CN1258538C - Recombinant protein - Google Patents
Recombinant protein Download PDFInfo
- Publication number
- CN1258538C CN1258538C CN 200310122418 CN200310122418A CN1258538C CN 1258538 C CN1258538 C CN 1258538C CN 200310122418 CN200310122418 CN 200310122418 CN 200310122418 A CN200310122418 A CN 200310122418A CN 1258538 C CN1258538 C CN 1258538C
- Authority
- CN
- China
- Prior art keywords
- sars
- protein
- recombinant protein
- thr
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The present invention relates to a recombinant protein which is a protein with 345 to 655 amino acid sequences of an S protein of SARS viruses, or a protein whose one or more amino acid residue in the amino acid sequences is replaced or deleted or added, wherein the functions of the protein with one or more replace or deleted or added amino acid residue are the same as those of the protein with 345 to 655 amino acid sequences of an S protein of SARS viruses. The recombinant protein is a functional structure area for SARS viruses to identify host cell surface receptors. The present invention can be used as antigens for SARS viruses, or can be used for preparing SARS vaccines or medicine for treating SARS, and can be used for preparing reagents for diagnosing SARS.
Description
Technical field
The present invention relates to a kind of recombinant protein, specifically relate to the recombinant protein of the poverty-stricken syndromes of a kind of serious acute respiratory (SARS) virus, and in preparation SARS vaccine and the purposes for preparing in prevention, the treatment SARS medicine.
Technical background
The poverty-stricken syndromes of serious acute respiratory (hereinafter to be referred as SARS) is a kind of newfound acute infectious disease.Up to now, the whole world has had 8450 people to catch an illness, 810 people's death.Find that now the pathogenic agent that causes SARS is a kind of newfound coronavirus, this virus is named as SARS virus.
Before current SARS is popular, it is found that can infect human coronavirus has only two kinds of HCV-229E and HCV-OC43, mankind's flu of 15-30% is caused by these two kinds of coronavirus.By dna homolog relatively, it is found that the homology of SARS virus and HCV-229e and HCV-OC43 is about 30%.
Experiment showed, that coronavirus is generally the strand positive chain RNA virus, the S albumen of its coding (spike albumen) can with corresponding receptors bind, thereby the mediation virus enter host cell.Therefore the S albumen difference of different coronavirus coding can discern the corresponding acceptor of specific species cell, optionally infects the cell of specific species then, is the characteristics of all coronavirus.The genome of virus must could form complete infective virion that has by after encoding viral albumen such as the S albumen packing in host cell.In the wrapping process of SARS virus, the S albumen of its coding may reside in the tenuigenin of host cell.
After the known infective virus; the intravital immunity system of people can produce the immunne response at the various compositions of virus; comprise humoral immunoresponse(HI) and cellullar immunologic response; it is generally acknowledged; wherein can discern the specific antibody of virus surface and host cell receptor binding molecule, can the blocking virus host cells infected, so this antibody-like is also referred to as protection antibody; be the important indicator of judging body opposing virus infection ability and estimating the vaccine provide protection, as the antibody of resistance of hepatitis B surface antigen.To studies show that of coronavirus infection, discern segmental property antibody blocking virus host cells infected specifically at acceptor on the coronavirus S albumen, be a kind of main protection antibody.Also not at the specific medicament of coronavirus infection, the generation of protection antibody is the main mechanism of the recovery from illness behind patient's coronavirus infection at present, and therefore, protection antibody also is an important indicator of judging that the state of an illness lapses to.Because the difference of acceptor recognition sequence on the S albumen of coronavirus; have very high specificity at the proteic protection antibody of various coronavirus S, can only protect human body not to be subjected to the infection of virus of the same race and can not protect human body to avoid the infection of other coronavirus at the protection antibody of a kind of coronavirus.
Recombinant protein vaccine is a kind of artificial vaccine that both can be used for the prophylaxis of viral infections disease, can avoid the defective of deactivations such as virus rescue or virus virulence recovery and attenuated vaccine.In addition, recombinant s protein fragment itself since to SARS virus on the acceptor recognition sequence have similar structure, therefore, can suppress SARS virus identification virus receptor in vivo competitively, host cells infected can be used for preparing the medicine for the treatment of SARS.
Summary of the invention
The object of the present invention is to provide the recombinant protein that is used for SARS diagnosis, treatment and prevention.
The objective of the invention is to realize by the following technical solutions:
The invention provides a kind of recombinant protein, have following (a) or (b) described aminoacid sequence:
(a) have the aminoacid sequence shown in the sequence 1, it is the aminoacid sequence of 345～655 in SARS virus S albumen;
(b) with the aminoacid sequence in (a) through the replacement of one or several amino-acid residue, disappearance or add, and having and (a) protein of middle protein identical function.
The invention provides a kind of above-mentioned recombinant protein as the antigenic purposes of SARS virus.
The invention provides the purposes of a kind of above-mentioned recombinant protein in preparation SARS vaccine.
The invention provides the purposes of a kind of above-mentioned recombinant protein in preparation treatment SARS medicine.
The invention provides the purposes of a kind of above-mentioned recombinant protein in preparation diagnosis SARS reagent.
Recombinant protein provided by the invention can be by conventional expression of recombinant proteins technology preparation.
The advantage of recombinant protein provided by the invention is: the present invention first at vivoexpression the proteic acceptor recognition function of reorganization SARS virus S fragment; Simultaneously, calculating this fragment of confirmation by chemical structure is the major function zone of SARS virus identification receptor; And in the SARS rehabilitation patient's who detects serum, all found to discern the antibody of this recombinant protein; When the organism infection SARS virus, can be by this recombinant protein antibody that self produces or external source is imported, the blocking-up SARS virus infects normal cell, and reaches the effect of treatment or the infection of prevention SARS virus; Simultaneously, also can be by to can be at this recombinant protein detection of antibodies, generation, the development that SARS virus is infected and whether can take a turn for the better and diagnose.In addition, this recombinant protein fragment itself can also the inhibition SARS virus of direct competitive and combining of its virus receptor, and reaches the effect that treatment or prevention SARS virus infect.
Description of drawings
Fig. 1 is the recombinant protein of embodiment 2 and the western blot analysis chart of SARS rehabilitation clients and control group normal human serum, wherein Fig. 1-1 and Fig. 1-2 represent the reaction image of recombinant protein and rehabilitation clients and normal human serum respectively, can see significantly that in Fig. 1-1 recombinant protein is by the band of SARS rehabilitation clients serum identification; " → " sensing place is the recombinant protein of embodiment 2;
Fig. 2 is the recombinant protein of embodiment 5 and the western blot analysis chart of SARS rehabilitation clients and control group normal human serum, wherein Fig. 2-1 and Fig. 2-2 represents the reaction image of recombinant protein and rehabilitation clients and normal human serum respectively, can see significantly that in Fig. 2-1 recombinant protein is by the band of SARS rehabilitation clients serum identification; " → " sensing place is the recombinant protein of embodiment 5.
Embodiment
Embodiment 1, contain gsh (GST) Expression of Fusion Protein and the purifying of the aminoacid sequence of 345～655 in SARS virus S albumen
The recombinant plasmid that contains encoding SARS virus S protein sequence that utilizes biology department of Hong Kong University of Science and Thchnology to provide is template, adopts the segmental Auele Specific Primer of following SARS virus S protein receptor recognition function,
sense?GG
GGATCCTCAACATTTTTTTCAACCTTTAAGTGC
anti-sense?CC
GGTACCTGTATGGTAACTAGCACAAATGCCAGC，
(condition of PCR is: 94 ℃ 5 minutes by PCR; 94 ℃ 15 seconds, 60 ℃ 30 seconds, 72 ℃ 2 minutes, totally 25 circulations; Then, 72 ℃ were extended 6 minutes) the amplification purpose fragment that obtains encoding.Utilize the restriction enzyme site of the BanHI that comprises respectively in the above-mentioned primer and the restriction enzyme site of KpnI (drawing the horizontal line place among the figure), fragment and PGEX-4T-2 (available from Amersham Pharmacia company) that PCR is obtained use restriction enzyme BamHI and KpnI enzyme (all available from Promega company) to cut respectively, reclaim through electrophoresis, glue again, and through dna fragmentation purifying preparation box (QIAquick Gel Extraction Kit, QIAGEN company) purifying connects conversion DH5 α competence bacterium.The single bacterium colony of picking is cut evaluation with BamHI and KpnI enzyme.With the DH5 α bacterium after identifying, be seeded in the LB nutrient agar that contains penbritin, cultivate after 24 hours the single colony inoculation of picking in containing the LB liquid nutrient medium of penbritin, 37 ℃ of cultivations, and induce (30 ℃ were induced 4 hours) with the IPTG of 0.2mM.Results bacterium liquid, centrifugal (10000rpm, 20 minutes), the results bacterium, the ultrasonic degradation bacterium, centrifugal 10 minutes of 12000g collects thalline and supernatant respectively, and electrophoresis is identified.The result shows that target protein appears in the inclusion body.Inclusion body is used washings Buffer B (100Mm NaH respectively
2PO
4, 130Mm NaCl; TritonX-100 (0.5-1%)) and BufferA (130MmNaCl, 100mmNaH
2PO4) washing inclusion body uses lysate (0.3%N-laurysarcosine) dissolving after 15 minutes inclusion body, and centrifugal (12000rpm, 10 minutes) go precipitation, dialysis renaturation (20mM Tris-Cl pH8.0) 48 hours.Then, with the renaturation solution affinity chromatography, use the Bulk GST purification kit purifying of Pharmacia company to obtain containing the segmental gst fusion protein of purpose.
Embodiment 2, have the preparation and the purifying of the recombinant protein of the aminoacid sequence shown in the sequence 1
(LeuValProArg ↓ GlySer), this fusion rotein is cut is to obtain to have the recombinant protein of the aminoacid sequence shown in the sequence 1 for zymoplasm cleavage site in the gst fusion protein that embodiment 1 is obtained.It is 1mg/ml that gst fusion protein is dissolved to concentration with reductive glutathione damping fluid (reductive glutathione of 10mM is dissolved in 50mM Tris-HCL pH8.0), get 1ml fusion rotein solution and add 14 milliliter 1 * cutting damping fluid (20mMTris-HCL pH8.4,150mM NaCL and 2.5mM CaCL
2) and 1 unit zymoplasm (Novagen product: Thrombin Protease, restriction grade), at room temperature hatched 4 hours.Then, protein solution through the GST of Pharmacia company affinity chromatography column purification, is collected the effluent liquid that the recombinant protein with the aminoacid sequence shown in the sequence 1 is arranged, the sucrose dialysis is concentrated into 1.5 milliliters.
The calculating of embodiment 3, recombinant protein and virus receptor bonding force
The present invention adopts chemical structure software for calculation (Autodock 2.0) to acceptor (the human angiotensin saccharase II of SARS virus on the human cell surface, document Wenhui Li, et al.Angiotensin-converting enzyme 2 is afunctional receptor for the SARS coronavirus.Nature.2003 426:450-454) carry out the structural stability computational analysis with SARS virus S albumen.The result shows, it is more stable to comprise the protein fragments of the recombinant protein with the aminoacid sequence shown in the sequence 1 and structure that angiotensin-converting enzyme II forms, confirms that this sequence is the necessary fragment of SARS virus identification receptor.
Embodiment 4, analyze in the SARS rehabilitation clients serum antibody that identification has the recombinant protein of the aminoacid sequence shown in the sequence 1 with the method for western blot.
The SARS rehabilitation clients serum that adopts among the present invention (collection of clinical laboratory of Peking University First Hospital) is diagnosed as the patient of SARS from SARS recovery from illness 1 month through clinical diagnosis and ELISA, during one's sickness, the patient has sings and symptomses such as heating, dry cough and chest X-ray examination change.The control group normal human serum is the healthy human serum that collect popular preceding this chamber of SARS.The recombinant protein of the purifying that embodiment 2 is obtained, electrophoresis in 10% polyacrylamide gel is transferred on the nitrocellulose membrane then; Film, was hatched 1 hour with SARS rehabilitation clients's serum and normal human serum (being 1: 500) respectively after 1 hour with 3% BSA sealing,, add the goat anti-human igg and the IgM antibody of HRP mark, hatched 1 hour then with the serum flush away; With the antibody flush away, with the NBT/BCIP Color Appearance System colour developing of Promega company, observe band, the result is as shown in Figure 1.Wherein Fig. 1-1 and Fig. 1-2 represent the reaction image of recombinant protein and rehabilitation clients and normal human serum respectively.In Fig. 1-1, can see the band that recombinant protein is discerned by SARS rehabilitation clients serum significantly, then not see specific reaction band among Fig. 1-2.This shows that recombinant protein of the present invention can only be discerned by the specific antibody in the SARS rehabilitation clients serum, is the sign at the SARS rehabilitation.Embodiment 5, contain the preparation and the purifying of recombinant protein of the aminoacid sequence of 1～655 in SARS virus S albumen
The recombinant plasmid that contains encoding SARS virus S protein sequence (protein of 655 amino-acid residues of encoding SARS virus S protein N end) that utilizes biology department of Hong Kong University of Science and Thchnology to provide is a template, adopt the segmental Auele Specific Primer of following SARS virus S protein receptor recognition function
Sense：GG
GGATCCAGTGACCTTGACCGGTGCACCAC
Antisense：CC
GAATTCAACTGTATGGTAACTAGCACAAATGCC
(condition of PCR is: 94 ℃ 5 minutes by PCR; 94 ℃ 15 seconds, 60 ℃ 30 seconds, 72 ℃ 2 minutes, totally 25 circulations; Then, 72 ℃ were extended 6 minutes) the amplification purpose fragment that obtains encoding.Utilize the restriction enzyme site of the BamHI that comprises respectively in the above-mentioned primer and the restriction enzyme site of EcoRI (drawing the horizontal line place among the figure), fragment and pET32a-TRX (available from Amersham Pharmacia company) that PCR is obtained use restriction enzyme BamHI and EcoRI enzyme (all available from Promega company) to cut respectively, reclaim through electrophoresis, glue again, and through dna fragmentation purifying preparation box (QIAquick Gel Extraction Kit, QIAGEN company) purifying connects conversion BL21 (Rare Codon) competence bacterium.The single bacterium colony of picking is cut evaluation with BamHI and EcoRI enzyme.With BL21 (Rare Codon) bacterium after identifying, be seeded in the LB nutrient agar that contains penbritin, cultivate after 24 hours the single colony inoculation of picking in containing the LB liquid nutrient medium of penbritin, 37 ℃ of cultivations, and induce (30 ℃ were induced 4 hours) with the IPTG of 0.2mM.Results bacterium liquid, centrifugal (10000rpm, 20 minutes), the results bacterium, the ultrasonic degradation bacterium, centrifugal 10 minutes of 12000g collects thalline and supernatant respectively, and electrophoresis is identified.The result shows that target protein appears in the inclusion body.Inclusion body is resuspended in 20ml Buffer A (6M Guanidinium hydrochloride, 10mM Tris-ClpH8.0,100mM NaH
2PO
4), room temperature magnetic agitation 2 hours is filtered, and with the Ni-NTA column equilibration of supernatant liquor and Qiagen company, uses Buffer B (8M urea, 10mM Tris-C1pH8.0, the 100mM NaH of 5 times of volumes then respectively
2PO
4); The Buffer C of 10 times of volumes (same B, pH6.3); Buffer D (the same B of 2 times of volumes, pH5.9), (same B pH4.5) carries out the specificity wash-out to target protein to use the Buffer E of 2 times of volumes at last, substep is collected, and obtains the recombinant protein of the aminoacid sequence with 1～655 of SARS virus S albumen n end of purifying.
Embodiment 6, analyze in the SARS rehabilitation clients serum antibody of recombinant protein prepared among the identification embodiment 5 with the method for western blot.
The SARS rehabilitation clients serum that adopts among the present invention (collection of clinical laboratory of Peking University First Hospital) is diagnosed as the patient of SARS from SARS recovery from illness 1 month through clinical diagnosis and ELISA, during one's sickness, the patient has sings and symptomses such as heating, dry cough and chest X-ray examination change.The control group normal human serum is the healthy human serum that collect popular preceding this chamber of SARS.The recombinant protein of the purifying that embodiment 5 is obtained, electrophoresis in 10% polyacrylamide gel is transferred on the nitrocellulose membrane then; Film, was hatched 1 hour with SARS rehabilitation clients's serum and normal human serum (being 1: 500) respectively after 1 hour with 3% BSA sealing,, add the goat anti-human igg and the IgM antibody of HRP mark, hatched 1 hour then with the serum flush away; With the antibody flush away, with the NBT/BCIP Color Appearance System colour developing of Promega company, observe band, the result is as shown in Figure 2.Wherein Fig. 2-1 and Fig. 2-2 represents the reaction image of recombinant protein and rehabilitation clients and normal human serum respectively.In Fig. 2-1, can see the band that recombinant protein is discerned by SARS rehabilitation clients serum significantly, then not see specific reaction band among Fig. 2-2.This shows that recombinant protein of the present invention can only be discerned by the specific antibody in the SARS rehabilitation clients serum, is the sign at the SARS rehabilitation.
Recombinant protein provided by the invention can be used for SARS virus antigen, also can be used for preparing the SARS vaccine, or the reagent of preparation treatment SARS medicine and preparation diagnosis SARS.Described recombinant protein not only is confined to contain the protein of the aminoacid sequence shown in the sequence 1, and with the replacement of this aminoacid sequence through one or several amino-acid residue, disappearance or interpolation also have identical function.
Sequence table
Sequence number: 1
Title: recombinant protein
Sequence length: 311
Sequence type: amino acid
Topology: linearity
Sequence kind: peptide
The source:
Biological name: SARS virus
Tissue types: S albumen
Sequence signature:
The mark of feature: peptide
Location: 1..311
Sequence
Ser?Thr?Phe?Phe?Ser?Thr?Phe?Lys?Cys?Tyr?Gly?Val?Ser?Ala?Thr?Lys
Leu?Asn?Asp?Leu?Cys?Phe?Ser?Asn?Val?Tyr?Ala?Asp?Ser?Phe?Val?Val
Lys?Gly?Asp?Asp?Val?Arg?Gln?Ile?Ala?Pro?Gly?Gln?Thr?Gly?Val?Ile
Ala?Asp?Tyr?Asn?Tyr?Lys?Leu?Pro?Asp?Asp?Phe?Met?Gly?Cys?Val?Leu
Ala?Trp?Asn?Thr?Arg?Asn?Ile?Asp?Ala?Thr?Ser?Thr?Gly?Asn?Tyr?Asn
Tyr?Lys?Tyr?Arg?Tyr?Leu?Arg?His?Gly?Lys?Leu?Arg?Pro?Phe?Glu?Arg
Asp?Ile?Ser?Asn?Val?Pro?Phe?Ser?Pro?Asp?Gly?Lys?Pro?Cys?Thr?Pro
Pro?Ala?Leu?Asn?Cys?Tyr?Trp?Pro?Leu?Asn?Asp?Tyr?Gly?Phe?Tyr?Thr
Thr?Thr?Gly?Ile?Gly?Tyr?Gln?Pro?Tyr?Arg?Val?Val?Val?Leu?Ser?Phe
Glu?Leu?Leu?Asn?Ala?Pro?Ala?Thr?Val?Cys?Gly?Pro?Lys?Leu?Ser?Thr
Asp?Leu?Ile?Lys?Asn?Gln?Cys?Val?Asn?Phe?Asn?Phe?Asn?Gly?Leu?Thr
Gly?Thr?Gly?Val?Leu?Thr?Pro?Ser?Ser?Lys?Arg?Phe?Gln?Pro?Phe?Gln
Gln?Phe?Gly?Arg?Asp?Val?Ser?Asp?Phe?Thr?Asp?Ser?Val?Arg?Asp?Pro
Lys?Thr?Ser?Glu?Ile?Leu?Asp?Ile?Ser?Pro?Cys?Ala?Phe?Gly?Gly?Val
Ser?Val?Ile?Thr?Pro?Gly?Thr?Asn?Ala?Ser?Ser?Glu?Val?Ala?Val?Leu
Tyr?Gln?Asp?Val?Asn?Cys?Thr?Asp?Val?Ser?Thr?Ala?Ile?His?Ala?Asp
Gln?Leu?Thr?Pro?Ala?Trp?Arg?Ile?Tyr?Ser?Thr?Gly?Asn?Asn?Val?Phe
Gln?Thr?Gln?Ala?Gly?Cys?Leu?Ile?Gly?Ala?Glu?His?Val?Asp?Thr?Ser
Tyr?Glu?Cys?Asp?Ile?Pro?Ile?Gly?Ala?Gly?Ile?Cys?Ala?Ser?Tyr?His
Thr?Val?Ser?Leu?Leu?Arg?Ser
SEQUENCE?LISTING
＜110〉Peking University
＜120〉a kind of recombinant protein
<130>FPI03172
<160>1
<170>PatentIn?version?3.1
<210>1
<211>311
<212>PRT
<213>Coronavirus
<400>1
Ser?Thr?Phe?Phe?Ser?Thr?Phe?Lys?Cys?Tyr?Gly?Val?Ser?Ala?Thr?Lys
1 5 10 15
Leu?Asn?Asp?Leu?Cys?Phe?Ser?Asn?Val?Tyr?Ala?Asp?Ser?Phe?Val?Val
20 25 30
Lys?Gly?Asp?Asp?Val?Arg?Gln?Ile?Ala?Pro?Gly?Gln?Thr?Gly?Val?Ile
35 40 45
Ala?Asp?Tyr?Asn?Tyr?Lys?Leu?Pro?Asp?Asp?Phe?Met?Gly?Cys?Val?Leu
50 55 60
Ala?Trp?Asn?Thr?Arg?Asn?Ile?Asp?Ala?Thr?Ser?Thr?Gly?Asn?Tyr?Asn
65 70 75 80
Tyr?Lys?Tyr?Arg?Tyr?Leu?Arg?His?Gly?Lys?Leu?Arg?Pro?Phe?Glu?Arg
85 90 95
Asp?Ile?Ser?Asn?Val?Pro?Phe?Ser?Pro?Asp?Gly?Lys?Pro?Cys?Thr?Pro
100 105 110
Pro?Ala?Leu?Asn?Cys?Tyr?Trp?Pro?Leu?Asn?Asp?Tyr?Gly?Phe?Tyr?Thr
115 120 125
Thr?Thr?Gly?Ile?Gly?Tyr?Gln?Pro?Tyr?Arg?Val?Val?Val?Leu?Ser?Phe
130 135 140
Glu?Leu?Leu?Asn?Ala?Pro?Ala?Thr?Val?Cys?Gly?Pro?Lys?Leu?Ser?Thr
145 150 155 160
Asp?Leu?Ile?Lys?Asn?Gln?Cys?Val?Asn?Phe?Asn?Phe?Asn?Gly?Leu?Thr
165 170 175
Gly?Thr?Gly?Val?Leu?Thr?Pro?Ser?Ser?Lys?Arg?Phe?Gln?Pro?Phe?Gln
180 185 190
Gln?Phe?Gly?Arg?Asp?Val?Ser?Asp?Phe?Thr?Asp?Ser?Val?Arg?Asp?Pro
195 200 205
Lys?Thr?Ser?Glu?Ile?Leu?Asp?Ile?Ser?Pro?Cys?Ala?Phe?Gly?Gly?Val
210 215 220
Ser?Val?Ile?Thr?Pro?Gly?Thr?Asn?Ala?Ser?Ser?Glu?Val?Ala?Val?Leu
225 230 235 240
Tyr?Gln?Asp?Val?Asn?Cys?Thr?Asp?Val?Ser?Thr?Ala?Ile?His?Ala?Asp
245 250 255
Gln?Leu?Thr?Pro?Ala?Trp?Arg?Ile?Tyr?Ser?Thr?Gly?Asn?Asn?Val?Phe
260 265 270
Gln?Thr?Gln?Ala?Gly?Cys?Leu?Ile?Gly?Ala?Glu?His?Val?Asp?Thr?Ser
275 280 285
Tyr?Glu?Cys?Asp?Ile?Pro?Ile?Gly?Ala?Gly?Ile?Cys?Ala?Ser?Tyr?His
290 295 300
Thr?Val?Ser?Leu?Leu?Arg?Ser
305 310
Claims (4)
1, a kind of recombinant protein, its aminoacid sequence is shown in sequence 1.
2, the purposes of the described recombinant protein of a kind of claim 1 in preparation SARS vaccine.
3, the purposes of the described recombinant protein of a kind of claim 1 in preparation treatment SARS medicine.
4, the purposes of the described recombinant protein of a kind of claim 1 in preparation diagnosis SARS reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310122418 CN1258538C (en) | 2003-12-23 | 2003-12-23 | Recombinant protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310122418 CN1258538C (en) | 2003-12-23 | 2003-12-23 | Recombinant protein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1631896A CN1631896A (en) | 2005-06-29 |
| CN1258538C true CN1258538C (en) | 2006-06-07 |
Family
ID=34844492
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200310122418 Expired - Fee Related CN1258538C (en) | 2003-12-23 | 2003-12-23 | Recombinant protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1258538C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112300251B (en) * | 2020-02-24 | 2022-04-05 | 成都威斯克生物医药有限公司 | Protein and vaccine for anti SARS-CoV-2 infection |
-
2003
- 2003-12-23 CN CN 200310122418 patent/CN1258538C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1631896A (en) | 2005-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| TW202207979A (en) | Combination vaccine | |
| MX2010012020A (en) | Radio base station and communication control method. | |
| CN101153059B (en) | ELISA reagent kit for screening, diagnosis and treatment effect forecast of nasopharyngeal carcinoma | |
| KR102673090B1 (en) | Vaccine composition based on synthetic polypeptide epitope | |
| Lu et al. | Protection of grass carp, Ctenopharyngon idellus (Valenciennes), through oral administration of a subunit vaccine against reovirus. | |
| MX2010013437A (en) | Attenuated pestivirus. | |
| JP2008505050A (en) | SARS coronavirus S protein and use thereof | |
| CN101062941A (en) | Recombined hepatitis E hepatitis virus protein, preparation method and usage thereof | |
| CN102649819A (en) | Screening model of HCV (Hepatitis C Virus) proteolytic enzyme inhibitor | |
| CN104628871B (en) | A kind of preparation for recombinating bursal disease protein engineering vaccine | |
| CN102101889A (en) | Prokaryotic expression protein of VP73 gene from African swine fever virus and preparation method thereof | |
| CN102690327A (en) | Enterovirus 71 neutralized epitope polypeptide and application thereof | |
| CN1800854A (en) | Gold-labeled test paper strip for quick diagnosis of hemorrhagic fever with renal syndrome | |
| CN1258538C (en) | Recombinant protein | |
| Wang et al. | Expression of codon-optimized PDCoV-RBD protein in baculovirus expression system and immunogenicity evaluation in mice | |
| CN102406929B (en) | Co-expressed molecular adjuvant enhanced divalent foot and mouth disease protein engineering vaccine | |
| Habib | Vaccine design, adaptation, and cloning design for multiple epitope-based vaccine derived from SARS-CoV-2 surface glycoprotein (S), membrane protein (M) and envelope protein (E): In silico approach | |
| US20080008721A1 (en) | Preventive and therapeutic use of polypeptides from African Swine virus as vaccines | |
| CN1273482C (en) | Hepatitis C virus tunic protein E2 gene capable of being total length expressed in E. coli, its coding protein and use | |
| CN113736825A (en) | Recombinant drosophila cell line for expressing swine atypical pestivirus fusion protein and preparation method and application thereof | |
| CN1185254C (en) | First hypervariable region antigen of hepatitis C and fusion antigen | |
| CN112724205A (en) | Method for preparing virus-like particles from hepatitis E virus (HCV) 239 protein and application of virus-like particles | |
| JPH10505236A (en) | Vaccines for infectious peritonitis in cats | |
| Wu et al. | Characterization of the monoclonal antibody against classical swine fever virus glycoprotein E rns and its application to an indirect sandwich ELISA | |
| CN1458168A (en) | Recombined pig influenza virus NP antigen, its preparing method and use in diagnosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20060607 Termination date: 20100125 |