forming by lps molecule and guide molecule by joint sequence.More particularly, the present invention relates to connect by simple 5～15 peptide linker sequences, by as the diphtheria toxin of cytotoxic agent part and the chimeric toxin of forming as the Urogastron of targeting part, its preparation method and as the application of tumor therapeutic agent.

Traditional tumor chemical therapy method depends on that medicine kills and wounds the ability of patient body's inner tumour cell.Yet most of antitumor chemicalses also will kill and wound normal cell in killing tumor cell.Antitumor drug has been represented the selectivity degree of some antitumor drug to tumour cell to tumour cell rather than Normocellular kill capability.The optionally a kind of method of tumor cell specific that improves antitumor drug is preferentially to the tumour cell delivering drugs.Optionally send chemotherapeutic promptly so-called " guiding " to specific cells colony.Can be by several method with the drug targeting tumour cell.Wherein one of method is to rely on the specific receptors molecule that is present on the tumor cell surface.The molecule that is called as " directed agents " can be discerned these cell surface receptors and specificity combination with it.Said " directed agents " can comprise antibody, somatomedin or hormone." directed agents " of identification specificity cell surface receptor can have the cytotoxicity molecular guide cell of these surface receptors.For example, many tumor cell surfaces all have the proteinic overexpression of EGF-R ELISA (EGFR).Urogastron (EGF) and transforminggrowthfactor-(TGF-α) but all EGFR and combinations with it on the tumor cell.Therefore, EGF and TGF-α promptly are " directed agents " of these tumour cells.

Can be connected another part that also forms hybrid molecule with it with " directed agents " is cytotoxin or cytotoxic agent.The most strong cytotoxic agent that is used to make up hybrid molecule is to suppress mammalian proteins matter synthetic bacteriotoxin.Studying more at present and being familiar with comparatively deep cytotoxic agent is ETA (PE40, PE38 and PE66).Many chimeric proteins based on ETA and other bacteriums or plant poison and hormone molecule are disclosed in the prior art.For example, United States Patent (USP) 4,545 discloses the binding substances that the ETA that can be used for killing and wounding human tumor cells and antibody or Urogastron form for No. 885.United States Patent (USP) 4,664 is addressed, the A chain or the coupling of B chain of antibody and Ricin can be used for killing tumor cell for No. 382.United States Patent (USP) 4,675, described for No. 383 with some hormone (as melanocyte-stimulating hormone, MSH) directly be connected with diphtheria toxin (DT) albumen, resulting hybrid protein can be used in conjunction with and kill and wound the cell that the surface has these hormones (as MSH).

As seen, the chimeric cell toxin is that the directive action molecule that there is the cell of specific receptors expression on the surface can be discerned and be killed and wounded specifically to a class.These hybrid molecules with DNA recombinant technology and gene fusion technical project and structure have comprised the cell that respectively toxin led, and and then the targeting part of killer cell and the toxin moiety of killer cell.

Along with to the research of antineoplastic guide medicine and deepening continuously of understanding, it is found that, in order to improve the cell killing activity of chimeric toxin, when strengthening dosage, tend to cause toxic side effect such as antibody generation and vascular leakage, thereby limited the clinical application of chimeric toxin.In the research of the molecular mechanisms of action of relevant guidance quality chimeric toxin, also find, improve the inappropriate folding of chimeric molecule, and then the receptor binding capacity and the stability of targeting part in the raising chimeric molecule, and the cell internalization of promotion toxin moiety, be one of important means that overcomes the problems referred to above.

For this reason, there is the people at first to utilize mouse interleukin-13 (mIL-3) to combine with diphtheria toxin, and between two parts, inserts a small peptide joint sequence Gly as targeting part ₄Ser obtains fused protein DAB ₃₈₉-Gly ₄Ser-mIL-3.Experimental result shows in the external and body, with belt lacing sequence Gly not ₄The fusion rotein DAB of Ser ₃₈₉-mIL-3 compares, and the former improves about 5～10 times (referring to Domunique.et al., FEBS Letters 406:157～161,1997) to the specific cell toxic action of tumour cell.Also once addressed in No. 99121905.8 Chinese patent application that we submitted in the past: can between the guiding of the gomphosis toxin albumen matter that constitutes by EGF and PE molecule and toxin moiety, insert " joint sequence " or a spacerarm of forming by 10～30 amino acid.And (as L-Ala, glycine and Serine) 2～3 tandem repetitive sequences that said joint sequence better is no more than 4 carbon atoms by 5～10 main chains and does not have a neutral amino acids of benzene ring side chain are formed.Recently, also reported a kind of based on joint sequence, the chimeric protein of forming by Pseudomonas exotoxin (PE) and gonadoliberin (GnRH) (L-GnRH-PE66 or L-GnRH-PE40).External and in vivo test result shows that L-GnRH-PE has cytotoxic activity and tumor growth to suppress active to the kinds of tumor cells cording, and the active GnRH-PE that does not have polylinker that is significantly higher than.Therefore, the investigator thinks that L-GnRH-PE gets a good chance of becoming a kind of strong anti-tumor medicine (referring to AhmiBen-Yehudah et al, Medical Oncology 16:38-45,1999).

The inventor has successfully made up between toxin moiety-diphtheria toxin molecule and targeting part-Urogastron molecule and has inserted (Gly on the basis that studies for a long period of time for many years based on the antineoplastic guide medicine of diphtheria toxin ₄Ser) chimeric protein of joint sequence, and tentative confirmation its external and anti-tumor in vivo biologic activity of obviously improving, thereby finished the present invention.

An object of the present invention is to provide and form by toxin moiety and targeting part, and between has inserted the chimeric protein of suitable joint sequence, be characterised in that said toxin moiety is the diphtheria toxin molecule, targeting part is the Urogastron molecule, and joint sequence is (Gly ₄Ser) _n

According to a preferred embodiment of the invention, wherein said diphtheria toxin is partly by comprising ripe diphtheria toxin catalysis and striding the DAB that three amino acid of 386 amino acid and 484-486 position in film district are formed ₃₈₉

According to a preferred embodiment of the invention, wherein said epidermal growth factor subdivision amino acid/11～53 that are ripe Urogastron.

According to a preferred embodiment of the invention, wherein joint sequence is (Gly ₄Ser) _1～3

According to a preferred embodiment of the invention, wherein joint sequence is (Gly ₄Ser) ₂

Another object of the present invention provides the method for producing the chimeric protein that is defined as above, and this method comprises:

(1) provides and carry DAB ₃₈₉The recombinant expression vector of the dna encoding sequence of-L-EGF;

(2) recombinant vectors with step (1) transforms appropriate host cell;

(3) be suitable for expressing DAB ₃₈₉Culturing step under the condition of-L-EGF chimeric protein (2) by transformed host cells;

(4) results and purifying with chimeric protein.

A further object of the present invention provides and contains the chimeric protein that is defined as above and the pharmaceutical composition of one or more pharmaceutically acceptable carriers or vehicle.

A further object of the present invention provides the application of chimeric protein in producing antitumor drug that is defined as above.

Fig. 1 demonstration is used to express DAB ₃₈₉The structure of the recombinant expression plasmid pET-28a-DLE of-L-EGF chimeric protein.

Fig. 2 shows DAB ₃₈₉-(Gly ₄Ser) ₂Agarose gel electrophoretogram with the pcr amplification product of the dna encoding sequence of EGF.Wherein swimming lane A is the pcr amplification product of EGF gene; Swimming lane B is DAB ₃₈₉-(Gly ₄Ser) ₂Pcr amplification product; Swimming lane C is a dna molecular amount mark.

Fig. 3 shows the DAB that the present invention prepares ₃₈₉The SDS-PAGE collection of illustrative plates of-L-EGF.Wherein swimming lane A is the protein molecular weight mark; Swimming lane B, C, D are DAB ₃₈₉-L-EGF chimeric protein.

Fig. 4 show with [ ³H]-influence of DT-EGF chimeric protein pair cell (HepG-2 Bel7402) protein synthesis that has or do not have joint sequence of the different concns that the leucine method of mixing detects.Wherein represent zero DAB ₃₈₉-L-EGF treatment group; ● represent DAB ₃₈₉-EGF treatment group; ■ represents the PBS negative control group.The result is with the synthetic expression of the percentage albumen that accounts for the cellular control unit that does not contact chimeric protein.

Fig. 5 shows DAB ₃₈₉-L-EGF is to nude mice (Balb/c) transplanted tumor (Hct-8 human colon carcinoma), the influence of average tumor size.Wherein zero represent DAB ₃₈₉-L-EGF; ● represent DAB ₃₈₉-EGF positive control; ■ represents phosphate buffered saline (PBS) (PBS) negative control.

The present invention relates to form, and between inserted the chimeric protein of a small peptide joint sequence by lps molecule and guide molecule.Specifically, the present invention relates to connect, by as the diphtheria toxin of cytotoxic agent part and the chimeric protein of forming as the long factor of the epidermal growth of molecular guide part, its preparation method and as the application of antineoplastic agent by simple 5～15 peptide linker sequences.According to a preferred embodiment of the invention, wherein the cytotoxic agent of said chimeric protein partly by the catalysis that comprises sophisticated diphtheria toxin with what stride that 3 amino acid of preceding 386 amino acid and 484-486 position in film district form (is DAB ₃₈₉), and targeting part is made up of amino acid/11～53 of ripe Urogastron.

As everyone knows, diphtheria toxin be contain 535 amino acid whose, responsive eukaryotic cell is had supervirulent single chain polypeptide.The complete molecule of diphtheria toxin comprises A and two fragments of B.Lps molecule at first combines with cell surface receptor by the Serine on 525, pass through acid CC through the acceptor mediated endocytosis then, in cytosol, discharge A fragment (Moya, M.et al. with enzymatic activity, J.Cell Biol.101:548～559,1985; Sandvig, K.et al., J.Biol.Chem.261:11639～11645,1986).The NAD of A fragment catalysis elongation factor 2 (EF-2) ⁺The dependency ADP ribosylation causes synthetic inhibition of cell protein and necrocytosis.Diphtheria toxin B fragment has the eukaryotic cell receptor binding domain and helps passing the endochylema film sends the A fragments sequence, so available various peptide hormone (as MSH or GnRH) and somatomedin (as EGF) replace the receptor binding domain of natural diphtheria toxin, to produce fusion toxin (the Murphy.J.et al. that the eukaryotic cell that carries the specific receptors molecule is had the selecting cell toxic action, Proc.Natl.Acad.Sci.USA 83:8258～8262,1986).

From the sixties in 20th century, some laboratories just attempt diphtheria toxin is used for tumor treatment.For example, Willams, people such as D.P. have at first made up with DAB ₄₈₆As toxin moiety and with the recombinant toxin of interleukin-22 (IL-2) as targeting part.Continue after, some other research group has prepared based on diphtheria toxin in succession and has utilized the fusion toxin as directed agents such as 1L-3, IL-4, IL-6, EGF and TGF α.Particularly in recent years in the further further investigation to fusion toxin, people such as Domunique (FEBS Letters 406:157～161,1997) at first utilize mouse IL-3 (mIL-3) and diphtheria toxin DAB ₃₈₉Merge, and between guiding and toxin moiety, insert joint sequence Gly ₄Ser has successfully prepared than prototype DAB ₃₈₉-mIL-3 has the DAB of stronger cytotoxic activity ₃₈₉-Gly ₄The Ser-mIL-3 fused protein, thus for improving the special biologic activity of fusion toxin, reducing effective using dosage provides a new approach.

Urogastron (EGF) is made up of 53 amino acid, can and the cell in epidermis and protoplasm source on after the specific receptors of expressing interacts, the single chain polypeptide that stimulates cellular proliferation (Carperter, G.Annu Rev Biochem.48:193～216,1979).EGF acceptor (EGFR) be a kind of by the extracellular ligand land, stride the film district and have the glycoprotein that the interior region of integral protein tyrosine kinase activity is formed.Some results of study show, EGFR may malignant disease bring out and keep in play a role.As seen the overexpression of malignant cell surface EGFR is all arranged in many tumor tissues.For example, compare with normal surrounding tissue, the EGFR of tumour cell can increase and reaches 500 times.These and some other research promptings can use cytotoxic agent at EGFR as a kind of effective tumor therapeutic agent, are used for the treatment of with cell surface EGFR and express the kinds of tumors that increases to feature.

Combine probability and combination stability in order to ensure targeting part in the chimeric toxin molecule and its cell surface receptor, consider the suitable folding of chimeric protein molecule β lamella, former being engaged in for a long time on the basis of studying based on the chimeric protein of diphtheria toxin, between diphtheria toxin molecule and EGF molecule, inserted one with single-chain antibody (scFv) in the substantially the same joint sequence of employed polylinker, successfully make up and prepared DAB of the present invention ₃₈₉-L-EGF chimeric protein-wherein L represents joint sequence (Gly ₄Ser) n, n are 1～3, and preferably 2.Experimental result effectively shows DAB of the present invention in our the external and body ₃₈₉-L-EGF chimeric protein does not more have (Gys ₄Ser) ₂Prototype chimeric protein (the DAB of joint sequence ₃₈₉-EGF) improved intramolecularly folding and cell surface receptor binding ability significantly, and the cell internalization ability of lps molecule, thus improved the target cell specific cell cytotoxic activity of chimeric toxin greatly.

In order to finish the present invention, can use gene fusion technology well known by persons skilled in the art or chemosynthesis and coupling technology to prepare gomphosis toxin albumen matter of the present invention, but preferably use the gene fusion technology.For this reason, can finish various DNA operations according to known DNA recombinant technology (as referring to Sambrook et a1., Molecular Cloning:ALaboratory Manual, Cold Spring Harbor Laboratory, 1989).For example, at first flank can be had suitable restriction enzyme site, by (Gly ₄Ser) _1～315～45bp synthetic oligonucleotide that encoding sequence is formed is inserted into same enzyme and cuts, and carries DAB ₃₈₉In the plasmid of-EGF, thereby obtain carrying DAB ₃₈₉The recombinant plasmid of-L encoding sequence.Perhaps, can use suitable synthetic Oligonucleolide primers, obtain DAB from the known plasmid amplification that carries overall length diphtheria toxin gene with the RT-PCR method ₃₈₉-(Gly ₄Ser) _nFragment (wherein n is 1～3, preferably 2).The fragment that then this end is had a suitable restriction enzyme site is connected on the plasmid with same endonuclease cutting, and increases it in appropriate host cell.Simultaneously, use suitable Oligonucleolide primers, amplification obtains the dna fragmentation of EGF of encoding from the plasmid vector that contains the EGF gene, and is connected to the above-mentioned DAB of containing ₃₈₉-(Gly ₄Ser) on the carrier of n encoding sequence, obtain required being used to and express DAB of the present invention ₃₈₉The recombinant plasmid vector of-L-EGF-wherein L represents (Gly ₄Ser) _n, n represents 1～3, and preferably 2.Can use endonuclease enzyme digestion and dna sequence analysis method to identify the exactness of resulting plasmid dna sequence.Transform appropriate host cell such as Bacillus coli cells with this recombinant expression vector then, and cultivate under suitable condition, to produce required chimeric protein by cell transformed.

Can use saltout, methods such as ultrafiltration, ion exchange chromatography, hydrophobic interaction chromatography and gel-filtration separate and the required protein expression product of purifying from the lysate of cell and substratum.In the separation and purge process step of product, can use the existence and the molecular size thereof of polyacrylamide gel electrophoresis (SDS-PAGE) and enzyme-linked immunosorbent assay (ELISA) or Western blotting monitoring product.

Can use in the document disclosed various detection methods to identify DAB of the present invention ₃₈₉The character of-L-EGF chimeric protein and biologic activity.These methods comprise: (1) ADP glycosylation test, this method is according to DAB ₃₈₉-L-EGF or DAB ₃₈₉The ability of the ADP ribosylation of-EGF catalysis elongation factor 2 (EF-2) detects its restraining effect to the mammalian cell protein synthesis; (2) receptor binding assays, this method is according to DAB ₃₈₉-L-EGF or DAB ₃₈₉The competitive displacement of-EGF combines it with A431 cell serous coat ¹²⁵The ability of I-EGF detects its specific receptors in conjunction with activity; (3) MTT cell survival rate test, this method are according to viable cell the ability that MTT changes into blue purple first a ceremonial jade-ladle, used in libation xln to be detected tumour target cell and DAB ₃₈₉-L-EGF or DAB ₃₈₉Viability after the-EGF contact; (4) the synthetic inhibition test of cell protein, this method be according to the tumour target cell that lives in protein building-up process, take in [ ³H]-leucic ability detection DAB ₃₈₉-L-EGF or DAB ₃₈₉-EGF suppresses cell protein synthetic cytotoxic activity; (5) transplanted tumor in nude mice growth inhibition test, this method is according to DAB ₃₈₉-L-EGF or DAB ₃₈₉-EGF detects its killing activity to the tumour target cell to the inhibition ability of Balb/c mice-transplanted tumor growth.

The invention further relates to the pharmaceutical composition that contains above-mentioned chimeric toxin and at least a pharmaceutically acceptable inert support or vehicle.Can be suitable for the pharmaceutical composition (as referring to Remington ' s Pharmaceutical Science, 15th ed., Mack Publishing Company, 1980) of the outer administration of gi tract according to known fundamental principle in pharmaceutical industry field and method preparation.Can by in various route of administration, particularly intravenously, intramuscular, intraarticular, intraperitoneal, the nose, intracutaneous, the outer approach of gi tract such as the subcutaneous pharmaceutical composition of the present invention that comes into operation.

The pharmaceutical composition that can use chimeric toxin of the present invention or contain this gomphosis toxin albumen matter is as therapeutical agent, is used for the treatment of that responsible this proteinic toxic action is alleviated or the various diseases of the particular type human body cell eliminated.A kind of preferred purposes is to be used for the treatment of the neoplasm disease that the cell of overexpression EGFR is gone up on its surface, particularly various tissue-derived gland cancer and squamous cell carcinoma.Chimeric toxin of the present invention or contain the treatment effective dose of the pharmaceutical composition of this chimeric toxin generally should be according to the character of disease, severity, patient's general situation and to the susceptibility of medicine, and factor such as route of administration is determined according to principle of individuation by the clinician.

The following example is intended to further illustrate for example the present invention, rather than limits the await the reply scope of claim of the present invention by any way.

Embodiment 1: the structure of recombinant plasmid pET-28a-DLE

Present embodiment is described for example and is used to express DAB of the present invention ₃₈₉Construction strategy and the basic skills of the recombinant expression plasmid pET-28a-DLE of-L-EGF chimeric toxin.

At first, use suitable primer to obtain the full gene of diphtheria toxin from the total DNA cloning of diphtheria corynebacterium, and it is cloned among the plasmid vector pGEM-T (Novagen) with the RT-PCR method.Then, use synthetic Oligonucleolide primers A:5 '-CATGCCATGG GCGCTGATGA TGTTGTT-3 ' (SEQ IDNO:1) and B:5 '-CGGGATCCAC CTCCGCCTGA ACCGCCTCCA CCCGCATGCGTTTTATGCCC CGGAGA-3 ' (SEQ ID NO:2), obtain encoding D AB with the PCR method amplification ₃₈₉-(Gly ₄Ser) ₂Dna fragmentation.Reclaim required dna fragmentation with endonuclease NcoI and BamHI digestion back, and in the presence of the T4 dna ligase, this fragment is connected in the pET-28a plasmid (Novagen) that digests with same restriction endonuclease.With resulting connection mixture transformed competence colibacillus intestinal bacteria JM105 cell, with a large amount of preparation plasmid DNA.And then use synthetic Oligonucleolide primers C:5 '-CGGGATCCAA CTCCGACTCC GAATGTC-3 ' (SEQ ID NO:3) and D:5 '-CGGAATTCTT ATCTCAATTC CCACCACTTC-3 ' (SEQ ID NO:4), from pVC8 plasmid (the Chaudhary et al. that contains the EGF gene, Proc.Natl.Acad.Sci.USA 84:4538～4542,1987) pcr amplification obtains overall length EGF encoding sequence in.After endonuclease BamHI and EcoRI digestion and reclaiming the EGF fragment, in the presence of the T4 dna ligase, be connected to the above-mentioned DAB that carries that uses same restriction enzyme cutting ₃₈₉-(Gly ₄Ser) ₂On the segmental plasmid vector pET-28a.Transform to infect with resulting connection product then and be subjected to attitude intestinal bacteria JM105 bacterial strain.

Cultivation by cell transformed after, select single bacterium colony and therefrom extract plasmid DNA.Use endonuclease enzyme digestion and pcr amplification method to identify resulting dna sequence dna.Can carry out the exactness of dna sequence analysis in case of necessity with further confirmation sequence.Carry diphtheria toxin DAB with what so obtain ₃₈₉Sequence (SEQID NO:5), epidermal growth factor subsequence (SEQ ID NO:7) and the recombinant plasmid that is present in joint sequence (SEQ ID NO:6) are between the two named and are pET-28a-DLE.The structure flow process of plasmid pET-28a-DLE is as shown in accompanying drawing 1.

Available this plasmid transformation escherichia coli BL21 (λ DE3) selects single bacterium colony and extracts plasmid DNA, and further uses PCR to identify (referring to Fig. 2) after the cultivation.

Embodiment 2:DAB ₃₈₉The expression of-L-EGF chimeric protein, purifying and evaluation

Present embodiment is described DAB of the present invention for example ₃₈₉The abduction delivering of-L-EGF chimeric protein in e. coli host cell, the separation and purification of expression product and evaluation.

With recombinant plasmid pET-28a-DLE transformed competence colibacillus e. coli bl21 (λ DE3) bacterial strain that makes among the embodiment 1, and according to a conventional method 37 ℃ of cultivations by cell transformed.Work as OD ₆₀₀During nm=0.6, reduce culture temperature to 32 ℃ and in culture, add IPTG with abduction delivering.Induce in the process, with SDS-PAGE electrophoretic method monitoring protein expression product.After discovery was induced 3.5 hours, target protein reached high expression level (account for bacterial protein 33%).

The inclusion body of separating Escherichia coli host cell according to a conventional method filters with method (HPLC) such as high pressure liquid chromatography (HPLC) separates the also required protein (referring to Fig. 3) of purifying from inclusion body and substratum to saltout, to filter glue.

Use immunoblotting assay method and N-terminal determined amino acid sequence method (the terminal cessation method of the two deoxidations of Sanger) to identify expression product then.The result shows, the DAB of the present invention's preparation ₃₈₉-L-EGF is the about 49KDa of molecular weight, 15 right-on chimeric proteins of amino acid of N-terminal.

Embodiment 3:DAB ₃₈₉The cell in vitro cytotoxic activity test of-L-EGF chimeric protein

Present embodiment is intended to test the verify human tumor cell line cell in vitro cytotoxic activity of various cultivations of gomphosis toxin albumen of the present invention.Employed Bel7402 HepG-2, CCL188 Hct-8, MCF-7 Mcf-7, human lung cancer cell line A549 and human cervical carcinoma cell are that Hela all can buy from China typical culture collection center (CCTCC) or Nat'l Pharmaceutical ﹠ Biological Products Control Institute in the experiment.

With cell (2 * 10 ⁴/ ml) be inoculated in each holes of 96 hole microtest plates (0.2ml/ hole) and cultivate 24 hours according to a conventional method after, in each hole, add the DAB of different concns ₃₈₉-L-EGF or control sample DAB ₃₈₉-EGF (0.01ml).Continue insulation after 24 hours, add again [ ³H]-leucine (1 μ Ci/ hole) and incubated overnight.Behind the fast freeze-thaw cell with cell harvesting to filter membrane, be incorporated into intracellular radioactivity with the β count detection then.

The result as seen, the gomphosis toxin albumen matter that has joint sequence of purifying relies on mode with dosage, suppresses the protein synthesis of various tumor cell lines significantly, thereby brings into play its cytotoxic activity (referring to table 1).In addition, end user's hepatoma cell line HepG-2 (being provided by Nat'l Pharmaceutical ﹠ Biological Products Control Institute) further shows as the comparative experiments result that target cell carried out, DAB of the present invention ₃₈₉The ID of-L-EGF chimeric toxin ₅₀Value is approximately than the ID of the chimeric diphtheria toxin of corresponding guidance quality that does not have joint sequence ₅₀Low 2～3 times (referring to Fig. 4).

Table 1.DAB ₃₈₉-L-EGF and DAB ₃₈₉_ EGF is to the cell in vitro toxic action of different people tumour cell

Clone	The source	IC 50(μg/ml)
				DAB 389-L-EGF	DAB 389EGF
		HepG-2 Hct-8 Mcf-7 A549 Hela	Liver cancer colorectal carcinoma mammary cancer lung cancer cervical cancer			2.34 1.36 0.88 0.65 0.98	4.56 3.87 2.76 1.64 3.54

Embodiment 4:DAB ₃₈₉The inhibition activity of the transplanted tumor of growth in the-L-EGF chimeric protein confrontation body

Present embodiment is intended to observe the restraining effect of chimeric toxin of the present invention to the transplanted tumor of growing in the nude mouse, so as to detecting guiding and the killing activity of chimeric toxin of the present invention to growing tumors target cell in the body.

To be dissolved in 2.5 * 10 of 100 μ l PBS ⁵Individual Bel7402 HepG-2 (being preserved by this chamber) is in being subcutaneously injected into each Balb/c mouse body.In the time can seeing or touch the nude mice Subcutaneous tumor after 5 days, animal is divided into 3 groups (10 every group) at random.The experimental group animal is respectively injected 10 μ g DAB every day ₃₈₉-L-EGF, positive controls is respectively injected 10 μ g DAB every day ₃₈₉-EGF.The negative control treated animal is then respectively accepted isopyknic PBS every day.All animals all through the intraperitoneal injection administration, every day 1 time, were injected 15 days altogether.Measure and calculate the tumour size every day.Put to death animal on the 18th day, transplanted tumor and the heart, liver,kidney,spleen and the cerebral tissue of animal carried out pathological examination.

The result shows that the tumour size when treatment finishes between each group has very big-difference.Injection DAB ₃₈₉The mouse Subcutaneous tumor of-L-EGF is approximately than injection DAB ₃₈₉The animal tumor of-EGF is little 2.5～3 times, and than the negative control group little 4～8 times (referring to Fig. 5) of only injecting PBS.In addition, treat after 15 days, all organs of animal there is no any tangible pathological change.This shows, in order to improve the susceptibility of tumour target cell to the toxin moiety and the targeting part of chimeric toxin, make chimeric toxin bring into play (EGFR) combination of its acceptor and cytotoxic activity and target cell kill capability better, between its toxin moiety and targeting part, insert a similar joint sequence that is used to make up single-chain antibody, to improve the β lamella folding of whole molecule greatly, thereby make it to bring into play more effectively its above-mentioned functions.

Sequence table

(1) general information

(I) applicant: Military Supplies Univ., PLA

(II) denomination of invention: the receptor-directed sex-mosaicism toxin that has joint sequence

(III) sequence number: 7

(IV) address:

(A) contact person: Zhu Ping

(B) street; No. 175, Xi'an main road

(C) city; Changchun

(D) country: the People's Republic of China (PRC)

(E) postcode: 130062

(V) computer-reader form:

(A) amboceptor type: 3.5 inches floppy disks

(B) computer: IBMPC

(C) operating system: WINDOW98

(D) software: WORD98

(VI) telecommunication information:

(A) phone: 86-0431-7962109

(B) fax: 86-0431-7965274

(2) information of SEQ ID NO:1

(I) sequence signature:

(A) length: 27bp

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(II) molecule type: DNA

(III) sequence description: SEQ ID NO:1

CATGCCATGG GCGCTGATGA TGTTGTT

(2) information of SEQ ID NO:2

(I) sequence signature:

(A) length: 56bp

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(II) molecule type: DNA

(III) sequence description: SEQ ID NO:2

CGGGATCCAC CTCCGCCTGA ACCGCCTCCA CCCGCATGCG TTTTATGCCC CGGAGA

(2) information of SEQ ID NO:3

(I) sequence signature:

(A) length: 27bp

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(II) molecule type: DNA

(III) sequence description: SEQ ID NO:3

CGGGATCCAA CTCCGACTCC GAATGTC

(2) information of SEQ ID NO:4

(I) sequence signature:

(A) length: 30bp

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(II) molecule type: DNA

(III) sequence description: SEQ ID NO:4

CGGAATTCTT ATCTCAATTC CCACCACTTC

(2) information of SEQ ID NO:5

(I) sequence signature:

(A) length: 1167bp

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(II) molecule type: DNA

(III) sequence description: SEQ ID NO:5

ATGGGCGCTGATGATGTTGTTGATTCTTCTAAATCTTTTGTGATGGAAAACTTTTCTTCGTA

CCACGGGACTAAACCTGGTTATGTAGATTCCATTCAAAAAGGTATACAAAAGCCAAAATCT

GGTACACAAGGAAATTATGACGATGATTGGAAAGGGTTTTATAGTACCGACAATAAATACG

ACGCTGCGGAATACTCTGTAGATAATGAAAACCCGCTCTCTGGAAAAGCTGGAGGCGTGG

TCAAAGTGACGTATCCAGGACTGACGAAGGTTCTCGCACTAAAAGTGGATAATGCCGAAA

CTATTAAGAAAGAGTTAGGTTTAAGTCTCACTGAACCGTTGATGGAGCAAGTCGGAACGG

AAGAGTTTATCAAAAGGTTCGGTGATGGTGCTTCGCGTGTAGTGCTCAGCCTTCCCTTCGC

TGAGGGGAGTTCTAGCGTTGAATATATTAATAACTGGGAACAGGCGAAAGCGTTAAGCGTA

GAACTTGAGATTAATTTTGAAACCCGTGGAAAACGTGGCCAAGATGCGATGTATGATTATAT

GGCTCAAGCCTGTGCAGGAAATCGTGTCAGGCGATCAGTAGGTAGCTCATTGTCATGCATA

AATCTTGATTGGGATGACATAAGGGATAAAACTAAGACAAAGATAGAGTCTTTGAAAGACC

ATGGCCCTATCAAAAATAAAATCAGCGAAAGTCCCAATAAAACAGTATCTGAGGAAAAAG

CTAAACAATACCTAGAAGAATTTCATCAAACGGCATTAGAGCATCCTGAATTGTCAGAACT

TAAAACCGTTACTGGGACCAATCCTGTATTCGCTGGGGCTAACTATGCGGCGTGGTCAGTA

AACGTTGCGCAAGTTATCGATAGCGAAACAGCTGATAATTTGGAAAAGACAACTGCTGCT

GTTTCGATACTTCCTGGTCTAGTTAGCGTAATGGGCATTGCAGACGGTGCCGTTCACCACA

ATACAGAAGAGATAGTGGCACAATCAATAGCTTTATCGTCTTTAATGGTTGCTCAAGCTATT

CCATTGGTAGGAGAGCTAGTTGATATTGGTTTCGCTGCATATATTTTGTAGAGAGTATTATC

AATTTATTTCAAGTAGTTCATAATTCGTATAATCGTCCCGCGTATTCTCCGGGGCATAAAACG

CATGCG

(2) information of SEQ ID NO:6

(I) sequence signature:

(A) length: 30bp (B) type: nucleic acid

(C) chain: strand (D) topological framework: linear (II) molecule type: DNA

(III) sequence description: SEQ ID NO:6

GGTGGAGGCG GTTCAGGCGG AGGTGGATCC

(2) information of SEQ ID NO:7

(I) sequence signature:

(A) length: 159bp

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(II) molecule type: DNA

(III) sequence description: SEQ ID NO:7

AACTCCGACTCCGAATGTCCATTGTCCCACGACGGTTACTGTTTGCACGACGGTGTTTGTA

TGTACATCGAAGCTTTGGACAAGTACGCCTGTAACTGTGTTGTTGGTTACATCGGTGAAAG

ATGTCAATACAGAGACTTGAAGTGGTGGGAATTGAGA

Claims (8)

1. be made up of toxin moiety and targeting part, and between inserted the chimeric protein of suitable joint sequence, be characterised in that said toxin moiety is the diphtheria toxin molecule, targeting part is the Urogastron molecule, and joint sequence is (Gly ₄Ser) _n

2. according to the chimeric protein of claim 1, wherein said diphtheria toxin is partly by comprising ripe diphtheria toxin catalysis and striding that three amino acid of 386 amino acid and 484-486 position in film district form.

3. according to the chimeric protein of claim 1, amino acid/11～53 that wherein said epidermal growth factor subdivision is ripe Urogastron.

4. according to the chimeric protein of claim 1, wherein joint sequence is (Gly ₄Ser) _1～3

5. according to the chimeric protein of claim 1, wherein joint sequence is (Gly ₄Ser) ₂

6. produce the method as the chimeric protein of any one qualification among the claim 1-5, this method comprises:

(1) provides and carry DAB ₃₈₉The recombinant expression vector of the dna encoding sequence of-L-EGF;

(2) recombinant vectors with step (1) transforms appropriate host cell;

(3) be suitable for expressing DAB ₃₈₉Culturing step under the condition of-L-EGF chimeric protein (2) by transformed host cells;

(4) results and the resulting chimeric protein of purifying.

7. contain just like the chimeric protein of any one qualification among the claim 1-5 and the pharmaceutical composition of one or more pharmaceutically acceptable carriers or vehicle.

8. as the application in producing antitumor drug of the chimeric protein of any one qualification among the claim 1-5.

Images