CN1259171A - Retroviral vector particles produced in a baculovirus expression system - Google Patents

Abstract

A composition is described. The composition comprises at least one baculoviral component and at least one retroviral component, wherein the retroviral component is capable of being packaged into a retroviral particle.

Description

The retroviral vector particles that in baculovirus expression system, produces

The present invention relates to a kind of composition.

Specifically, the present invention relates to a novel system that produces counter-transcription-ing virus particle.

More particularly, the present invention relates to a kind of composition that can express counter-transcription-ing virus particle, this counter-transcription-ing virus particle can with a nucleotide sequence of being studied (after this being abbreviated as " NOI ") or or even many NOIs be passed to required position.

More particularly, the present invention relates to a kind of in gene therapy effective composition.

Gene therapy comprises following any or several form: in for example one or several target site such as target cell, adds, and displacement, deletion replenishes, and controls its one or several nucleotide sequence.If this target site is a target cell, these cells may be the parts of tissue or organ so.Generality about gene therapy instructs and can find in " molecular biology " (Ed Robert Meyers, Put VCH is as p 556-558).

As further illustration, gene therapy also provides a kind of method, whereby, available any or several nucleotides sequence such as gene substitution or additional dcc gene, can delete any or several Disease-causing genes or gene product, for for example, produce a kind of more satisfied phenotype, can add one or more new genes, can control cell at molecular level, so that treatment cancer (Schmidt-Wolf and Schmidt-Wolf, 1994, hematology annual 69:273-279) or other illness-as immunological disease, cardiovascular diseases, refreshing smart disease, inflammation or the infectious diseases learned, also can handle and/or import antigen, so that bring out immunne response-as do gene vaccine inoculation.

In recent years, proposed retrovirus is used for gene therapy.Retrovirus is RNA viruses basically, has the life cycle that is not used in cracking performance virus.Thus, when the retroviral infection cell, its genome will be transformed into dna form.In other words, retrovirus is a kind of infectious entity that duplicates by DNA vehicle.

The back will provide the more details about retroviral infection etc.

There are many kinds of retroviruss, for example comprise: murine leukemia virus (MLV), human immunodeficiency virus (HIV), equine infectious anaemia virus (EIAV), mouse mammary tumour virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR-mouse osteosarcoma virus (FBRMSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), bird leukocytosis syndrome virus-29 (Avian myelocytomatosisvirus-29) (MC29), and avian erythroblastosis virus (AEV).

In " retrovirus " (1997, Cold Spring HarbourLaboratory Press Eds:JM Coffin.SM Hughes, HE Varmus pp 758-763) of Coffin etc., can find the detailed list of retrovirus.

Also can find the details of relevant some retrovirus genome structure in this area.For example, can understand the detailed structure (being genome searching number AFO33819) of HIV from NCBI Genbank.

All retroviruss all contain 3 main coding structure territory gag of the basic virion protein of encoding, pol, env.Yet, can briefly retrovirus be divided into 2 classes, i.e. " simple type " and " complexity ".This two viroid can be distinguished by means of their genomic weave constructions.The simple type retrovirus only carries basic information usually.By contrast, the complexity retrovirus is also encoded from the complementary adjusting albumen of many montages information generation.

Even retrovirus can also be further divided into 7 monoids.Wherein 5 monoids are represented the retrovirus with oncogenic potential.2 remaining monoids are slow virus and foamy virus.Commentary about these retroviruss is provided in " retrovirus " (1997 Cold Spring Harbour Laboratory Press Eds:JMCoffin, SM Hughes, HE Varmus pp 1-25).

(HTLV-BLV) all the other all carinogenicity members belong to the simple type retrovirus except adult T-cell leukosis virus-bovine leukemia virus group.HTLV, BLV and slow virus and foamy virus are the complexity retroviruss.Studying some maximum carinogenicity retroviruss is Rous sarcoma virus (RSV), mouse mammary tumour virus (MMTV), and murine leukemia virus and adult T-cell leukosis virus (HTLV).

Even Slow virus group can also be divided into " primate type " and " non-primate type ".Primate type slow virus comprises the pathogenic agent human immunodeficiency virus (HIV) of the damaged syndromes of human autoimmune (AIDS), and simian immunodeficiency virus (SIV).Non-primate type Slow virus group comprises, prototype " slow virus " Wei Sina/chronic progressive pneumonia virus of sheep (VMV), and relevant Gongshan's arthritis-Encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and feline immunodeficiency virus (FIV) and the bovine immunodeficiency virus (BIV) found more recently.

Difference between slow virus family and other type retrovirus is that slow virus has ability (Lewis et al 1992 EMBO, the J11 that infects fissility cell and non-fissility cell; 3053-3058, Lewis and Emerman 1994 J.Virol.68:510-516).By contrast, other retrovirus such as MLV can not infect non-fissility cell, as constituting muscle, brain, the cell of lung and liver organization.

In course of infection, it is to be attached to specific cell surface receptor that retrovirus begins.Enter after the susceptibility host cell, retrovirus rna gene group is copied into DNA by the ThermoScript II of the encoding viral that carries in the parent virus.This DNA is transported to host cell nuclear, and at this, it is integrated into the host cell gene group subsequently.In this stage, it is commonly called provirus.In fission process, provirus is stable in host cell chromosome, and is translated as other cell protein.This provirus coding is made required protein and the packing plant of more viruses, and the virus of generation can be left cell by the mode that is called as " sprouting " sometimes.

What as already noted, each retrovirus genome included coding virion protein and enzyme is called as gag, the gene of pol and env.At two ends, two sides of these genes have the zone that is called long terminal repetition (LTRs).LTRs is responsible for proviral integration, and transcribes.They also play enhanser-promoter sequence.In other words, LTRs can control the expression of virogene.By means of the psi sequence that is positioned at viral genome 5 ' end retrovirus RNAs is wrapped up.

LTRs itself is the spination sequence that can be divided into 3 elements, and these three elements are called as U3, R and U5.U3 is from having only the terminal sequence that just has of 3 of its RNA '.R comes the tumor-necrosis factor glycoproteins of comfortable RNA two ends, and U5 is from having only the terminal sequence that just has of this RNA 5 '.At different retroviruss, the big I of these three compositions has sizable change.

For ease of understanding, provide one to show LTRs below, gag, pol and the basic outward appearance of env, simple retrovirus genome diagram (not ratio) by size.

For viral genome, transcription initiation site is place, the line of delimitation between (as shown above) U3 and the R in the LTR of left side, adds poly (A) (terminations) site and is in the LTR of right side the line of delimitation between (as shown above) R and U5 and locate.U3 is included in proviral most of transcriptional control element, and these compositions comprise pair cell, and under some situation to promotor and many enhancer sequence of virus transcription activator sensitivity.Some retrovirus has following any or several coding and the gene of proteins associated matter is regulated in genetic expression: tat, rev, tax and rex.

As shown in diagram in the above, the basic molecular composition of retrovirus rna gene group is (5 ') R-U5-gag, pol, env-U3-R (3 ').In reverse transcription vector gene group, gag, pol and env do not exist, and perhaps do not have function.Zone R at these RNA two ends is a repeating sequences.U5 and U3 represent respectively has only this rna gene group 5 ' and the 3 ' terminal sequence that just has.This three covers end sequence has formed long terminal repetition (LTRs) in proviral DNA, it is the genome form that is integrated in the infected cellular genome.LTRs is made up of (5 ') U3-R-U5 (3 ') in the wild-type retrovirus, so U3 and U5 contain the sequence important to the provirus integration.Other comprises in order to bring into play the necessary sequence of suitable function in the genome, is the primer combining site of article one chain reverse transcription, is the primer combining site of second chain reverse transcription, and packaging signal.

About structure gene gag, pol and env itself, in more detail, gag is the inner structural protein of coding virus.Gag obtains sophisticated protein MA (matrix), CA (capsid), NC (nucleocapsid) after by proteolytic treatment.The gene pol ThermoScript II (RT) of encoding had both comprised archaeal dna polymerase, comprised the active and intergrase (IN) of relevant RNA enzyme H again, the duplicating of mediated gene group.Surface (SU) glycoprotein of gene env coding virus particle and stride film (TM) albumen, their form one can be with the interactional complex body of cell receptor protein specificity.This interaction causes viromembrane to merge mutually with cytolemma the most at last.

The tunicle sugar-protein compound of retrovirus comprises two peptide species: outside hydrophilic polypeptide of glycosylation (SU) and transmembrane protein (TM).They form oligomeric " projection " or " outstanding spike " together on the virus particle surface.This two peptide species is all by the env genes encoding, and is synthesized with the form of polyprotein precursor, and this precursor is cut by proteolysis in being transported to the process of cell surface.Though uncut Env albumen also can with receptors bind,, cutting incident itself is essential to activating this proteinic fusion faculty, is absolutely necessary and this ability enters host cell to virus.Generalized case is, SU and TM albumen all at a plurality of positions by glycosylation.But, for some virus, MLV for example, its TM is not by glycosylation.

Though for the assembling virom crosome, not necessarily need SU and TM protein, they have requisite effect really in the process of entering.About this respect, being the functional zone of SU combines with acceptor molecule on the target cell, and normally specific acceptor molecule.It is believed that this binding events can activate the potentiality that TM protein induce film merges, after this virus and cytolemma merge.For some virus, be MLV significantly, be considered to cause removing the cutting incident of its sub-fraction TM tenuigenin afterbody, for fully representing this proteinic fusion-activity, play critical effect (Brody et al 1994, Journal of Virology: 4620-4627, Rein etal 1994, Journal of Virology: 68:1773-1781).This tenuigenin afterbody of TM TMD end still is retained in the inboard of viromembrane, and at different retroviruss, its length has sizable change.

Therefore, the specificity of SU/ acceptor interaction, the host range of soluble retrovirus and organize taxis.In some cases, this specific specificity may limit the transduction ability of recombinant retroviruses carrier.For this reason, MLV has all been used in many gene therapy experiments.A kind of special MLV with envelope protein 4070A is called as anphotropc virus (amphotropicvirus), and this virus also can the infected person cell, and conservative phosphoric acid transporter " connects " in people and the mouse because its envelope protein can coexist.Because this vehicle is ubiquitous, so these viruses can infect the various kinds of cell type.But in some cases, consider from the viewpoint of safety particularly that the cell of aiming at limitation specifically may be useful.For this reason, several study group have made up a kind of mouse parent preferendum retrovirus (ecotropic retrovirus), it does not resemble under the relative normal circumstances can only the infecting mouse cell anphotropc virus, and can infect specific people's cell specifically.A fragment that replaces envelope protein with the erythropoietin section, produced a recombinant Retroviruses, (Maulik and Patel 1997 " molecular biotechnology: treatment is used and strategy ", Wiley-Liss Inc.pp 45) then specifically combines with people's cell such as erythrocyte precursor in its surface expression erythropoietin receptor.

Remove gag, outside pol and the env, the complexity retrovirus also contains coding incidental or complementary proteinic " attaching " gene.Incidental or complementary protein is defined as, except those by common duplicating or structure gene gag, outside pol and the env encoded protein matter, by the protein of subsidiary genes encoding.These incidental protein are different from and are included in the protein of genetic expression in regulating, as those by tat, rev, tax and rex encoded protein matter.The example of subsidiary gene comprises vif, vpr, vpx, one or more among vpu and the nef.For example can in HIV, find these subsidiary genes (referring to the p 802 and 803 in for example " retrovirus ", Ed.Coffin et al Pub.CSHL 1997).Non--essential subsidiary protein may be brought into play function in the cell type of specialization, provide to small part and cell protein eclipsed function.In general, subsidiary gene is between pol and env, just in time in the downstream of env, comprises the U3 district of LTR, perhaps env and lap each other.

The complexity retrovirus has developed the transcriptional activator of use encoding viral and the regulation mechanism of cell transcription factor.The viral protein of these trans-actings has played the rna transcription activator by the LTR guidance.The trans transcriptional activator of slow virus es is encoded by virogene tat.Tat is connected on the stable stem-ring RNA secondary structure that is called as TAR, and one of function of this structure is Tat obviously to be placed in trans-activation best transcribe on the position.

As previously described, the someone proposes retrovirus to be used for particularly perhaps many NOI being transported to one or several required position as transfer system (another kind of mode is to be expressed as to transmit vehicle or carrier).This transhipment can in body (ex vivo), take place in vivo external, and perhaps the array configuration with them takes place.When using by this way, generally this retrovirus is called retrovirus vector or recombinant retrovirus carrier.Even retrovirus vector exploitation is used to study all respects of retrovirus life cycle, comprise that acceptor uses, reverse transcription and RNA packing (see the commentary of Miller, 1992, Curr TopMicrobiol Immunol 158:1-24).

Be used for the typical recombinant retrovirus carrier of gene therapy, at least can be with gag, one or more part of pol and env protein-coding region is removed from virus.This has this retrovirus vector to duplicate damaged.Even can also replace the part that this removes with NOI, so that produce the virus that its genome conformity can be entered host genome, but wherein modified viral genome can not be bred owing to lack structural protein.After being integrated into host genome, for example NOI begins to express, and produces therapeutic action.Therefore, generally be to reach the purpose that the NOI transhipment is entered desired area: make NOI be integrated into recombinant viral vector by following manner, modified virus vector is packed in the virus particle dressing, and made it to be transduceed in required position, as target cell or target cell group.

By applied in any combination packing or auxiliary cell line and recombinant vectors, might breed and isolate a large amount of retrovirus vectors (retrovirus vector that for example prepares suitable titre), be used for subsequently for example desired area being transduceed.

In some cases, propagation and sepn process may require to isolate the gag of retrovirus, pol and env gene, and their are transduceed separately enter host cell, and produce " package cell line ".This package cell line can produce the needed protein of packing retrovirus DNA, but can not pack owing to lack the psi district.Yet when the recombinant vectors that carries NOI and psi district was entered this package cell line by transduction, accessory protein can be packed the positive recombinant vectors of psi-and produce the recombinant virus original seed.Available its cells infected and NOI is imported the genome of this cell.Recombinant virus is made the required a complete set of gene of viral protein because its genome lacks, and only with infection once, but can not breed.Therefore, NOI is imported the host cell gene group, can not produce may deleterious retrovirus.General introduction about existing package cell line is provided in " retrovirus " (1997, Cold Spring Harbour LaboratoryPress Eds:JM Coffin, SM Hughes, HE Varmus pp 449).But, being in usually in the titre level under the situation of unsatisfactory level, this technology is debatable.Yet, to the design of retrovirus package cell line, be devoted to progressively that early stage design often runs into, particularly the problem of the spontaneous generation of helper virus.Because homology can promote recombination greatly, reduce or eliminate the homology between vector gene group and the helper virus genome, reduced the problem that helper virus produces.

Developed wherein gag recently, pol and env encoding viral district are carried at the packing cell on other expression plasmid of branch, with this expression plasmid individually transfection enter packing cell, like this, need 3 recombination event in order to produce wild-type virus.Sometimes this strategy is called three plasmid transfection methods (Soneoka et al 1995 nucleic acids research 23:628-633).

When carrier forms, also can measure the generation of carrier with the transient transfection method.About this respect, it is the required long time that transient transfection can be avoided to producing stable carrier formation sexual cell, if this carrier or retrovirus packing may pair cell be deleterious, then can use transient transfection.The composition that is generally used for producing retrovirus vector comprises, the proteinic plasmid of coding Gag/Pol, the coding proteinic plasmid of Env and contain the plasmid of NOI.The generation of carrier comprises one or more these composition transient transfections is entered the cell that contains other required composition.If this vector encoded virulent gene or the gene such as cell cycle inhibitor or the apoptosis-induced gene that disturb host cell to duplicate, may be difficult to produce stable carrier so and form clone, but, the transient transfection effect can be used for before necrocytosis, producing this carrier.And, formed several clones with the transient transfection method, can produce and form sexual cell with stable carrier is suitable carrier titre level (Pear et al 1993, PNAS 90:8392-8396).

Therefore in view of the proteic toxicity of some HIV can make it to be difficult to produce the stable packing cell based on HIV, normally be used for preparing the HIV carrier by means of the transient transfection of carrier and helper virus.Some investigators even used the Env protein of vesicular stomatitis virus (VSV) to replace the Env protein of HIV.The Env protein that inserts VSV can improve carrier concn, has for example produced by the transient transfection effect to have 5 * 10 ⁵(after concentrating is 10 to titre ⁸) HIV/VSV-G carrier (Naldini et al 1996, science 272:263-267).Therefore, the transient transfection of HIV carrier may provide a useful strategy (Yee etal 1994 PNAS 91:9564-9568) for producing high titre carrier.But the shortcoming of this method is that VSV-G albumen pair cell is quite poisonous.

Therefore, as noted, retrovirus vector can be widely used in biomedical research and gene therapy.The method that is used to produce retrovirus vector at present is to utilize the following fact: can make genomic two the effect uncoupling of wild-type retrovirus, these two effects are protein coding and as the template of new genome copy (for example Soneoka et al 1995, nucleic acids research 23:628 and reference wherein).The assembling reovirion and is used for enzyme and the required protein of regulatory function, can produce (for example Miller 1990, and the human gene therapy 1,5) by the non-genomic group sequence in the Mammals package cell line for example.A genome sequence that lacks the protein coding function can be provided, can infect with the retrovirus vector particle that causes formation, but can not in target cell, duplicate.Can also design genome sequence is used for transmitting and integral treatment gene (Vile and Russel 1995 Britain's medical science communiques 51,12).For example, be used for producing standard method, comprise the gag-pol of use expression MLV and the clone of env gene (packing composition) based on the carrier of murine leukemia virus (MLV).These compositions will be packed by transduction or with the coexisted retrovirus vector genome of suitable plasmid transfection importing.Another kind method comprises that simultaneously with gag-pol, env and vector gene group plasmid transfection enter suitable cell.

Though the principle to these systems is fully understood, in practice, the viral line system that rebuilds usually can not be created in and be used for the needed a large amount of carrier particles of gene therapy practice.Generally be to gather in the crops the retrovirus vector particle by from the culture of carrier particle generative nature cell, removing supernatant liquor.But the Applied Physics method concentrates the suspension that forms, but can only reach limited degree to carrier particle, because the problem that will occur as solidify and damage.Therefore, only the carrier particle suspension may be concentrated and approximately reach 100 times.

The present invention seeks to provide an improved system, is used for preparing the virion that comes in handy in medical treatment subsequently.

Particularly, the present invention seeks to provide an improved system, is used for preparing the infectious titer particle that comes in handy in medical treatment subsequently.

A first aspect of the present invention has provided a kind of composition, comprises at least a baculovirus composition and at least a retrovirus composition, and retrovirus composition wherein can packagedly enter in the counter-transcription-ing virus particle.

A second aspect of the present invention has provided a kind of composition, and wherein said composition is the baculovirus expression system that contains at least a retrovirus composition, and retrovirus composition wherein can packagedly enter in the counter-transcription-ing virus particle.

A third aspect of the present invention has provided a kind of counter-transcription-ing virus particle that can obtain from the expression of the present composition.

A fourth aspect of the present invention has provided a kind of method, is used to prepare comprise the counter-transcription-ing virus particle of expressing the present composition.

A fifth aspect of the present invention has provided a kind of insect cell that comprises the present composition.

A sixth aspect of the present invention has provided a kind of retroviral vector particles and has produced system, and it contains the composition of the present invention in insect cell.

A seventh aspect of the present invention provides a kind of retroviral vector particles that is produced by retroviral vector particles generation of the present invention system.

A eighth aspect of the present invention provides a kind of expression vector, containing coding has 5 ' and the 3 ' terminal genomic polynucleotide sequence of retrovirus, this retrovirus vector genome can be expressed in baculovirus expression system, and packaged entering in the retroviral vector particles.

Preferably, this retrovirus composition is equivalent to a retrovirus genome.

Preferably, said composition contains the genomic rna transcription initiation site of retrovirus vector, and the nucleotide sequence of the retrovirus composition of wherein encoding is connected in a promotor effectively, this promotor comprises the upstream promoter composition that is positioned at rna transcription initiation site upstream, and the downstream promotor composition that is positioned at rna transcription initiation site downstream.

Preferably this downstream promotor composition is the upstream at the genomic polynucleotide sequence of coding retrovirus vector.

In one embodiment, this promotor bacilliform virus promoter preferably.

Preferably this promotor is the polyhedrin promotor, p10 promotor and/or polh promotor.

In one embodiment, preferably this promotor is non-bacilliform virus promoter.

Preferably, this promotor is T7 promotor or sp6 Salmonellas phage promoter.

Preferably this composition contains at least one RNA cutting composition.

Preferably, will produce retrovirus genome to the control of at least one RNA cutting composition without any the baculovirus composition.

Preferably, at least one RNA cutting composition is between the sequence of promotor and coding retrovirus composition.

In order to cut at 5 of carrier components ' end subsequently, preferably at least one RNA cutting composition is close to the sequence of coding retrovirus vector composition.

Preferably at least one RNA cutting composition is the downstream that is positioned at this retrovirus components series of coding.

In order to cut at 3 of this carrier components ' end subsequently, preferably this RNA cutting composition has a cleavage site, the sequence of this site next-door neighbour's coding retrovirus vector composition.

In order to make it cutting subsequently, preferably at least one RNA cutting composition is the ribozyme cleavage site.

In order to make it cutting subsequently, preferably each RNA cutting composition all is the ribozyme cleavage site.

Each ribozyme cleavage site can be by independent ribozyme cutting from said composition.But preferably, any one or several ribozyme cleavage site can be derived from the ribozyme cutting of second virus composition.

Ribozyme is not have under necessary protein participates in the cell, can bring into play the RNA molecule of catalysis specificity chemical reaction function, and for example, I class ribozyme is a form of taking intron, and this intron can mediate from the RNA precursor excision of self-splicing they self.Other ribozyme is to derive from the necessary self-cutting RNA structure of viral RNA molecular replication.As the protein enzyme, ribozyme can be folded to form secondary and tertiary structure, for substrate and cofactor such as metal ion provide specific binding site.The example of this class formation comprises: the tup type, and hair clip type or stem-ring, false knot, existing people has described hepatitis δ-anti-genome ribozyme.

Every kind of independent ribozyme all has the Sequence of Primitive Elements that can discern and be incorporated into recognition site in the target RNA.This Sequence of Primitive Elements can be taked the form of one or several " brachium conjunctivum ", but generally is the form of double combination arm.In hammerhead ribozyme, this brachium conjunctivum is flanking sequence Helix I and the Helix III that is positioned at Helix II two sides.This sequence can have different length, and each length is 6-10 Nucleotide usually, but can lack a little or long.The length of flanking sequence can influence the speed of cutting.For example find, the sum of Nucleotide in the flanking sequence is reduced to 12 from 20, can make the transformation efficiency of ribozyme cutting HIV sequence increase by 10 times (Goodchild, JVK, 1991, Arch Biochem.Biophys 284:386-391).In hammerhead ribozyme, the catalysis Sequence of Primitive Elements in the ribozyme Helix II is being called the position cutting target RNA of cleavage site.Whether ribozyme can cut any one given RNA, can contain the enzyme existence of suitable cleavage site or not exist recognition site to determine according to this.

Various types of its cleavage sites of ribozyme identification.The hammerhead ribozyme cleavage site has the nucleotide base triplet GUX over against the upstream, is guanine at this G, and U is a uridylic, and X is any nucleotide base.The hair clip type ribozyme has cleavage site BCUGNYR, is any nucleotide base except that VITAMIN B4 at this B, and N is any Nucleotide, and Y is cytosine(Cyt) or thymus pyrimidine, and R is guanine or VITAMIN B4.The cutting that the hair clip type ribozyme causes occurs between the G and N in the cleavage site.

In " molecular biology and biotechnics " (Ed.RA Meyers 1995 VCHPublishers Inc p 831-8320) and " retrovirus " (Ed.JM Coffin et al 1997Cold Spring Harbour Laboratory Press pp 683), can find being described in more detail about ribozyme.

The main aspect of this embodiment of the present invention relates to a composition, and it comprises first virus composition that can obtain from first kind of virus at least, and second virus composition that can obtain from second kind of virus; Wherein first kind of virus is different from second kind of virus; Second virus composition, two sides have two cleavage sites (they can be identical or different sites) at least; The part of at least the second virus composition can be packaged in a kind of virion, and there is not any first virus composition basically in this virion.

At this, preferably at least one cleavage site is the ribozyme cleavage site.

At this, preferably each cleavage site all is the ribozyme cleavage site.

According to this aspect of the invention, this ribozyme cleavage site can be derived from the ribozyme cutting of said composition separately.But preferably, any one or several ribozyme cleavage site can be derived from the ribozyme cutting of second virus composition.

At this, preferred first kind of virus is baculovirus.

At this, preferred second kind of virus is retrovirus.

Preferably, its downstream promotor composition is the sequence that is positioned at coding retrovirus composition.

Preferably, its downstream promotor composition is the sequence that is positioned at the coding retrovirus vector.

Preferably, this retrovirus composition contains a retrovirus Zone R at the arbitrary end of the coding genomic sequence of retrovirus vector, and downstream promotor composition wherein is to be positioned at 5 ' Zone R, and has a corresponding sequence in 3 ' Zone R.

In one embodiment, said composition preferably contains by down direction: a upstream bacilliform virus promoter composition, a downstream bacilliform virus promoter composition, a ribozyme sequence, retrovirus a 5 ' Zone R, a retrovirus U5 district, a retrovirus vector district, being used to insert one or several will be by the gene of this carrier transfer, a retrovirus U3 district, retrovirus a 3 ' Zone R, and one second ribozyme sequence randomly.

In one embodiment, said composition preferably contains by down direction: a upstream bacilliform virus promoter composition, retrovirus a 5 ' Zone R that contains downstream promotor composition, a retrovirus U5 district, a retrovirus vector district is used to insert the gene that one or several will be transmitted by this retrovirus vector, a retrovirus U3 district, retrovirus a 3 ' Zone R, and ribozyme sequence randomly.

Preferably, said composition comprises one or several one or several packing composition of encoding, and is used to produce the nucleotide sequence of retroviral vector particles, and this particle contains the retrovirus composition.

Preferably, this composition also contains at least one nucleotide sequence to be studied (NOI) in addition.

This NOI is preferably useful to medical treatment.

Preferably this NOI is the part of retrovirus composition.

At this noun used " composition ", may comprise an entity (as a kind of composition of material), perhaps two or two above entities according to the present invention.For example, the composition of the present invention first or second aspect may be an entity, and as the baculovirus genome of a modification, wherein the genomic part of this baculovirus has replaced with retrovirus composition of the present invention at least.Noun " modification " comprises the actual modification to the wild type gene group, perhaps from the beginning the adorned entity from the wild type gene group is made up (for example by connecting the segment more than two or two, consequently forming and the corresponding entity of institute's modifying factor group).Further for example, packing composition of the present invention can be included in and be different from the described just now entity.Again for example, composition of the present invention can be the generation body and/or the carrier of counter-transcription-ing virus particle.

Said composition even can be a test kit comprises the first part that comprises the baculovirus composition, and the second section that comprises the retrovirus composition.Randomly, this test kit also may comprise one or more other compositions, as one or more Restriction Enzymes that are fit to etc.

Noun " retrovirus vector genome " comprises the retrovirus nucleic acid that can infect, but this nucleic acid itself can not duplicate.Therefore, it duplicates damaged.The retrovirus vector genome carries, and perhaps can carry the poly nucleotide sequence in non-retrovirus source, so that pass to target cell.The retrovirus vector genome can also comprise other non-retrovirus sequences, and as comprise non-retrovirus control sequence in the U3 district, in case this sequence is be integrated into target cell as provirus, it will influence this genomic expression.This retrovirus vector genome only needn't contain the composition from single retrovirus.For example, WO 96/37623 has described and has derived from two kinds of different retroviruss, has the retrovirus vector of heterozygosis LTRs.

Noun " reverse transcription carrier granule " refers to the retrovirus vector genome of having packed, and preferably it can be incorporated into, and enters target cell.As this vector gene group being discussed, this particulate component may have been modified with respect to the wild-type retrovirus.For example, in order to change its target specificity or, can to carry out genetic modification to the envelope protein in this granule protein matter dressing in order to obtain some other required function.

If this retrovirus composition comprises the env nucleotide sequence, so all or part of of this sequence can be randomly with all or part of replacement of another env nucleotide sequence.Replacing this env gene with heterology env gene, is an example that is called as pseudotyping (pseudotyping) technology or strategy.Pseudotyping is not a kind of new phenomenon, can find example: WO-A-98/05759 in following document, WO-A-98/05754, WO-A-97/17457, WO-A-96/09400, WO-A-91/00047 and Mebatsion et al 1997 cells 90,841-847.

Pseudotyping can make it to have one or several advantage.For example, for lentiviral vectors, be the env gene product of carrier is carrier with HIV, will limit this carrier and only can infect to express and be called the proteinic cell of CD4.But if the env gene in this carrier has used the env sequence from other RNA viruses to replace, they may have the scope that infects widely (Verma andSomia 1997 natural 389:239-242) so.For example, the research worker has made a kind of carrier pseudotyping based on HIV (Verma and Somia1997, the same) that has from the glycoprotein of VSV.

According to the present invention, we are surprised to find, and can produce functional retroviral vector particles in baculovirus expression system, and these particles can successfully be passed to target cell with one or several NOI.

Another significant advantage of the present invention is, and compares in mammlian system, can produce the carrier granule of higher titre.This also is unexpected a discovery.

And, also have additional advantage to be, baculovirus expression system can not have endogenous Mammals genetic material, therefore, has reduced the danger that has the Mammals pollutent in formed retrovirus vector prepared product.About this point, the insect contamination thing does not have biological activity probably in mammlian system, and therefore expection is than the less problem that causes of Mammals pollutent.

As noted, composition of the present invention includes the baculovirus composition.

Briefly, baculovirus is a kind of main diversity virus groups in insect of finding, there are not known arthropod host (O ' Reilly et al rhabdovirus expression vector, laboratory manual, 1994 by inference, the Oxford University Press), they can admit relatively large heterology DNA inset, as NOI of the present invention (O ' Reilly et al rhabdovirus expression vector, laboratory manual, 1994, the Oxford University Press).They have very strong expressing heterologous gene DNA, as the potentiality of NOI of the present invention, have for example reported the expression level that reaches total cell protein matter 25%-50%.

Say to have double-stranded big annular DNA genome in the rod capsid of baculovirus in more detail.In its capsid, the dense nucleoprotein structure that becomes to be called core of gathering of DNA.Capsid adds core and lumps together and be called as nucleocapsid.

The about 80-120 kilobase of the length of baculovirus DNA is to (kbp).Usually be utilized baculovirus as expression vector, autographa california multinuclear polyhedrosis virus (AcMNPV) (Miller et al 1987, genetically engineered vol 8, eds Setler, JK and Hollaender APlenum Press, New York) and the flacherie poison, Bombyx mori nuclear polyhydrosis virus (BmNPV) (Maeda et al 1985, nature 315:592-594), the two all approximately is 130kbp.

Nucleocapsid is to produce in infected cells nuclear, carries out dressing (that is, they obtain film) by means of one of two kinds of modes subsequently.Nucleocapsid can sprout by the plasma membrane of cells infected, perhaps can obtain tunicle in the nuclear that produces them.The nucleocapsid of film dressing is called as virion or virus particle.The plasma membrane virus that forms of sprouting is called as blastogenesis C-type virus C (BV).

In normal course of infection, virus produces the nuclear closed shape, they contain be imbedded in the crystalline protein matrix by the dressing nucleocapsid, the main component of this matrix is the protein that is called polyhedrin of encoding viral.Polyhedrin is the product of baculovirus genome term single gene, produces after infection, and what estimate all protein is to be produced by the insect cell that infects more than 50% or 50%.Transcribing of polyhedron gene (polh) driven by utmost point promoters active, and therefore, it is fit closely as driving the alien gene expression promoter.If this polyhedron gene is replaced by external gene, also can produce the protein output of similar level.Therefore, the structure of expression vector is included in external encoding sequence of just in time downstream part insertion of polyhedrin promotor.But, can't directly reach this purpose because viral DNA huge (about 130kbp) make it can not external simply the operation (Old and Primose 1989 " Principles of gene manipulation " 4th Ed.Blackwell Scientific Publicarions pp 290-291).

Insect baculovirus expression system provides an eucaryon environment, and promptly needed suitably folding to some eukaryotic protein biologic activity, disulfide linkage forms, oligomeric turn into and/or other posttranslational modification, generally be favourable.The posttranslational modification of having reported that takes place in the insect cell of baculovirus infection comprises: signal cutting, proteolysis cutting, N-glycosylation; the O-glycosylation, acylation, amidation; phosphorylation, isoprenylation effect, and carboxylation.The site of these modifications is to the protein that produces in insect and mammalian cell, usually in identical position (O ' Reilly et al is the same).

Favourable characteristics of rhabdovirus expression vector are to have very strong expressing heterologous gene DNA-as the potentiality of NOI of the present invention.The high expression level of having reported with rhabdovirus expression vector is the 25%-50% of total cell protein matter.This level is equal to the expression level of polh gene (polyhedrin), is equivalent to the about 1 gram protein of per 109 cells (for example 1 liter of culture).

But not every heterologous protein can both be producing with the same level of polyhedrin, and, only be issued to level near total cell protein matter 25% in a few cases.Relating to other virus family expression of structural gene in most cases, its product is very stable.Most of heterologous proteins are with 10mg-100mg/10 ⁹The level of cell produces.Yet under the situation that different eukaryotic expression systems is compared, gross protein generation aspect rhabdovirus system is better than other expression system usually.

Therefore, from aspect widely, the invention provides a kind of production equipment (for example a kind of container that is used to produce a large amount of NOI or its expression product, perhaps or even a kind of organism or its cell), wherein this device comprises a kind of substratum, and this substratum contains the baculovirus composition of a kind of NOI of comprising.Preferably, this baculovirus composition composition that is first aspect present invention.

Use very late promoter (for example polh and p10 promotor), for the expression system of doing the basis with baculovirus provides remarkable advantages, this promotor is to be activated in unique latent period of virus replication and to be transcribed consumingly.Because phase when being different from the late period that comprises BV formation this latent period so the expression minimally of heterology gene DNA such as NOI of the present invention disturbs the generation of BV, and has very little selection pressure to virus to the sudden change of heterology genetically deficient or inactivation.

Very late period, expressional function was for the heterology gene DNA, may be particularly advantageous as the expression of NOI of the present invention, and cell function such as cell toxicant gene product that this heterology is expressed necessity have destruction.When the very late period of virus infection mutually in the negative effect of expressing gene be, in the time of late mutually in, it seems that the modification ability after the cell translation can descend.

The rod nucleocapsid of baculovirus can provide holds bigger viral DNA genome, and baculovirus vector may hold 100kbp or the above additional DNA of 100kbp probably.The gene dosage that available baculovirus vector system is expressed simultaneously also may be very high.But, in order to form very large insertion, may make up a series of transferring plasmids, make and might construct insertion in the mode that increases continuously.This restriction with in the fragility of external big DNA direct relation is arranged, and irrelevant with carrier system itself, equally, more than 3, need additional transferring plasmid so as gene to be expressed.

All characteristic baculovirus very late gene all is non-montage, but can express effectively.Therefore, this rhabdovirus system is effective especially to the cDNA gene of expressing non-montage.But baculovirus expression system really can be realized some montage at least, and has noticed that it is in the purposes of identifying and obtain specific gene product from multigene family.

Therefore, from an aspect widely, the invention provides and utilize the baculovirus composition to express the NOI that contains at least one intron.Preferably, this baculovirus composition is a kind of composition according to first aspect present invention.

Baculovirus vector is a helper-dependent, so use fairly simple.Compare with the high expression level recombined eukaryotic cell system that makes up a clone, the baculovirus that makes up reorganization is quite quick and easy.

Though use based on AcMNPV and to use the basic fundamental based on the carrier of BmNPV be that similarly the system that is based on AcNPV has many advantages for most of common application.Compare with the clone of supporting BmNPV to duplicate, the clone of supporting AcMNPV to duplicate is more superior aspect growth characteristics and expression level.In addition, compare, can be used for based on the scope of the transferring plasmid of AcMNPV system and parent virus much bigger with system based on BmNPV.And it is favourable using the carrier based on AcMNPN of genetic modification, because it only duplicates in insect cell, and can carry big insertion (greater than 15kb) (Boyce and Butcher 1996PNAS 93:2348-2352).

The more frequent clone of using with the carrier based on AcNPV is fall army worm (SF) clone, because they are fully measured, has remarkable growth and performance characteristic.Reported this cell and can produce some protein with about 20% or above level of total cell protein matter, any other general available clone can not provide than the doubly proteinic output of this Senior Three, use SF clone, IPBL-SF 21 AE strains (Vaughn etal (1997) as SF clone, in vitro tests, 13, be particularly preferred 213-217).Derived cell is that Sf9 or Sf8 also may be preferred.But, can also use other clone, as Tricoplusia ni 386 (Kurstack and Marmorosch (1976) invertebral zooblast is cultivated in medical science, the application in biology and the agricultural, Academic Press, New York, USA).These clones, and be suitable for other insect cell line of the present invention such as pBCC4-1are can buy (for example from Stratagene, La Jolla, CA, USA and Novagen).

Though infer the carrier based on AcMNPV, its host specificity is to be confined to arthropods, prove that reorganization AcMNPV virus can infect multiple mammal cell line (Boyceand Butcher 1996 PNAS 93:2348-2352).Do not resemble retrovirus and adenovirus carrier, can not make it special infected liver, having shown proves that the AcMNPV of genetic modification baculovirus has strong taxis (Sandig et al 1996 people's genes treatment 7:1937-1945, Hofmann et al 1995 PNAS 92:10099-10103) to liver cell.

Generally replace NOI is imported the baculovirus genome by allelotrope.Replace strategy according to allelotrope, alien gene is inserted in the transferring plasmid, cause it to be positioned at the downstream of required viral promotors, two sides have and will make this gene and promotor be oriented to the virus sequence of specific region in this viral genome.This plasmid and parent viral DNA cotransfection are entered host cell, and the enzyme in the cell is recombinated to this DNA.This process mainly comprises the plasmid DNA district of alien gene flank and the homologous recombination between their the homology counterpart in viral genome.

In baculovirus expression system, can use " late period " and " in early days " promotor.Polh and p10 promotor are the strong promoter examples of expressing at later period of infection.Although identified many to transcribing the virogene product (Hasnain et al 1997 gene 190:113-118) that has significance,, for these promotors to the still insufficient at present understanding of the regulating effect of transcribing.Drive the promotor of genetic expression in early days in course of infection, also be considered to be used for the promotor of the non-toxic protein that the cell at baculovirus infection slowly forms.Baculovirus expression system also has as the outstanding operating records of non-expressing fusion protein gene (just, use natural translation initiation codon and N-end sequence expressing gene), but, can reach higher level to some protein expression because merge.

Knownly insect baculovirus expression system has been used to produce retrovirus sample particle (VLP) and (has for example consulted Gheysen et al, 1989 cells 59,103; Morikawaet al, 1991 virusology, 183,288; Griffiths et al, 1993 Journal of Virologies, 67,3191; Sommerfelt et al, 1993 virusology, 192,298).This insect rhabdovirus system has been widely used in analyzing the Gag assembly reaction, and many observations of being done are relevant with the generation gene therapy vector.The coexpression of proteolytic enzyme and pol gene (using the gag-pol construction) causes this virion maturation, and whole functional Gag and Pol antigen (Konvalinka et al, 1995, European biochemical magazine, 228,191 are provided in last virion; Wagner et al, 1992, virusology archives 127,117).And the envelope antigen that is present in VLP-express cell surface also mixes into VLP (Yamshchikovet al, 1995, virusology 214,50; Garnier et al, 1995, Journal of Virology 69,4060).

But, should be noted that VLP does not have virus genomic protein particulate.Therefore, the VLP right and wrong are infective, lack to duplicate desired virus (or other DNA/RNA).VLP does not duplicate in host cell really.The sheep test shows that compare with subunit vaccine (virus protein) or by the virus that chemical deactivation kills, VLPs has stronger immunogenicity.In addition, they are for bringing out body fluid, cell-mediated and mucosal immunity is also more effective.The production of VLP and operation also are safe.The baculovirus vector and the host cell that are used to prepare VLPs are not to be produced by the Mammals source.Therefore they do not contain pathogenic agent (the Roy.P.1996 Inter Virology 39:62-71 in Mammals source.Referring to OBM 10 spec text page2, lines 20-30 and page 3, lines 1-10).

And as if prove that single gag expression of gene is enough for the requirement that satisfy to form retrovirus VLP, the amount of the retrovirus VLP that is produced is directly proportional with the expression level of the gag of coding precursor protein matter.Therefore, do not have the sprout secondary modification of process of any restriction retrovirus VLP, and the output of VLP surpasses the level of the baculovirus that produces.

WO 95/22617 once advised using rhabdovirus system and produced retrovirus vector, but importantly, it does not point out to reach any method of this purpose.

Therefore, although some observationss relevant with retrovirus protein are arranged, although and existing available data in the document in the past few years,, never rhabdovirus system was used to produce retrovirus vector in the past.One of its reason is when successfully having produced the protein component of retrovirus in insect rhabdovirus system, fails to foresee and can satisfy the requirement of functional retroviral vector particles.These requirements comprise that package carrier genome correctly, and the ability of the carrier granule target cell infection that forms and former viral integrase enter the ability of target cell.Special consider it is to need vector gene groups, it can carry out becoming from RNA the accurate reverse transcription of proviral DNA in target cell, and can produce and can successfully be integrated into the genomic proviral DNA of target cell.This requires this RNA to contain required initiation of suitable reverse transcription and the (commentary of Luciw and Leung: retrovirus of other recognition site, Ed.J.A.Levy 1992Plenum), and require this DNA product to have the necessary end sequence of the integration of realization (commentary of Luciw and Leung, Op.cit; Cannon et al, 1996, Journal of Virology 70,8234).In addition, the provirus that is integrated must contain necessary for gene expression control composition in integration process subsequently.

Result of the present invention is very astonishing, because baculovirus expression system has some abnormal feature, makes it design to the baculovirus vector that is used to produce retrovirus vector and has been far from directly and works as.The bacilliform virus promoter composition that its validity part needs is downstream (Posse and Howard, 1987, nucleic acids research, 15,10233 that are positioned at the rna transcription initiation site; Rankin et al, 1988, gene 70,39; Oni et al, 1989, molecular biology magazine, 210,721).This means in order to transcribe (this requirement provides high titre carrier) retrovirus vector genome effectively and must have the baculovirus sequence at its 5 ' end.For reverse transcription and integration, need specificity retrovirus end sequence, then having this non-retrovirus sequence is undesirable in principle, and can expect to disturb the function of normal reverse transcription vector gene group.

As noted, the present invention is by providing baculovirus expression system, is used to produce retrovirus vector and/or counter-transcription-ing virus particle (it may work as carrier) and overcome technical problem in the past.

That produce by composition of the present invention or from the counter-transcription-ing virus particle (also can be expressed as " counter-transcription-ing virus particle carrier ") of the present composition, can be used for external one or several NOI being passed to cell in vivo, particularly transmit the NOIs that therapeutic activity is arranged.One or several selected NOIs can be mixed the vector gene group and in target cell, express.This NOI may have one or several himself expression control sequenc, perhaps can be by their expression of carrier LTR control.For the NOI that expresses properly, can in LTRs or between it, comprise promotor, this promotor is under certain conditions, perhaps preferably has activity in some cell type.This NOI has adopted sequence or antisense sequences.And if multiple NOI is arranged, these NOI have adopted sequence or antisense sequences so, or their combination.

In the preferred case, retrovirus vector genome of the present invention generally can be included in 5 ' and 3 ' terminal LTR, one or several NOI (including the gene and/or the marker gene of therapeutic activity), the suitable insertion site that perhaps is used to insert one or several NOI.In some cases, having packaging signal makes genome become carrier granule in production cell internal packing.Even also have suitable primer binding site and integration site, but make the vector rna reverse transcription become DNA, and proviral DNA is integrated into the genome of target cell.In preferred embodiments, this retroviral vector particles has reverse transcription system (reverse transcription of coupling and primer binding site) and integration system (intergrase of coupling and integration site).

According to the present invention, might operate this viral genome or retrovirus vector nucleotide sequence, so that available one or several NOI replaces or replenish the gene of virus.NOI may be the gene of any or several selections, marker gene and therapeutic genes.Successfully multiple different suitable marker is used for retrovirus vector.At " retrovirus " (1997 ColdSpring Harbour Laboratory Press Eds:JM Coffin, SM Hughes, HEVarmus pp 444) this marker is evaluated, this marker comprises, but be not limited to, give bacterium Xin Meisu and hygromycin phosphotransferase gene respectively G 418 and hygromycin resistance; Give mutant mice dihydrofolate reductase gene to the methotrexate resistance; Cell can be grown in contain mycophenolic acid, the bacterium gpt gene of growing in the substratum of xanthine and aminopterin-induced syndrome can be grown cell not having Histidine but contain in the substratum of histidinol; Give multi-drug resistance gene (mdr) to multiple drug resistance; And give bacterial gene to tetracycline or phleomycin resistance.All these markers are that dominance is selected, and make it to carry out chemistry selection to the cell that majority is expressed these genes.

Composition of the present invention can be used for particularly medical use, uses as diagnosis or treatment.

Therefore, according to the present invention, NOI can be that a therapeutic genes-its connotation is that this gene itself may can bring out therapeutic action, and perhaps it can be encoded and can bring out the product of therapeutic action.

The limiting examples of therapeutic NOIs comprises the gene of the following material of encoding: tumor suppressor protein, cytokine, antiviral protein, immune modulatory molecules, antibody, Engineering immunoglobulin-like molecule, fused protein, hormone, membranin, vasoactive albumen or peptide, somatomedin, ribozyme, sense-rna, enzyme, prodrug such as prodrug activity enzyme, cytotoxic agent, and enzyme inhibitors.

The example of prodrug is including, but not limited to etoposide phosphoric acid salt (using together with alkaline phosphatase), 5-fluoro cytosine(Cyt) (using together) with the cytosine(Cyt) deamidase, Doxorubin-N-para hydroxybenzene oxygen yl acetamide (same penicillin-V-Ntn hydrolase uses together); Two (2-chloroethyl) the ammonia benzyl glutaminates (using together) of right-N-with carboxypeptidase G 2; Cynnematin mustargen carbamate (using together) with the beta-lactam enzyme; SR 4233 (using together) with p 450 reductase enzymes; Gancyclovir (using together) with the HSV thymidine kinase; Mustard seed prodrug (using together), and endoxan or ifosfamide (using together) with cytopigment p 450 with nitroreductase.

The disease that may treat is including, but not limited to cancer, heart trouble, apoplexy, neurodegenerative disease, sacroiliitis, virus infection, infectation of bacteria, parasitic infection, disease of immune system, virus infection, tumour, blood coagulation disease, and heredopathia-as chronic granuloma, Lescg-Hyhan syndromes, Parkinson's disease, pyothorax (empysema), pku, sicklemia, α-Di Zhonghaipinxue disease, β-thalassemia, Gaucher disease.

Use target cell that the reverse transcription carrier carries out gene therapy including, but not limited to hematopoietic cell (comprising monocyte, scavenger cell, lymphocyte, granulocyte, the perhaps any precursory cell of these cells); Endotheliocyte, tumour cell, stroma cell, stellate cell, or spongiocyte, muscle cell, epithelial cell, neurone, inoblast, liver cell, stellate cell, and pneumonocyte.

In retrovirus vector of the present invention, one or several NOIs can transcribing under the control at viral LTR.Alternatively, for the purpose that realizes that higher level is expressed, can there be the array configuration of enhanser-promotor composition.This promoter-enhancer composition preferably has strong activity, perhaps can be induced consumingly in target cell.An example of strong active promoter-enhancer combination be people's cytomegalovirus (HCMV) main in early stage (MIE) promotor/enhanser combination.The activity of this promoter-enhancer combination may be that tissue or sequential are restrictive.The example of the tissue limitations promoter-enhancer combination that is fit to is that those have highly active combination in tumour cell, as the promoter-enhancer combination from MUC1 gene or CEA gene.

Hypoxemia or local asphyxia regulatable expression are also particularly useful in some cases.Hypoxemia all is the strong conditioning agent of genetic expression to extensive dissimilar cell, and be by inducing bringing out property of hypoxemia transcription factor such as hypoxemia to bring out sex factor-1 (HIF-1) work (Wang andSemenza 1993 PNAS (USA) 90:430), this brings out sex factor and is incorporated into relevant DNA recognition site, i.e. hypoxemia response element (HRE) on the range gene promotor.Will be from the HRE polymer form of mouse phosphoglyceric kinase-1 (PGK-1) gene, be used for controlling people's myofibroma cell external and in vivo the reaction of solid tumor hypoxemia to the expression of marker gene and therapeutic gene (Firth et al 1994, PNAS 91 (14): 6496-6500; Dachs et al 1997 Nature Med, 5:515).On the other hand, in the fact that the zone of ischemia of tumour also exists glucose to lack, can be used to activate heterology gene DNA-as NOI-of the present invention specific expressed in tumour.632 base-pair sequences having found the brachymemma of grp 78 gene promoters drive the reporter gene high level expression in vivo in the mouse tumour, known can shortage by glucose of this sequence and specificity activates (Gazit et al 1995 cancer research 55:1660).

In order to be used for gene therapy subsequently, reverse transcription vector gene group of the present invention preferably contains the promising necessary minimum retrovirus material of function vector of bringing into play effectively.The purpose of doing like this is in order to reserve the space for mixing of NOI (s), and also for the reason of safety.Owing to there is not the functioning gene of one or several structure by gag-pol and env coded by said gene of coding (or packing) composition, the retrovirus vector genome preferably duplicates damaged property.Required the lacking composition and can provide by trans in producing cell of particle is provided.Do not exist the virus structure composition to mean that also the undesirable immunne response that is produced can reduce or avoid in this genome, these are replied is virus at expressing in target cell.And when using in the plan body, the venereal disease of preferably should avoiding infection poison particle has the possibility of reconstruction.Therefore, preferably should the virus structure composition be excluded this genome, in order that reduce the chance that any success is recombinated as far as possible far.

Retroviral vector particles of the present invention generally is to produce in suitable production cell.

Therefore, the invention still further relates to a kind of production cell that comprises the present composition.

Producing cell may be a kind of packing cell, and it contains and normally is be integrated into its genomic viral structural gene.Infective in order to produce then, duplicate damaged property carrier granule this packing cell of nucleic acid transfection with this vector gene group of coding.By another kind of method, the nucleotide sequence of this vector gene group of available code and constituent, and/or same this production cell of nucleotide sequence cotransfection that is present on one or more following expression vectors: plasmid, adenovirus carrier, herpesvirus vector, vaccinia virus vector, perhaps any known method that the functional DNA transmission can be entered target cell.

The production cell that is fit to comprises insect cell and mammalian cell, but also can be other cell that is fit to.Preferably this production cell is an insect cell.

The present invention also provides a kind of pharmaceutical composition by gene therapy treatment patient, and wherein said composition comprises the present composition of treat effective dose, perhaps by the said composition generation, or from the virion of said composition.This pharmaceutical composition can be used for the human or animal.Usually, the physician can determine the optimal exact dosage desired to a certain patient, and this dosage will be with the age, the reaction of body weight and given patient and changing.

Said composition also can randomly comprise carrier, thinner, vehicle or the adjuvant that pharmaceutics allows.Can select medicament carrier, vehicle or thinner according to the pharmaceutics rules of route of administration of planning to adopt and standard.Except carrier, outside vehicle or the thinner, this pharmaceutical composition can also comprise any suitable tackiness agent, lubricant, suspensoid, Drug coating, solvating agent and other can help or increase the delivery agent (for example lipid delivery system) that this virus enters the target site.

In appropriate circumstances, this pharmaceutical composition can be by following any or several mode administrations: suck, form with suppository or vaginal suppository, with lotion, solution, the form topical of emulsifiable paste or pulvis, use by skin patch, oral with the tablet form that contains vehicle such as starch or lactose, perhaps with separately or with the form of the capsule or the ovulum (ovule) of mixed with excipients, perhaps to contain the elixir of perfume compound or tinting material, the form of solution or suspension, perhaps can be with they non-enteron aisle drug administration by injection, for example intracavitary administration, intravenous injection, intramuscularly or subcutaneous injection.For drug administration by injection, this composition can preferably use with the form of aseptic aqueous solution, and this solution can contain some other material such as enough salt or monose, and this solution and blood etc. are opened.In order to contain clothes or sublingual administration, this composition can be with the tablet of ordinary method preparation or the form administration of lozenge.

On the one hand, the invention provides an expression vector, it contains coding and has 5 ' polynucleotide sequence of and 3 ' terminal reverse transcription vector gene group, and this reverse transcription vector gene group can be expressed in baculovirus expression system and be packed and be entered in the reverse transcription carrier granule.Therefore, 5 ' and 3 ' terminally can bring into play function in reverse transcription with in integrating.

Described three schemes at this, be used to overcome the problem of bacilliform virus promoter with rna transcription initiation site upstream and downstream composition.These three schemes are displayed among Fig. 1-3.

(see figure 1) in the first string is the downstream composition with this promotor, mixes its Zone R (being called as 5 ' Zone R) at the upstream termination of coding retrovirus vector genome sequence.So just make the rna transcription initiation site directly be placed in the front of coding retrovirus vector genome sequence.If counterpart with this promotor downstream composition, downstream end at coding retrovirus vector genome sequence also mixes this Zone R (being called as 3 ' Zone R), make these two Zone Rs the vector rna genome is transformed into the dna virus precursor, this vector gene group will correctly be brought into play function identical or closely similarly.

(see figure 2) in second scheme is to make a sequence that can be cut in rna transcription, is included in this carrier between the sequence of bacilliform virus promoter and coding reverse transcription vector gene group.In case produced initial rna transcription, therefore the downstream composition of bacilliform virus promoter can be cut.Preferably, cleavage site is that the sequence of this reverse transcription vector gene group of next-door neighbour's coding exists, and causes having produced the appropriate carriers genome.Ribozyme is can realize this function and can be fabricated the RNA enzyme that enters DNA construct.The 26S Proteasome Structure and Function of suitable ribozyme has been carried out sufficient research (for example Cech 1992 Curr.Op.Struct.Biol.2,605), and example comprises hammerhead ribozyme, the anti-genome ribozyme of hair clip ribozyme and hepatitis δ.Inclusion as RNA cutting sequence ribozyme sequence has a cleavage site at the genomic sequence end of coding retrovirus vector, and this inclusion can be used for whole transcripts are supplied with terminal complete RNA.Each molecule of being transcribed all will contain ribozyme sequence, and the independent cutting in cis just can be satisfied the requirement that each ribozyme produces correct template.

(see figure 3) in the 3rd scheme has been used non-bacilliform virus promoter.The promotor example that is fit to comprises T7 phage promoter and sp6 Salmonellas phage promoter.For the T7 promotor, the terminal G residue of 5 ' Zone R accurately can be placed in the transcription initiation site of T7 promotor, so that in the retrovirus vector genome, produce 5 a real ' terminal residue.For example need to provide the source (Polkinghorn and Roy 1995 nucleic acids research 23,188) of T7 polysaccharase by the recombinant baculovirus of an expression T7 polysaccharase.

Preferably, coding retrovirus vector genomic expression vector is a rhabdovirus expression vector, and promptly one based on the genomic carrier of recombinant baculovirus.In general, virus vector is than the easy operation of non-virus carrier.For example, and compare, can realize virus vector shifted entering cell more reliably with DNA plasmid transfection cell.But press on the other hand, this expression vector can be non-rhabdovirus expression vector, perhaps is non-virus expression carrier such as DNA plasmid.

In according to above-mentioned three schemes, in one of any expression vector, may there be a RNA cutting sequence that is positioned at the sequence downstream of this retrovirus vector of coding, so that guarantee correctly to stop rna transcription and for the 3 correct ' end of vector gene group.In order to cut at this genomic 3 ' end, preferably this cutting sequence has a cleavage site, the genomic sequence of its next-door neighbour's this retrovirus vector of coding.Ribozyme can provide suitable RNA cutting sequence, as discussing at this.Ribozyme may be in 5 of ribozyme sequence ' or 3 ' and end has a cleavage site.Therefore, when all there was ribozyme in the two ends of this vector gene group, they were normally different.For example, hammerhead ribozyme cuts the right side of itself, therefore is suitable for 5 ' end of this vector gene group, yet the hair clip type ribozyme cuts its left side, and is suitable for 3 ' end of this vector gene group.

Another aspect of the present invention provides retroviral vector particles to produce system, and it comprises described herein, the expression vector in insect cell, and the retroviral vector particles that produces of system thus.

In order to produce the reverse transcription carrier granule, also need to provide the packing composition.Gag-pol and env that they normally can provide on one or several expression vector that is fit to.This expression vector or carrier must be expressed this packing composition in baculovirus expression system.Therefore, this packing composition will be under the expression control of one or several bacilliform virus promoter.Carry preferably rhabdovirus expression vector of this expression vector of packing composition or carrier.The another kind of selection be, they can right and wrong baculovirus or non-virus expression carrier, as plasmid.Some or all pack composition, can be used as the retrovirus vector genome and are provided on identical expression vector.

Be suitable for rhabdovirus system of the present invention and obtain easily, and be well known in the art.O ' Reilly etc. 1994 (Op.cit) have done detailed description to rhabdovirus expression vector.The autographa california nucleopolyhedrosis virus (AcMNPV) that a kind of baculovirus that is suitable for recombination bacillary viral vector is fully studied.The recombinant baculovirus such as the pBAC4 x-1 (Novagen) that can use market to buy.PBAC4 x-1 contains four and inserts the site, and may be built into the nucleotide sequence of admitting coding retrovirus vector genome and packing composition.Similarly, it also is well known in the art being suitable for bacilliform virus promoter of the present invention.Normally used bacilliform virus promoter is polyhedrin and p10 promotor.The dna sequence dna of polyhedrin promotor is displayed among Figure 18.The present invention also comprises the mutant of this sequence, varient, homologue or segment.

The noun " varient " relevant with the nucleotide sequence of code book invention preferred enzyme, " homologue " or " segment " comprises, to (or several) nucleic acid, carry out any replacement from its sequence or to its sequence, variation is modified, replace, deletion or increase provides nucleotide sequence consequent, that coding maybe can be encoded promotor, preferably can resemble biologically active the sequence shown among Figure 18 at least.Particularly, " homologue " is meant that structure and/or function homology make the nucleotide sequence coded promotor of maybe can encoding of gained.With regard to the homology of sequence, preferably the homology with the shown sequence of SEQ ID NO.1 is at least 75%, more preferably is at least 85%, more preferably at least 90%.Preferably be with Figure 18 in the homology of shown sequence be at least 95%, more preferably be at least 98%.

Particularly noun " homology " (homology) can be equal to noun " homogeny " as used herein.Can determine the relative homology (being the sequence homogeny) of sequence by means of the computer program of buying, this program can be calculated the percent homology between two or the several sequence.A representative instance of this computer program is CLUSTAL.

These nouns " varient ", the allelic variation synonym of " homologue " or " segment " and sequence.

Sequence complementary sequence with this nucleotide sequence hybridization that provides that can coexist also is provided noun " varient ".Preferably, this noun " varient " comprises with this nucleotides sequence that provides that can coexist and being listed under the stringent condition sequence complementary sequence that (for example 65 ℃ and 0.1 * SSC{1 * SSC=0.15M NaCl, 0.015 trisodium citrate pH 7.0}) hybridizes.

The invention still further relates to can be with the nucleotide sequence of nucleotide sequence of the present invention (complementary sequence of this sequence that provides is provided) hybridization.Preferred aspect is, the present invention relates to be listed under the stringent condition with nucleotides sequence of the present invention (nucleotide sequence of 65 ℃ and 0.1 * SSC) hybridization for example, the sequence that this nucleotide sequence that provides (complementary sequence of this sequence that provides is provided) that coexists is hybridized.

According to the present invention, can also use other bacilliform virus promoter, and the mutant of this promotor, varient, homologue or fragment.

The insect cell line that uses with expression vector of the present invention also easily obtains.One of example is the sf8 insect cell line.It is compatible mutually requiring insect cell that is adopted and the special expression carrier of selecting for use.Insect cell need support to encode the duplicating of expression vector of reverse transcription vector gene group supported the retrovirus vector genomic expression.The clone that some glycosylation lacks may be particularly suitable for, because glycosylation is different between Mammals and the insect cell system.Estimate that glycosylation difference can not have problems; Clinical use-case, as be used in the clinical trial that the HIV gp 120 that produces in the insect cell done and show that the difference of any secondary modification is all nonsensical.

Can be used for retrovirus type of the present invention and be not limited to any specific retrovirus.Carcinogenic retrovirus (Oncoretrovirnses) is as mouse C-C-type virus C MLV, perhaps slow virus such as HIV, and retrovirus of perhaps knowing such as ASLV, SNV and RSV can use.The present invention can use the retrovirus vector based on slow virus especially, because they are difficult to produce high titre.The titre of lentiviral vectors usually than mouse carrier as low two orders of magnitude of MLV (for example Naldini et al.1996, Science 272,263).In addition, because can in baculovirus expression system, produce retrovirus RNA so effectively, so that might from the retrovirus vector genome, omit slow virus composition such as HIV Rev and RRE (Gheysenet al.1989 Op.cit.) (in the document of being quoted).It is favourable avoiding unnecessary retrovirus composition in retrovirus vector, particularly when using HIV, or during other slow virus, because these compositions have side effect.

To the present invention be described by embodiment below, and with reference to following accompanying drawing-wherein:

Fig. 1 is the signal schematic diagram; Fig. 2 is the signal schematic diagram; Fig. 3 is the signal schematic diagram; Fig. 4 is the signal schematic diagram; Fig. 5 is the signal schematic diagram; Fig. 6 is the signal schematic diagram; Fig. 7 is the signal schematic diagram; Fig. 8 is the signal schematic diagram; Fig. 9 is the signal schematic diagram; Figure 10 is the signal schematic diagram; Figure 11 is the signal schematic diagram; Figure 12 is the signal schematic diagram; Figure 13 is the signal schematic diagram; Figure 14 is the signal schematic diagram; Figure 15 is the signal schematic diagram; Figure 16 is the signal schematic diagram; Figure 17 is the signal schematic diagram; Figure 18 is the signal schematic diagram; Figure 19 is the signal schematic diagram; Figure 20 is the signal schematic diagram; Figure 21 is the signal schematic diagram; Figure 22 is the signal schematic diagram; Figure 23 is the signal schematic diagram; Figure 24 is the signal schematic diagram; Figure 25 is the signal schematic diagram; Figure 26 is the signal schematic diagram; Figure 27 is the signal schematic diagram; Figure 28 is the signal schematic diagram; With Figure 29 is to illustrate schematic diagram.Fig. 1,2,3 and 18 mentioned in the above.

Embodiment 1 is MLV gag-pol and tunicle expression of gene in baculovirus expression system

This strategy is at first the tunicle sequence to be inserted among the pBAC4x-1 (Novagen), inserts MLV gag-pol sequence subsequently, will at first rebuild this sequence in pBlusecript (Stratagene).

A) Env expresses (close preferendum MLV or VSV G)

Isolate the EcoRI fragment that contains complete env sequence from pHIT 123 (Soneoka et al Op.cit), be used for close preferendum MLV tunicle sequence.Isolate the EcoRI fragment from pHCMV-G (Yee etal, 1994 PNAS 91,9564) equally, be used for the VSV-G sequence.Then these fragments are inserted the EcoRI site (Fig. 4) of pBAC4x-1 (Novagen) respectively, produced pBAC4-env-e and pBAC4-env-v.By similar method, use the technology that the recombinant DNA field is known, any virus can be inserted in this carrier by membrane gene.By membrane gene may comprise from any retrovirus by membrane gene, or from any other viral gene, this virus can pseudotyping or is impregnated on the contrary into from the particle that retrovirus gag-pol gene produces.

B) in pBluescript, rebuild MLV gag-pol (Fig. 5)

Produced 5 ' and 3 ' fragment (seeing the primer table) by PCR from pgagpolgpt (Markowitz et al 1988, Journal of Virology 62,1120).5 ' fragment amplification is to the XhoI site, and forms KpnI and NotI site in the starting point of this encoding sequence, produced the fragment of a 940bp.3 ' fragment is expanded to the end of pol encoding sequence from the SphI site of gag-pol sequence, produces the fragment of a 700bp.Formed the EcoRI site at these segmental two ends, and the NotI site consequently when rebuilding complete gag-pol sequence, can be passed through to digest its excision with NotI only at 3 ' end, and it be inserted among the pBAC4x-1 (Novagen) in this NotI site.

5 ' segment is inserted into the KpnI/XhoI site among the pBluescript, and 3 ' segment is inserted into the EcoRI site.

From above-mentioned plasmid, excise XhoI-SphI fragment (30 bp) then, and use XhoI-SphI fragment (3580bp) to substitute,, form pBluescript-gagpol so that in pBluescript, rebuild complete gag-pol sequence from pgagpolgpt.

C) MLV gag-pol sequence is inserted pBAC4-env and formed pBAC4-gagpolenv (Fig. 6)

From pBluescript-gagpol, isolate and contain gag-pol sequence of N otI fragment, and be inserted into respectively pBAC4-env-e and-the NotI site of v, form pBAC4mgagpol-env-v, be used for MLV by membranous type and VSV-G type.

Can use the standard method described in O ' Reilly et al (Op.cit), these plasmids are used as baculovirus transfer vector.The virus formulation that produces is hereinafter referred to as bBAC4mgagpol-env-e and bBAC4mgagpol-env-v.When this virus is used for infected insect cell such as sf8 cell, can produce a large amount of VLPs.Embodiment 2 uses the vector gene group (Fig. 3 and 7) of T7 scheme expression based on MLV

In this embodiment, be to express this vector gene group from the plasmid that will be used for transient expression system.This genome can be from being expressed as the recombinant baculovirus of gag-pol and env gene.

To insert pEc-Hd (Polkinghorn 1996 D.Phil.Thesis, Oxford University) in the EagI/SmeI site from the MLV genome of pLZSN (Adams et al, 1991, Journal of Virology 65,4985).The genome that is placed into this carrier has following structure:

By pcr amplification this is genomic 5 ' and 3 ' end, be placed on the upstream that 5 ' Zone R is right after to cause the T7 promoter sequence.3 ' end is expanded to the end of 3 ' R sequence, produces a flush end product, make it will accurately be blended in hepatitis δ-anti-genome ribozyme Sequence of Primitive Elements.Proofread and correct polysaccharase with one and be used for PCR, so that produce the flush end product.

By PCR this genomic 5 ' end is expanded to EagI site in the packaging signal.Produce an additional EagI site, the EagI site that is used for inserting pEc-Hd in 5 ' end just in time.With this genomic 3 ' end, the least significant end of R sequence so far increases from the SmaI site in 3 ' R sequence.

At first 3 ' fragment is inserted pEc-Hd (the SmaI site will can not produce at 3 ' least significant end again) in the SmaI site, then 5 ' fragment is inserted the EagI site.

With above-mentioned SmaI fragment excision, and use SmaI fragment to substitute, produce pEc-Hd-LZSN from pLZSN.By means of the program of standard, same expression cassette can be fit in the baculovirus transfer vector that has gag-pol and env sequence.

Available plasmid pEc-Hd-LZSN transfection sf 21 cells, this cell are with the Bac-T7 coinfection of bBAC4mgagpol-env-e or bBAC4mgagpol-env-v and expression T7 polysaccharase.In these cells, whole compositions of retrovirus vector all can be expressed, and like this, can measure the generation of functional carrier.The generation of the functional carrier of high titre can be with the lacZ transgenosis to target cell.Be used for MLV gag-pol, the primer that env and VSV-G make up is for the MLV gag-pol sequence that increases:

5 ' fragment

Forward (35 MER NOTFOR)

5′-CGG? GGTACC? GCGGCCGC?ATGGGCCAGACTGTTACC-3

Kpn NotI

Oppositely (22 MER XHOREV)

5′-GGGCG? CTCGAG?GGGAAAAGCGG-3′

XhoI

3 ' fragment

Forward (27 MER SPHFOR)

5′-CCG? GAATTC? GCATGC?CTCAGGTATTGG-3

EcoRI?SphI

Oppositely (33 MER NOTREV)

5′-TTT? GAATTC? GCGGCCGC?TTAGGGGGCCTCGCGG-3′

EcoRI NotI is for amplification gene group (pLZSN):

5 ' fragment

Forward (44 MER EAGFOR) 5 '-GCG CGGCCG TAATACGACTCACTATAGCGCCAGTCTTCCGATAG-3 '

EagI T7 promotor

Oppositely (18 MER EAGREV)

5′-TTG? CGGCCG?GGTGTTCAG-3′

EagI

3 ' fragment

Forward (20 MER SMAFOR)

5′-TCG? CCCGGG?TACCCGTGTAT-3′

SmaI

Oppositely (22 MER SMAREV)

5 '-TGCAACTGCAAGAGGGTTTATT-3 ' embodiment 3 expresses HIV gag-pol and VSV-G (Fig. 8) in baculovirus expression system

The source of HIV gag-pol sequence is plasmid pRV 664.This be one from pWI 3 (Kim et al, 1989, Journal of Virology 63,3708) gagpol vif expression plasmid.By flat endization StyI/StyI fragment (7720-8050), the RRE of pWI3 (Genbank preserve number: U 26942) is inserted among the pBluescript KS+ (Stratagene) of SmaI incision, thus generation pBSRRE.The NarI/EcoRI fragment (637-5743) of pW13 is inserted among the pBSRRE that cuts with ClaI and EcoRI, constituted pBSGPRRE1.XhoI/NotI fragment (containing gagpol and RRE) is inserted among the expression plasmid pCI-Neo, constituted pGR-RRE1.

Isolate the 5.6kb XhoI-NotI fragment that contains HIV gag-pol sequence from pRV 664, and equal endization with the Klenow fragment of dna polymerase i.Then this fragment is inserted the SmaI site of pBAC4-env-v, produced pBAC4hgagpol-env-v.Can according to use this plasmid in the identical method of plasmid described in the embodiment 1.Embodiment 4 uses the vector gene group (Fig. 3 and 9-12) of T7 scheme expression based on HIV

Has as shown in Figure 9 structure from the genome of pH4nZ.Produce as follows.By making ClaI site (829) equal endization,, produce phase shift mutation from HIVgpt (Page et al, 1990, Journal of Virology 64,5270) preparation HIVdge.Use BglII and PstI (473-1414) to cut HIVdge then, and insert among the pTIN 406 (Cannon et alOp.cti).PTIN 406 has CMV, the LTR structure of R (HIV) and U5 (MLV).This has just produced one and has contained CMV and R and from the heterozygosis LTR of the U5 of HIV, be called as pBS5 '.For Rev and RRE being provided for this plasmid, can cut EcoRI/XhoI fragment (5743-8897) from HIVdge1.2, this HIVdge 1.2 is the HIVdge derivatives that contain from NdeI to BglII (6403-7621) disappearance, and is inserted into pBS5 ' and has formed pBS5 ' R.Can be by the NotI/XhoI fragment of pBS3 ' be inserted pBS5 ' R, form pH2 and 3 ' LTR is provided.The XhoI/HindIII fragment that can connect pWI 3 by three kinds of approach, the HindIII/KpnI fragment of pTIN 408 (Cannon et al.Op.cit) and the pBluescript KS+ that cuts with XhoI/KpnI, and form pBS3 '.To insert unique XhoI site of the pH2CMV of pH2 preparation from the CMV promoter fragment (SalI/XhoI) of pSPCMV.Produced pSPCMV by inserting among the pSP72 (Promega) from the PstI/HindIII fragment of pLNCX (Genbank preserve number: M 28246).To insert pSP72 (XhoI/SphI) from the beta-galactosidase gene of pTIN 414 (Cannon et al Op.cit) and constitute pSPlacZ.Digest pSPlacZ with XhoI/SalI, obtain the beta-galactosidase enzymes coding region, it is inserted pH2-CMV and obtains pH3Z.In order to produce the carrier of tat-disappearance, can make up pH4Z.Can remove 50 bp of tat-coding region by substitute EcoRI (5743) the I-SpeI fragment among the pH3 with EcoRI (5881)-SpeI PCR product of using following PCR primer amplification, obtain pH4.

DELT5 (5 '-CGTGAATTCGCCTAAAACTGCTTGTACCA-3 ') and

DELT3(5′-GAACTAATGACCCCGTAATTG-3′)

To insert pH3Z and produce pH4Z from the NsiI/SpeI fragment of pH4.

For 5 of amplification gene group ' and 3 ' end be used for baculovirus expression, implemented two PCR reaction.Rebuild complete genome by inserting the intervening sequence of omitting subsequently.PCR reaction is 3 ' sequence for the amplification gene group.ScaI site in 3 ' U3 sequence is changed over the SmaI site, and be expanded to the least significant end of R sequence.This change has caused three base-pair mutations, but can not influence integration.Produced the flush end product of 900bp with the correction polysaccharase.Then this product is inserted the SmaI site (Figure 10) of pEc-Hd.Like this, destroyed the SmaI site at the contact place of R sequence and pEc-Hd.

At first from the starting point of R sequence amplification 5 ' sequence, until first EcoRI sequence that is arranged in packaging signal.Produced the fragment of a 900bp like this.The EagI site is placed on two ends of this product, and the XhoI site is at this segmental 5 ' least significant end.Again with in the XhoI-EcoRI site of this product insertion pBluescript KS (Stratageme) (Figure 11).

In pH4nZ, isolate and cross over EcoRI site and the sequence of SpeI site (in the CMV promotor) and the EcoRI-SpeI site of inserting above-mentioned plasmid.

From pBluescript KS, isolate the EagI-SpeI fragment that contains genome sequence then, and it is inserted in the EagI-SpeI site of pEc-Hd (Figure 12).

At last, by inserting the SpeI-SmaI site of pEc-Hd, produce pEc-Hd-H4nZ and be reconstructed into complete genome from the isolated SpeI-ScaI fragment of pH4nZ.Can this plasmid be used for pEc-Hd-LZSN by similar method, but in order to produce the retrovirus vector based on HIV with very high titre, baculovirus vector is from pBAC4hgagpol-env-v.Embodiment 5 expresses EIAV gag-pol and VSV-G (Figure 13) in rhabdovirus system

Starting molecule is pSPEIAV19 (AC:U01866), and it is the provirus clone of ELAV.By cutting pSPEIAV19 in the tunicle district with HindIII (5835/6571), make the cutting of tunicle coding region, self connects and generation pSPEIAV19dH.Produced a tunicle loss property provirus clone like this.Use MluI (216/8124) to cut pSPEIAV19dH then, and the fragment that forms is inserted the pCI-Neo (Promega) that cuts with MluI (216) and constituted pONY3.

From comprising EIAV gag-pol, isolate the MluI fragment among the pONY3 of tat and rev encoding sequence, and equal endization with the Klenow fragment of dna polymerase i.Then it is inserted pBAC4-VSVenv (flush end) in the SmaI site, produce pBAC4gagpol-env-v.By being similar to the method described in the embodiment 1, formed the recombinant baculovirus that will produce high-level EIAVVLP with this plasmid.Embodiment 6 uses the vector gene group (Fig. 3 and 14-17) of T7 scheme expression based on EIAV

The genome of plasmid pONY 2.1nlslacZ has structure as shown in Figure 14.Can by following structure it.Use the pfu polysaccharase, with following primer, the 5 ' LTR that EIAV is cloned pSPEIAV19 carries out pcr amplification:

5′GCATGGACCTGTGGGGTTTTTATGAGG

3′GCATGAGCTCTGTAGGATCTCGAACAGAC

Mend the flat endization of flat fragment with this amplification by 5 ' protuberance, and be inserted among the pBluescript II KS+, it cuts with Bss HII, and equals endization by removing of 3 ' protuberance.This construct is called as pONY1, orientation be with respect to the beta-galactosidase enzymes of pBluescript II KS+ from 5 ' to 3 '.The sequence of pONY1 does not show any sudden change.Cut pSPEIAV19dH with MluI (216/8124), and this fragment is inserted the pONY1 (216) that is cut by MluI, form pONY2.With Bss HII pBluescript II KS+ is digested (619/792), obtain multiple clone site.Mend by 5 ' protuberance flat with flat endization of this fragment, and with is connected with the pONY2 that NcoI (1901/4949) cuts with BglII, put down quilt by 5 ' protuberance benefit again and equal endization.Orientation be with respect to the EIAV sequence from 3 ' to 5 '.This plasmid is called pONY 2.1.By will (Genbank preserves number: Psti/HindIII fragment M28246) be inserted pSP72 (Promega), produces plasmid pSPCMV from pLNCX.To insert the pSP72 that cuts with XhoI and SphI from the beta-galactosidase gene of pTIN 414 (in the document that Cannon et al is quoted), form pSPlacZ.Use the 5 ' end that replaces beta-galactosidase gene from the SV40 T antigen nuclear localization signal of pAD.RSVBgal (Bloggs et al, 1992 Journal of Clinical Investigations 90,629).Cut pAD.RSVbgal with XhoI/ClaI, this fragment is inserted the pSPlacZ that XhoI/ClaI cuts, form pSPnlslacZ.To comprise the PstI fragment of the CMV promotor that drives the lacZ gene from pSPnlslacZ, insert the PstI site of pONY 2.1 according to 5 of EIAV ' to 3 ' orientation.It is named the 2.1nlslacZ into pONY.

Make template with pONY 2.1nlslacZ then, carry out secondary PCR reaction, so that increase that this is genomic 5 ' and 3 ' end, be used for the baculovirus expression box.Subsequently, by inserting the intervening sequence of omitting, be reconstructed into complete genome.

With proofreading and correct this 3 ' PCR product of polymeric enzymatic amplification, the SmaI site from the env sequence is expanded to the least significant end of R sequence, produces the product of flat endization.Then this product is inserted the SmaI site of pEc-Hd.Just in time lost SmaI site (Figure 15) at 3 ' end.

Isolate the SmaI fragment that comprises CMVnlslacZ from pONY 2.1nlslacZ, and it is inserted SmaI site (Figure 16).

This 5 ' PCR product that increases, the EagI site in MCS, and in the 5 ' terminal EagI site that adds.Then this product is inserted the EagI site,, thereby produced pEc-Hd-ONY 2.1nlslacZ so that rebuild the pONY genome (Figure 17) among the pEc-Hd.According to being similar to the method described in embodiment 2 and 4, this plasmid is used together with pBAC4egagpol-env-v, produce the carrier based on EIAV of high titre.Embodiment 7 uses the vector gene group (Fig. 1,18 and 19) of R-district metathetical scheme expression based on MLV.

The genomic plasmid of LZSN retrovirus vector that includes from pplyhedrin promotor (the document that O ' Reill et al is quoted) expression is named into pBHLZSN (Figure 19).By this plasmid of following program construction: the starting template that is used for a series of PCR reactions is pHIT111 (Soneoka et al is in 1996 documents of being quoted).In order to produce the PCR product that is shown as PCR:A (Figure 19), in reaction A, produced the 5 ' LTR that contains the polyhedrin promotor with the PCR primer.Second reaction (B) produced and PCR:A eclipsed fragment.In addition, reaction C produces a combination fragment with SalI and HindIII cutting.Then the fragment that is produced is inserted among the pBluescript KS+, produced plasmid pBHR (Figure 18).In order in the new Zone R that makes up, to make up the 3 ' LTR that has suitable polyhedrin promotor composition, PCR reaction D and E (Figure 19) have been carried out.Product with these reactions has produced combination PCR product (PCR:F) then, cuts this product with XbeI and NotI, and the fragment that forms is inserted among the pBHR, constitutes pBHU3HR (Figure 19).A last step is by with SpeI and XbaI incision pHIT111, inserts the LZSN inner area from pHIT111, and the fragment that generates is inserted among the pBHU3HR that cuts with identical enzyme (Figure 19).

For making up the primer that pBHLZSN is used for the PCR reaction: A.5 ' primer (polyhA5)-TACT GTCGACATA ACC ATC TCG CAAATA AAT (add bottom line=SalI); 3 ' primer (PolyhA3)-CAG TCT ATCGGA AGA CTG GCG CT ATT TAT AGG TTT TTT TATB.5 ' primer (polyhB5)-ATA AAA AAA CCT ATA AAT AGC GCCAG TCT TCC GAT AGA CTG; 3 ' primer (polyhB3)-GCTA AAGCTTTCC GCC AGA TAC AGA FCT (add bottom line=Hind III) C. is with primer polyhA5 and polyhB3, together with PCR product A and B, obtain 5 ' LTR heterozygote (polyderin.R) D.5 ' primer (polyhD5)-AGTT TCTAGAGAA CCA TCA GAT GTTTCC AGG (add bottom line=Xba I); 3 ' primer (polyhD3)-TAC AAA ACTGTT ACG AAA ACA GTA AAA TAC TT C CCG AGT GAG GGG TTGTGGE.5 ' primer (polyhE5)-TTC GTA ACA GTT TTG TAA TAA AAAAAC CTA TAA ATA GCG CCA GTC CTC CGA TTG; 3 ' primer (polyhE3)-GATC GCGGCCGCAAT GAA AGA CCC CCG CTG (add bottom line=Not I) F. is with primer polyhD5 and polyhE3, together with PCR product D and E, obtain 3 ' LTR heterozygote (U3.polyherin.R) embodiment 8 and use the vector gene group of R-district replacement scenario expression based on EIAV

Call pBONY2.1nlslacZ containing the genomic plasmid of pONY 2.1nlslacZ retrovirus vector, and this genome is from having suitable R-district metathetical polyhedrin promoter expression.By this plasmid of following program construction: the starting template that is used for a series of PCR reactions is pONY 2.1nlslacZ (seeing embodiment 6 and GB number of patent application 9727135.7 and GB number of patent application 9711578.6).In order to produce the PCR product that is shown as PCR:AE, in reaction AE, made the 5 ' LTR that contains the polyhedrin promotor with the PCR primer.Second reaction (BE) made and PCR:AE eclipsed fragment.React CE in addition and produced a combination fragment with SalI and HindIII cutting.Then the fragment that produces is inserted among the pBluescript KS+, formed plasmid pBEHR.In order in the new Zone R that makes up, to make up 3 ' LTR, PCR reaction DE and EE have been carried out with suitable polyhedrin promotor composition.Produce combination PCR product (PCR:FE) with these reaction product then, cut this product, the fragment that forms is inserted among the pBEHR, produced pBEHU3HR with XbaI and NotI.Final step is by cutting the inner area of inserting pONY 2.1nlslacZ with NarI and NspV, and the fragment that forms is inserted with among the pBEHU3HR of identical enzyme incision (note of face and Figure 20 as follows).Plasmid pBONY 2.1nlslacZ can be used with pBAC4gagpol-env-v, produce the carrier based on EIAV (also can with reference to Figure 21) of high titre.Make up pONY 2.1nlslacZA.5 ' primer (polyhAE3) TACT GTCGACATA ACC ATC TCG CAA ATA AAT (add bottom line=SalI) 3 ' primer (polyhAE3) AGA CCG CAG AAT CTG AGT GCCC T ATT TAT AGG TTT TTTTAT

This PCR product will provide the polyhedrin that has part R promotor.B.5 ' primer (polyhBE5) ATA AAA AAA CCT ATA AAT AGG GCA CTC AGA TTC TGC GGTCTG3 ' primer (polyhBE3) ACTG AAGCTT CAG GTC CCT GTT CG GGCGCCA ACT G (italic=Hind III, add bottom line=Nar I)

This PCR will provide the polyhedrin that has R part.C.

With primer polyAE5 and polyhBE3,, obtain 5 ' LTR heterozygote (polydrin.R) together with PCR product A E and BE

After cutting, it is inserted among the pBluescript KS+II, be called pBEHR with SalI and HindIII.

3 ' LTR (U3. polyhedrin .R.U5).D. in U3 to R, still comprise the polyhedrin promotor.5 ' primer (polyhDE5) CTG TCTAGAA GA TTCGAA GCG AAG GAGGAAA C... (add bottom line=3 ' primer (PolyhDE3) TAC AAA ACT GTT ACG AAA ACA GAT AAA TAC TTATTGTCAGAATACAAGCACT of Xba I. italic=NspV)

This PCR will provide the U3 that has part polyhedrin promotor.E.R to U5 has polyhedrin promotor 5 ' primer (polyhEE5) TTCGTA ACA GTT TTG TAA TAA AAA AAC CTA TAA ATAGGCACTCAGATTCTGCGGTC3 ' primer (polyhEE3) GATC GCGGCCGCCTGTAGGATCTCGAACAGACAAAC (add bottom line=Not I)

This PCR will provide the part polyhedrin that has R promotor.F.

With primer polyhDE5 and polyhEE3,, obtain 3 ' LTR heterozygote (U3. polyhedrin .R) together with PCR product D E and EE.

After cutting, it is inserted among the pBEHR, be called pBEHRU3HR with XbaI and NotI.G.

Cut pONY 2.1nlslacZ with NarI and NspV, obtain the fragment of 7.8kb,, it is inserted among the pBEHRU3HR, form pBEHONYnlslacZ by NarI and NspV.Embodiment 9 uses the vector gene group of R-district replacement scenario expression based on HIV

To comprise from the genomic plasmid of pH4Z retrovirus vector of polyhedrin promoter expression and be called pBH4Z.By this plasmid of following program construction: the starting template that is used for a series of PCR reactions is that pH4Z (sees PCT/GB 97/02857 and GB number of patent application: 9711578.6).In reaction AH, form the 5 ' LTR that contains the polyhedrin promotor with the PCR primer, so that produce the PCR product that is shown as PCR:AH.Second reaction (BH) produced one and PCR:AH eclipsed fragment.React C in addition and produced the combination fragment of cutting with SalI and HindIII.Then the fragment of this generation is inserted pBluescript KS+, produce plasmid pBHHR.In order in the new Zone R that makes up, to make up the 3 ' LTR that has suitable polyhedrin promotor composition, PCR reaction DH and EH have been carried out.Product with these reactions has produced combination PCR product (PCR:FH) then, cuts this product with XbaI and NotI, and the fragment that produces is inserted among the pBHHR, constitutes pBHHU3HR.A last step is by cutting the inner area of inserting pH4Z with NarI and SphI, and the fragment that forms is inserted with among the pBHHU3HR of same enzyme incision (note of face and Figure 22 as follows).Plasmid pBH4Z can be used together with pBAC4hagapol-env-v, produce the carrier based on HIV (can also with reference to Figure 23) of high titre.Make up pBH4ZA.5 ' primer (polyhAH5) TACT GTCGACATA ACC ATC TCG CAA ATA AAT (add bottom line=SalI) 3 ' primer (PolyhAH3) AGA CCG CAG AAT CTG AGT GCCC T ATT TAT AGG TTT TTTTAT

This PCR product will provide the polyhedrin promotor that has the R part.B.5 ' primer (polyhBH5) ATA AAA AAA CCT ATA AAT AGG GCA CTC AGA TTC TGC GGTCTG3 ' primer (polyhBH3) ACTG AAGCTT GGT CCC TGT TCG GGCGCCAC (italic=HindIII, add bottom line=NarI)

This PCR will provide the part that has R polyhedrin.C.

With primer polyhAH5 and polyBH3, together with PCR product A H and BH, obtain 5 ' LTR heterozygote (polyderin.R) and it is inserted among the pBluescript KS+II by cutting with SalI and HhidIII, be called pBHHR.

3 ' LTR (U3. polyhedrin .R.U5).D. in U3 to R, still comprise polyhedrin promotor 5 ' primer (polyhDH5) GATC TCTAGAA AAGCATGCCTGCAGGTCGAGGTCGAT... (add bottom line=XbaI, 3 ' primer (PolyhDH3) TAC AAA ACT GTT ACG AAA ACA GTA AAA TAC TT AGT ACAGGC AAA AAG CAG CTG C of italic=SphI)

This PCR will provide the U3 that has polyhedrin promotor part.E.R to U5 has polyhedrin promotor 5 ' primer (polyEH5) TTCGTA ACA GTT TTG TAA TAA AAA AAC CTA TAA ATAGGGTCTCTCTGGTTAGAC3 ' primer (polyhEH3) GATC GCGGCCGCTGC TAG AGA TTT TCC ACA CTG (add bottom line=NotI)

This PCR will provide the part polyhedrin that has R promotor.F.

With primer polyDH5 and polyhEH3,, obtain 3 ' LTR heterozygote (U3. polyhedrin .R) together with PCR product D H and EH

By cutting it is inserted among the pBHHR, be called pBHHRU3HR with XbaI and NotI.G.

Cut pH4Z with NarI and SphI, obtain the fragment of 6.7kb, it is inserted among the pBHHRU3HR, constitute pBH4Z by means of NarI and NspV.Embodiment 10 is from the functional MLV of polyhedrin promoter expression, EIAV and HIV vector gene group: binuclear enzymes patterning method

Be to realize this scheme, so that they can delete the 5 ' polyhedrin sequence of itself from the transcript that is attached thereto by means of comprising tup forming core enzyme in the design of polyhedrin promoter sequence downstream.Figure 24, how the synoptic diagram graphic extension in 25 and 26 makes it to reach and is respectively applied for MLV, the purpose of ELAV and HIV carrier.

This scheme is identical in whole three examples, just in order to mate MLV, EIAV and HIV complementary R sequence separately, the spiral 1 sequence difference of ribozyme.When cutting with ribozyme in indicated position, the rna transcription thing of formation is in its 5th initial terminal correct R sequence that now comprised.

To sketch successively below be used for making up these based on self-each clone's scheme of the retrovirus genome expression vector of cutting polyhedrin promotor.Every kind of carrier can be used from the retrovirus vector prepared product that produces high titre with its homologous gagpol and env expression system one.In addition, can insert in the baculovirus vector by means of the program of standard genomic expression box them.(i) make up carrier based on MLV:

With primer polyhAM5 and polyhAM3 (see Figure 27-and following notes comment) be used for 5 ' LTR of pcr amplification pEc-Hd-LZSN, so that the change that will need (polyhedrin promotor/ribozyme sequence adds flushing 5 ' R sequence) is mixed in the PCR fragment, the clone enters among the pEc-Hd-LZSN by means of EcoRI-SpeI digestion with this fragment then, produces final carrier-pBHz-Hd-aR.Make up pBHz-H δ-α R5 ' primer (polyhAM5) actg GaattcATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATA AAAAAACCTATAAATA GGACTGGCGC CTGATGAGCGGCCGAAAGCCCGCGAAACCTGCGTCGACACGCAGGTC GCGCCAGTCCTCCGATTGACTGAGTC (add bottom line=EcoRI site) 3 ' primer (polyhAM3) GTTAGCTA ACTAGTACAGACGCAG (add bottom line=SpeI)

This PCR will provide polyhedrin, hammerhead ribozyme, MSV Zone R, U5 and leader sequence.

Can this fragment cloning be entered among the pEc-Hd-LISN at EcoRI and SpeI site, obtain pBHz-H δ-α RLZSN.(ii) make up carrier based on EIAV:

With primer polyhAEM5 and polyhAEM3 (see Figure 28-and following notes comment) be used for 5 ' LTR of pcr amplification pEc-Hd-ONY 2.1nlslacZ, so that the change that will need (polyhedrin promotor/ribozyme sequence adds flushing 5 ' R sequence) is mixed in the PCR fragment, the clone enters among the pEc-Hd-ONY 2.1nlslacZ by means of Eag1 digestion with this fragment then, produces final carrier-pBEHz-H δ-α R.Make up pBEHz-H δ-α R5 ' primer (polyhAEM5) actg CggccgATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATA AAAAAACCTATAAATA CTGAGTGCCC CTGATGAGCGGCCGAAAGCCCGCGAAACCTGCGTCGACACGCAGGTCGGGCACTCA GATTCTGCGGTCTG (add bottom line=Eag I site) 3 ' primer (polyhAEM3) CTAGTTCTAGAG CGGCCGCCAC (add bottom line=Eag I)

This PCR will provide polyhedrin, hammerhead ribozyme, EIAV Zone R, U5 and leader sequence.

Can this fragment be inserted among the pEc-Hd-ONY 2.1nlslacZ at Eag I and Eag I site, obtain pBEHz-H δ-α R.(iii) make up carrier based on HIV

With primer polyhAHM5 and polyhAHM3 (see Figure 29-and following notes comment) be used for 5 ' LTR of pcr amplification pEc-Hd-H4nZ, so that needed change (polyhedrin promotor/ribozyme sequence adds flushing 5 ' R sequence) is mixed in the PCR fragment, then this fragment is entered among the pEc-Hd-H4nZ by means of Eag I-Nar I digestion clone, produce final carrier-pBHHz-H δ-α R.Make up pBHHz-H δ-α R5 ' primer (polyhAHM5) ACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTAT

Hammerhead ribozyme AAATA AGAGAGACCC CTGATGAGCGGCCGAAAGCCCGCGAAACCTGCGTCGACACGCAGGTCGGGTCTCTC TGGTTAGACCAGATC... (add bottom line=Eag I site) 3 ' primer (polyhAHM3) CCCTGTTCG GGCGCCACTGC (add bottom line=Nar I)

This PCR will provide polyhedrin, hammerhead ribozyme, HIV Zone R, U5 and leader sequence.

This fragment can be inserted among the pEc-Hd-H4nZ at Eag I and Nar I site, be constituted pBHHz-H δ-α RLZSN.Summary

Therefore, the invention provides a novel system that is used to produce retroviral vector particles.In highly preferred embodiment, this novel system is to use the genomic rhabdovirus expression vector of coding retrovirus vector.In another embodiment preferred, the invention provides a kind of rhabdovirus expression vector of the reverse transcription vector gene group of encoding, and it is offered the retroviral vector particles that is produced by novel system of the present invention.

All documents of quoting in describing in detail in the above all are introduced into as a reference at this.According to content of the present invention and marrow, for those skilled in the art, the various modifications and variations forms that form the method for the invention and system will be conspicuous.Though in conjunction with specific preferred embodiment the present invention is discussed, it should be understood that protection scope of the present invention will be not limited to these specific embodiments.Really, be regarded as within the following claim scope in order to realize various modification of the present invention, for the technician in molecular biology or relevant field, these modification also are conspicuous.

Claims (40)

1. a composition comprises at least a baculovirus composition and at least a retrovirus composition, and retrovirus wherein becomes and can packagedly enter in the counter-transcription-ing virus particle.

2. composition, wherein said composition is the baculovirus expression system that contains at least a retrovirus composition, retrovirus composition wherein can packagedly enter in the counter-transcription-ing virus particle.

3. claim 1 or 2 composition, retrovirus composition wherein is equivalent to a retrovirus genome.

4. one of any composition in the top claim, wherein said composition contains the genomic rna transcription initiation site of retrovirus vector, and the nucleotide sequence of the retrovirus composition of wherein encoding is connected in a promotor effectively, this promotor comprises the upstream promoter composition that is positioned at rna transcription initiation site upstream, and the downstream promotor composition that is positioned at rna transcription initiation site downstream.

5. the composition of claim 4, downstream promotor composition wherein are the upstreams at the polynucleotide sequence of coding reverse transcription vector gene group.

6. claim 4 or 5 composition, promotor wherein is a bacilliform virus promoter.

7. the composition of claim 6, promotor wherein is polyhedrin promotor and/or p10 promotor and/or polh promotor.

8. one of any composition among the claim 1-5, promotor right and wrong-bacilliform virus promoter wherein.

9. the composition of claim 8, promotor wherein is T7 promotor or sp6 Salmonellas phage promoter.

10. one of any composition in the top claim, wherein said composition contains at least one RNA cutting composition.

11. the composition of claim 10, wherein at least one RNA cutting composition will produce the retrovirus genome without any the baculovirus composition.

12. the composition of claim 11, when one of any, wherein at least one RNA cutting composition is between the sequence of promotor and coding retrovirus composition in being subordinated to claim 4-9.

13. the composition of claim 12 is wherein in order to cut the sequence of at least one RNA cutting composition next-door neighbour coding retrovirus vector composition subsequently at 5 of carrier components ' end.

14. one of any composition among the claim 4-13, wherein at least one RNA cutting composition is the downstream that is positioned at coding retrovirus components series.

15. the composition of claim 14, wherein in order to cut at 3 of carrier components ' end subsequently, this RNA cutting composition has the cleavage site of the sequence of next-door neighbour's coding retrovirus vector composition.

16. one of any composition among the claim 4-15, wherein for its cutting subsequently, at least one RNA cutting composition is the sequence that can be discerned by ribozyme.

17. one of any composition among the claim 4-15, wherein for its cutting subsequently, each RNA cutting composition all is the sequence that can be discerned by ribozyme.

18. one of any composition among the claim 4-17, downstream promotor composition wherein is to be positioned within the sequence of coding retrovirus composition.

19. the composition of claim 18, downstream promotor composition wherein are to be positioned within the sequence of coding retrovirus vector.

20. the composition of claim 19, retrovirus composition wherein at genomic sequence one end of coding retrovirus vector, contains a Zone R, downstream promotor composition wherein is to be positioned at 5 ' Zone R, and has a corresponding sequence in 3 ' Zone R.

21. one of any composition in the top claim, wherein said composition contains by down direction: a upstream bacilliform virus promoter composition, a downstream bacilliform virus promoter composition, a ribozyme sequence, retrovirus a 5 ' Zone R, a retrovirus U5 district, a retrovirus vector district, being used to insert one or several will be by the gene of this carrier transfer, a retrovirus U3 district, retrovirus a 3 ' Zone R, and one second ribozyme preface randomly.

22. one of any composition in the top claim, wherein said composition contains by down direction: a upstream bacilliform virus promoter composition, retrovirus a 5 ' Zone R that contains downstream promotor composition, a retrovirus U5 district, a retrovirus vector district is used to insert the gene that one or several will be transmitted by this retrovirus vector, a retrovirus U3 district, retrovirus a 3 ' Zone R, and ribozyme sequence randomly.

23. one of any composition in the top claim, wherein said composition comprises one or several one or several packing composition of encoding, is used to produce the nucleotide sequence of retroviral vector particles, and this particle contains the retrovirus composition.

24. one of any composition in the top claim, wherein said composition also contains at least one nucleotide sequence to be studied (NOI) in addition.

25. the composition of claim 24, NOI wherein is useful to medical treatment.

26. the composition of claim 24 or 25, NOI wherein are the parts of retrovirus composition.

27. a counter-transcription-ing virus particle can obtain by expressing composition one of any in the top claim.

28. a method for preparing counter-transcription-ing virus particle comprises above expressing composition one of any in the claim.

29. an insect cell comprises one of any composition of top claim.

30. a retroviral vector particles produces system, is included in to contain composition one of any in the top claim in a kind of insect cell.

31. a retroviral vector particles is to be produced by the retroviral vector particles generation system of claim 30.

32. expression vector that contains a polynucleotide sequence, this polynucleotide sequence coding has 5 ' and 3 ' terminal retrovirus vector genome, this retrovirus genome can be expressed in baculovirus expression system, and is packaged in the retroviral vector particles.

33. a composition comprises first virus composition that can obtain from first kind of virus at least, and second virus composition that can obtain from second kind of virus; Wherein first kind of virus is different from second kind of virus; The second virus composition flank has two cleavage sites (they can be sites identical or inequality) at least; At least a portion of second virus composition can be packaged in a kind of virion; There is not any first virus composition basically in this virion.

34. the composition of claim 33, wherein at least one cleavage site is the ribozyme cleavage site.

35. the composition of claim 34, wherein each cleavage site all is the ribozyme cleavage site.

36. one of any composition among the claim 33-35, first virus wherein is baculovirus.

37. one of any composition among the claim 33-36, second virus wherein is retrovirus.

38. a baculovirus composition contains purposes among the NOI of at least one intron in expression.

39. a production equipment that is used to produce a large amount of NOI or its expression product, wherein this production equipment comprises a kind of substratum, and this substratum contains the baculovirus composition of a kind of NOI of comprising.

40. one kind as described herein basically and with reference to the composition of accompanying drawing.

Images