CN1242054A - Process and composition for preparing D-aspartic acid - Google Patents

Abstract

A process and composition for preparing D-aspartic acid and beta -alanine from D,L-aspartic acid, wherein a solution of D,L-aspartic acid or a salt thereof is contacted with a composition having an L-aspartate- alpha -decarboxylase activity of greater than 100 mu mol L-aspartate used per hour per gram of cells.

Description

The method and composition of preparation D-aspartic acid

Background of invention

Invention field

The present invention sets forth a kind of method for preparing the D-aspartic acid from the aspartic acid of racemization.More particularly, the present invention sets forth the enzymatic decarboxylation by the aspartic acid of racemization, prepares the method for D-aspartic acid and Beta-alanine.

Description of Related Art

L-aspartic acid-α-decarboxylase catalysis produces Beta-alanine from the L-aspartic acid.Nakano etc. have shown in the crude extract from intestinal bacteria B strain this enzymic activity.Nakano, Y. etc., journal of biological chemistry; 70 volumes, 327-334 page or leaf (1971).Williamson etc. have further studied the enzymic activity of this enzyme purification in the intestinal bacteria behind the apparent homogeneous.Williamson, J etc., journal of biological chemistry, 254 (16) volumes, 8074-8082 page or leaf (in August, 1979).The document of these inventions does not illustrate except the curiosity of experiment, but can produce the enzyme amount of any practical application.As following discuss more comprehensively, the present invention utilizes a kind of composition, the activity that makes L-aspartic acid-α-decarboxylase be Nakano etc. with document such as Williamson in 100～2000 times of this enzymic activity of delivering.

Giving the method and composition that discloses generation L-L-Ala and its derivative in the U.S. Patent number 5,019,509 of Rozzell.Yet Rozzell discloses the gene of coding aspartic acid-β-decarboxylase and has been used to produce the L-L-Ala.Giving in the U.S. Patent number 5,552,317 and 5,552,318 of Houng, disclosing and be used for preparing the method for optically active amino acids and its ester class from the lipase of wheat or Candida lipolytica (Candida lipolytica).By contrast, method of the present invention is not the common method of converting as methods such as Houng, and common method is that in fact amino acid whose transformation relies on amino acid whose derivative to carry out, thereby needs extra chemical step.The most common method is that the racemate class is handled with esterase/lipase, or the N-acetylamino acid is handled with acyl enzyme.

Known other conversion procedures are to use Ntn hydrolase, act on the amino acid amide of racemization, and wherein this enzyme is just specifically at a kind of isomer.See U.S. Patent number 4,880,737.Yet, the invention provides a kind of more simple method, because chemically modified that need not be extra is with the preparation substrate.

The invention provides easy approach,, in the L-aspartic acid, produce 2 kinds of widely used compounds from rich in natural resources D.In medicinal, existing a large amount of document description D-aspartic acids and its derivative.These application include, but are not limited to suppress arginine base succsinic acid synthase activity and are used as immunosuppressor.Suppress arginine base succsinic acid synthase activity, can be used for preventing or treating the systemic ypotension of Sepsis or cytokine induction.Other application of D-aspartic acid comprises the sense of taste modifying composition of making food and a kind of new sweetening agent of being developed by Pfizer, Alitame ^TMIn addition, Beta-alanine is used for the synthetic of pantothenic acid, and pantothenic acid is essential to the synthetic of coenzyme A.Also known Beta-alanine is as the synthetic α of chiral synthon-alternate beta amino acids.The derivative of Beta-alanine has been used as the damping fluid of electroplating in the industry.

Summary of the invention

The racemic mixture of aspartic acid isomer (D and L) and the enzyme incubation in a kind of microorganism or suitable source, this microorganism contain the panD gene of coding L-aspartic acid-α-decarboxylase.The reaction that this enzyme catalysis is following:

This enzyme stereospecificity ground becomes Beta-alanine and CO to L-asparagine acid decarboxylation ₂, and the still not reaction of D-aspartic acid.Because along with CO ₂Release, this reaction is irreversible basically, thereby has realized the high conversion of product.This reaction can be under mild conditions as carrying out under room temperature and the neutral pH, thereby make this method extremely help protecting environment, have demand widely.

The accompanying drawing summary

Fig. 1 shows the production process of plasmid pIF309.

Fig. 2 shows D, the biotransformation of L-aspartic acid substrate solution becomes D-aspartic acid and Beta-alanine, L-aspartic acid-α-decarboxylase catalysis by the present invention preparation reduces the L-aspartic acid, is illustrated with the quantity of remaining L-aspartic acid in the solution.

Fig. 3 shows the new fresh cell of L-aspartic acid-α-decarboxylase prepared product, the activity of the supernatant liquor effect that stays after the reaction of Fig. 2 explanation is finished.

Exhausted L-aspartic acid-α-decarboxylase before Fig. 4 shows acts on fresh D, the activity of L-aspartic acid substrate solution.

Fig. 5 shows L-aspartic acid-α-decarboxylase of different applied sample amount 50g/l and 100g/l, acts on 1.0M D, the activity of L-asparagine acid solution.

Fig. 6 shows L-aspartic acid-α-decarboxylase, acts on NH ₄OH neutral D, the activity of L-aspartic acid substrate.

Fig. 7 shows L-aspartic acid-α-decarboxylase, acts on various amino acid substrate, D, L-aspartic acid, D, L-glutaminate and D, the activity of L-L-Ala.

Fig. 8 relatively under 37 ℃, 45 ℃ and 50 ℃ of temperature, D, the result of L-aspartic acid bio-transformation.

Detailed Description Of The Invention

The invention provides a kind of from D, the method for preparing D-ASP in the ASPARTIC ACID, the method comprises D, ASPARTIC ACID or its esters and the composition that comprises microbial cell or its extract carry out incubation, wherein under the appropraite condition that produces D-ASP and Beta-alanine, the activity of ASPARTIC ACID-α that composition has-decarboxylase is greater than every gram cell 100 μ mol ASPARTIC ACIDs per hour.

L-aspartic acid-α-decarboxylase is also referred to as L-aspartic acid-1-decarboxylase, aspartic acid-1-decarboxylase or E.C.4.1.1.11 at this, in the present invention according to following reaction formula, is used for the aspartic acid preparation D-aspartic acid from racemization. Substrate and reaction product alternately are called their sour form and salt form at this.Substrate D for example, the L-aspartic acid is also referred to as D at this, the L-aspartate.Those of ordinary skill in the art can recognize according to existing pH value of solution difference, the form and the title difference thereof of acid.As following discussion more comprehensively, method of the present invention is used for pH scope widely, and the substrate of using acid and two kinds of forms of salt can be provided.As the purpose of disclosure of the present invention,, be set at synonym in this used title based on acid and salt.

The e. coli k12 panD gene of this enzyme of encoding is cloned on the intestinal bacteria multiple copied plasmid vector, is used in the whole-cell biological conversion system, to produce Beta-alanine and D-aspartic acid." whole-cell biological conversion system " refer to use contain not by the cell of this enzyme of extracting and purifying and from fermention medium ultra-filtration or the isolating enzyme of alternate manner, directly be added to catalyzed reaction in the solution, to produce Beta-alanine and D-aspartic acid.Other " systems " can be used to put into practice invention of the present disclosure, and are provided with and depart from scope of the present invention.Aforesaid method includes, but are not limited to use immobilized cell fraction, immobilization holoenzyme or enzyme fraction.Form cell fraction and the enzyme of purifying and the method for enzyme fraction, well-known in one of ordinary skill in the art.Preferred process for fixation is discussed below.

L-aspartic acid-α-decarboxylase is also referred to as L-aspartic acid-1-decarboxylase or EC4.1.1.11 at this, and catalysis is removed the α carboxyl from the L-aspartic acid, to produce Beta-alanine.

The present invention also provides the composition that comprises microorganism cells or its extract, and wherein L-aspartic acid-α-decarboxylase of having of composition is greater than every gram cell 100 μ molL-aspartic acids per hour.

In one embodiment, composition comprises that the extract of microorganism cells or cell, this cell transform with the carrier of the panD gene that comprises coding L-aspartic acid-α-decarboxylase.For example, carrier may be a plasmid, as pIF309 described here.Then, carrier is used to transform the microorganism such as bacterium, for example intestinal bacteria.In an embodiment preferred, composition comprises intestinal bacteria NS3291 cell or cell extract.

L-aspartic acid-α-decarboxylase that composition of the present invention has is greater than every gram cell 100 μ mol L-aspartic acids per hour, preferably approximately per hour every gram cell 100～2000 μ mol L-aspartic acids.The enzymic activity of said composition is to calculate as the reference point with the activity of methods such as the Williamson explanation of as above being indicated.In that piece reference, the activity that crude extract shows is 400 gram cell 6700U, and 1U is equal to the CO that 42 ℃ of following per minutes discharge 1nmol ₂Therefore, the 16.75U/g cell is equal to every gram cell per minute release 16.75nmol CO ₂The L-aspartic acid of supposing 1 mole changes into 1 mole Beta-alanine and 1 mole CO fully ₂, the L-aspartic acid of the 16.75nmol that the every gram cell of per minute is used spends about per hour every gram cell the L-aspartic acid of 1 μ mol.As in this embodiment explanation, the activity that composition of the present invention provides is higher more than 100 times than the enzymic activity of known systems preparation.According to Williamson paper Table III, the specific activity of pure enzyme is a 650U/mg albumen.Suppose that 50% total cell protein has this activity, the activity of L-aspartic acid-α-decarboxylase that present method and composition provide per hour reaches every gram cell 2000 μ mol L-aspartic acids.In an embodiment preferred, the activity of L-aspartic acid-α-decarboxylase that composition has per hour is approximately every gram cell 100-2000 μ mol L-aspartic acid.In another embodiment, the activity of L-aspartic acid-α-decarboxylase that composition has per hour is approximately every gram cell 100～1000 μ mol L-aspartic acids.

The clone of L-aspartic acid-α-decarboxylase gene can finish by following method, from suitable donator microorganism, separate the dna fragmentation that coding has the polypeptide of L-aspartic acid-α-decarboxylase, then dna fragmentation is incorporated in the suitable carriers, well-known among this method one skilled in the relevant art.Suitable donator microorganism comprises all microorganisms of carrying following gene, and the α-decarboxylation of the polypeptide energy catalysis L-aspartic acid of this genes encoding becomes Beta-alanine.Embodiment includes, but are not limited to, and from the bacterium of intestinal bacteria (" E.coli "), comprises intestinal bacteria B strain, e. coli k12 strain, intestinal bacteria NIHJ strain and intestinal bacteria Tennessee strain; Proteus vulgaris, cadaverine bacillus, azotobacter vinelandii, rhizobium leguminosarum, clover rhizobia or from the bacterium of Bacillaceae.

Be used for the suitable cloning vector of the present invention practice, generally contain replication orgin and selective key, with keep carrier in host cell stability and be convenient to identify transformant.Be used to clone the certain methods of L-aspartic acid-α-decarboxylase gene and the description of material, can be at molecular cloning: laboratory manual (T.Maniatis, E.Fritsch and J.Sambrook, cold spring harbor laboratory (1982)) and in the reference wherein find, be incorporated herein only for referencial use.

Express the dna fragmentation that coding has the polypeptide of L-aspartic acid-α-decarboxylase then.Express the general strategy of L-aspartic acid-α-decarboxylase gene, comprise the dna fragmentation that coding is had the polypeptide of L-aspartic acid-α-decarboxylase, be connected in the expression vector that is suitable for required host cell, wherein many embodiment are well known in the art.Generally speaking, being characterized as of suitable expression vector exists replication orgin, promotor or other to transcribe enhancement sequences, ribosome bind site and transcription termination sequence.Expression vector also can comprise electing property of the gene mark of giving antibiotics resistance; But, if desired, contain the plasmid of the proteic gene of any other coding host microorganism growth and survival needs, also the useful as selective mark.The embodiment that is used for the promotor of recombinant DNA construction comprises, but be not limited to, tryptophane, alkaline phosphatase, beta-galactosidase enzymes, β-Nei Xiananmei and PL promoter systems and the hybrid promoters system that forms from component or the structure of 2 or how known promoter systems such as tac.Although these are the most common promotors that are used for bacterial host strains, also can use other bacterial strain and the microbe species of being convenient to genetic manipulation and other promotor that is used for those host strains.

After the connection, the carrier that the present invention produces contains L-aspartic acid-α-decarboxylase gene that operability is connected with promotor, if use the carrier transformed host cells, can instruct to produce L-aspartic acid-α-decarboxylase.Suitable comprises any microorganism with the carrier host transformed, and bacterium for example, this microorganism allow the genetic expression of coding L-aspartic acid-α-decarboxylase.Embodiment is including, but not limited to, the bacterium of Colibacter, bacillus, Klebsiella, Rhodopseudomonas, salmonella, proteus, Azotobacter and rhizobium.

In a preferred embodiment of the invention, the host strain of expressing L-aspartic acid-α-decarboxylase gene is any coli strain, especially intestinal bacteria W3110 strain, promoter systems is the pheA promotor of modified, U.S. Patent number 5 is seen in the description of this promotor, 120,837 (Fotheringham etc.), its content is incorporated herein only for referencial use.Therefore, genetic expression realizes by gene is connected in the carrier that carries out genetic expression in the selected host strain.In a particularly preferred embodiment of the present invention, the carrier that is used at expression in escherichia coli L-aspartic acid-α-decarboxylase gene is pBR322, or derived from the plasmid of pBR322, as pIF309.Plasmid pBR322 contains the gene of coding penbritin and tetracyclin resistance, can allow identification of transformed cell easily.

If use the preferred embodiment of pIF309, the expression of enzyme is a composition.If use heat sensitive promotor, suppress son/promoter systems as λ cI857, induce L-aspartic acid-α-decarboxylase to synthesize and can realize by temperature change, for example leavening temperature is brought up to 40 ℃ from 30 ℃.Can expect and be approximately the level of L-aspartic acid-α-decarboxylase of producing 5%～40% of total protein of cell, thereby produced the full cell of the enzyme composition that contains very high L-aspartic acid-α-decarboxylase.

The enzyme that genetic expression occurs whether in cell or the extracellular produce, not crucial for purposes of the invention, because required product can reclaim easily, if desired, the method for knowing with those of ordinary skill in the art is further purified in either case.In a different preferred embodiment, this gene can be incorporated in the heat-staple microorganism, identifying the transgenation that strengthens enzyme heat stability, thereby allows present method to operate under the temperature that improves.

In enforcement of the present invention, produce the cell of the L-aspartic acid-α-decarboxylase improve the standard, can with contain D, the solution of L-aspartic acid or its salt, the result makes partial L-aspartic acid change into Beta-alanine at least in reaction mixture, emits CO ₂And stay the D-aspartic acid.But the processing of pair cell infiltration, the diffusion and the product that are beneficial to substrate pass in and out cell.This osmosis can be finished by handling cell with the tensio-active agent of lower concentration, and these tensio-active agents comprise but are not limited to, tween 80 ^, Triton X-100 ^, NonidetP40 ^, cetylpyridinium chloride Septochol, hexadecyl diformazan bromine ammonium or Zephiran chloride.In addition, organic solvent also is used to increase osmosis under lower concentration, and these organic solvents are including, but not limited to N, dinethylformamide (DMF), dimethyl sulfoxide (DMSO) (DMSO), ethanol or acetone.That L-aspartic acid-α-decarboxylase also can contain is rough, the cell extract mode of the L-aspartic acid-α-decarboxylase of partial purification or purifying, is added to and contains D, in the anti-mixed solution of L-aspartic acid.Cell extract is by method preparation well-known to those having ordinary skill in the art, and this method is a smudge cells, regains this enzyme.Cytoclasis can be finished by machinery or non-mechanical method.Modal situation, concerning bacterial suspension, mechanism as Schwann Cells forcer not, ultrasonic, pearl is ground or the Manton-Gaulin homogenizer can use, the characteristics of these methods are known those of ordinary skill in the art.See Scopes, R.K " protein purification ", (1982) (Springer-Verlag, New York).Then, with the reaction of cell extract, carry out in the mode that the full cell method of above-mentioned discussion is similar.

If desired, contain the enzyme or the enzyme fraction of L-aspartic acid-α-decarboxylase cell or its extract or purifying, but also immobilization.Can be used for the process for fixation in the invention process, comprise well-known method, as polymeric gel embedding, covalently bound, crosslinked, absorption and microencapsulation.Some embodiment of these methods are by describing among the A.M.Klihanov science 219:722-727 (1983), and reference is seen Enzymology method (1976), and the 44th volume (K.Mosbach chief editor) is incorporated herein only for referencial use.Immobilized a kind of method is at U.S. Patent number 5,019, disclose its content in 509, the support material that contains weight at least and be 20% silicon-dioxide or aluminum oxide and aminoalkyl group compound such as aminoalkyl group silane, polyethylene imine based or poly-alkylamine contact, and then activate with glutaraldehyde.Then, contain enzyme solution and contact, have the immobilized enzyme composition of L-aspartic acid-α-decarboxylase with generation with the activatory upholder.Other immobilization support that are used for the invention process are including, but not limited to, sintered glass and porous ceramics, bentonite, diatomite, gac Sepharose ^And Sepharose ^Derivative, Mierocrystalline cellulose and derivatived cellulose, polyacrylamide and polyacrylamide derivative, poly-azetidine, alginate, carrageenan and Chromosorb ^Sepharose ^(Pharmacia fine chemistry company UppsalaSweden) is a kind of pearl shape gel for preparing from agarose.Manufacturers's product bibliographical information, in its native state, agarose is the part of complex mixture that is called the electrically charged and neutral polysaccharide of agar.Be used to produce Sepharose ^Agarose obtains by the purification process of removing charged polysaccharide, only has the very gel of the lower tape electric charge gene of peanut to form.Those of ordinary skill in the art can correct estimate, and is applicable to immobilized cell or derives from many other materials of the extract of cell, also can be used for fixing L-aspartic acid-α of the present invention-decarboxylase.If necessary, these upholders can be by technology activation well-known in the art.

Utilization contains the cell of L-aspartic acid-α-decarboxylase or comprises the composition that derives from described cell extract, and the reaction that produces the D-aspartic acid is undertaken by following method.This method is containing D, and the solution of L-aspartic acid contacts with L-aspartic acid-α-decarboxylase, and reaction conditions allows to be transformed into Beta-alanine to the L-aspartic acid of small part.D, the concentration of L-aspartic acid is not crucial in this reaction, expects useful up to the concentration of 2M yet.In a preferred embodiment of the present invention, cell or cell extract and D, the contact of L-asparagine aqueous acid with 0.5M concentration.In a different preferred embodiment, D, the concentration of L-asparagine acid solution is 1.0M.

Enzymic catalytic reaction of the present invention carries out in about 4 ℃～70 ℃ temperature ranges, and preferred temperature range is approximately 20 ℃～60 ℃.In an embodiment preferred, temperature of reaction is an envrionment temperature.As purpose of the present invention, " envrionment temperature " means to not making and ins all sorts of ways or install, and the temperature of its physical environment when leaving standstill according to reaction vessel improves or reduce the temperature of reaction vessel.The optimal pH scope of reaction is approximately 2.0～12.0, and more preferably scope is approximately 4.0～9.0, and most preferred is pH7.0.

D-aspartic acid and Beta-alanine can separate and regain with method well known in the art, or D-aspartic acid/Beta-alanine mixture can regain or directly as mixture.L-aspartic acid-α of the present invention-decarboxylase composition can further be applied to produce in the Beta-alanine or Beta-alanine/D-asparagine acid mixture that contains radioactivity or non radioactive isotope mark.By using the asparagine acid precursor of suitable mark, and/or react under existing by the isotopic labeling solvent, above-mentioned product can easily produce.Can be incorporated into the isotope-labeled embodiment of Beta-alanine and/or D-asparagine acid product, including, but not limited to ¹⁴C, ¹³C, ¹³N, ¹⁵N, ²H, ³H, ¹⁷O and ¹⁸O.

Now, will further specify the present invention, and not lie in that also to should not be construed be to scope of the present invention restriction, limit scope of the present invention in the claim after connecing by the following example.

Embodiment 1

The preparation of plasmid pIF309

The panD gene of coding L-aspartic acid-1-decarboxylase from e. coli k12 karyomit(e), separates with following PCR method

A. chromosomal DNA preparation

(Yale University, Newhaven CT) obtain intestinal bacteria W3110 bacterial strain from Coli heredity storage center.Bacterial strain is according to supplier's indication recovery, and under 37 ℃, wave and culture spends the night in the Luria meat soup of 50ml volume in the 500ml culturing bottle.Centrifugal 4 minutes of 10ml equal portions culture 10,000 * g.What abandoning supernatant, precipitation were suspended in 1ml again contains 50mM Tris/HCl pH8.0, in the solution of 10mM EDTA and 100 μ g/ml RNaseA (Sigma).Solution is incubation 10 minutes at room temperature.The solution that contains 0.4% (w/v) sodium lauryl sulphate (" SDS ") and 100 μ g/ml Proteinase Ks (Sigma) that adds 2ml.37 ℃ of following incubation solution 20 minutes.Sodium acetate to the final concentration that adds pH5.2 is 300mM.Then, this solution is with isopyknic phenol extracting of 37 ℃ 3 times, with 2.5 times of volume of ethanol precipitations.Pipette DNA with asepsis ring then, DNA is dissolved in the 300mM sodium acetate of 400 μ l pH5.2 again.Then, DNA precipitates again with 2.5 times of volume of ethanol, pipettes by aforesaid method, and drying is dissolved among the 10mM Tris pH8.0 and 1mM EDTA of 500 μ l.Final concentration is approximately 200 μ g/ml.

B. by pcr amplification panD

By pcr amplification intestinal bacteria panD gene, use 0.2ml MicroAmp ^TMReaction tubes (Perkin Elmer, Norwalk, CT) finish, the e. coli chromosomal dna that in reaction tubes, adds 100ng such as above-mentioned preparation, each 2 μ l of dATP, dGTP, dCTP and dTTP (every kind of 10mM), 10 μ l contain damping fluid and 0.01% (w/v) gelatin of 15mM MgCl, 500mM KCl, 100mM TrispH8.3,5U Taq archaeal dna polymerase (AmpliTaq ^TM) and following every kind of Oligonucleolide primers solution of 5 μ l 10nmol/ml, Oligonucleolide primers is according to known method, and is synthetic with the applying biological 380B of system dna synthesizer.(MB1682)5′CGC?GGA?TCC?ACT?ATG?ATT?CGC?ACG?ATG?CTG?CAG?GGC?3′(MG1683)5′CAG?CGT?GCA?TGC?TCA?AGC?AAC?CTG?TAC?CGG?AAT?CGC?3′

Be reflected at Perkin Elmer 9600 ^TMCarry out in the PCR thermal cycler (Perkin Elmer).Amplified reaction is undertaken by following method, 94 ℃ of preheatings 3 minutes, and then 94 ℃ of sex change are 30 seconds, 50 ℃ of annealing 30 seconds, 72 ℃ were extended totally 30 circulations 2 minutes.Reaction mixture is stored in 4 ℃ then.

The clone of C.panD

The panD gene clone of amplification is to the plasmid vector that derives from plasmid pBR322.This plasmid called after pIF309.The fragment that contains the panD gene is connected between the independent BamHI of carrier and SphI site of similar manner cutting with Restriction Enzyme BamHI and SphI complete digestion.Insert the synthetic dna fragmentation between HindIII and BamHI, this dna fragmentation has the modification variant of e. coli k12 pheA promoter region.This fragment is synthetic on the 380BDNA of applying biological system synthesizer fully, data source in total United States Patent (USP) 5,120,837 such as Fotheringham.Above-mentioned sequence is seen as follows: HindIIIAAGCTTTTTTGTTGACAGCGTGAAAACAGTACGGGTATAATACTAAAGT CACAAGGAGGATCC

BamHI plasmid pIF309 shows in Fig. 1.Restrictive diges-tion uses the enzyme that is provided by New England Biolabs, Inc. (US) Massachusetts, United States of America to carry out, according to (NEB, Beverly, MA) use of specifying of manufacturers.The ligation test kit that use is provided by Takara Biochemics Inc. (Panvera Corp., Madison WI) carries out dna fragmentation according to specifying of manufacturers and connects.

By the extracting solution for preparing from the NS3291 strain culture by following description growth, biology is measured L-aspartic acid-1-decarboxylase and is determined the expression of panD.

Embodiment 2

The generation and the fermentation of intestinal bacteria NS3291 bacterial strain

Plasmid pIF309 is used for transformed into escherichia coli W3110 bacterial strain, and used condition is at U.S. Patent number 5,354, describes in 672, and its content is incorporated herein only for referencial use, and the result has produced the NS3291 bacterial strain.

The NS3291 bacterial strain is inoculated in the 2800ml Fernbach flask, contains the following growth medium of 1L in the bottle:

Dipotassium hydrogen phosphate 13g

Potassium primary phosphate 2g

Ammonium phosphate 4g

Ferric ammonium citrate 0.24g

Yeast extract 2g

Sal epsom (7H ₂O) 1g

Water 930ml

Add following ingredients after the sterilization:

Glucose (50%w/v stores liquid) 70ml

Penbritin 0.2g

Culturing bottle is 37 ℃ of shaking culture in the wave and culture case.Strain growth is used for the inoculation fermentation jar to 800-1100kletl unit.Fermentor tank is Biolafite 78-100 (St.GermainenLaye, France) 20L.Fermentor tank is operated under following condition:

Stirring velocity 500rpm

37 ℃ of temperature

Back-pressure (back pressure) 0.7Bar

PH (uses NH ₃Adjust) 7.2

Air flow 1vvm

Set volume 10L

Inoculum size 100ml

Working time 16hr

Except as otherwise noted, every liter of fermention medium substratum comprises following ingredients:

Sal epsom (7H ₂O) 5.35g

Ferric ammonium citrate 0.13g

Dipotassium hydrogen phosphate 4.6g

Sal epsom 0.023g

Potassiumiodide 0.74mg

Single nickel salt 0.74mg

Defoamer (Mazur Mazu DF204) 0.4ml

Yeast extract 5g

L-aspartic acid 10g

Tap water 10L

Before the inoculation, add the concentration of glucose to 25g/l.After initial glucose completely consumed, add glucose with the speed that changes, in the time of remainder, be not less than 1g/l, the total amount that added glucose in 16 hours is 290 grams.The final volume of jar is 12.2L.Fermentation reaches 10,352Kletl unit, and stem cell weight is 24.2g/l.Fermented liquid is cooled to below 10 ℃, is 158g/l with hollow fiber column (molecular weight cut-off 500,000) ultrafiltration to stem cell weight.Spissated cell elite is stored in 4 ℃.

This bacterial strain is used in the following example.

Embodiment 3

With L-aspartic acid-α-decarboxylase bio-transformation D/L aspartic acid

To heavily be that (Sigma A-9006) is added in the 2L beaker 66.5g (0.5M) D/L-aspartic acid, transfers pH to 7.0 with 10N NaOH.Add deionized water and add to volume 963ml.Add the cell (NS3291, as above describe) of 137ml with tinning cell volume (" PCV ") 7.31g/10ml cell, obtain final volume 1.1L.Pipette sample (each approximately 1ml) every for some time, centrifugal, supernatant liquor is analyzed the content of D-and L-aspartic acid with HPLC.

In this all embodiment, D-and L-aspartic acid isomer be by HPLC, and to preset the post deriving method qualitative with following.Aspartic acid is transformed into non-corresponding isomer with Phthalyldicarboxaldehyde and N-acetyl-L-cysteine.At Supelcosil ^TMLC-18DB, 3 μ, on 150 * 4.6mm post, use A moving phase: 20% methyl alcohol/80% tricresyl phosphate ethyl ammonium and B: methyl alcohol and following stagewise gradient obtain isolating non-corresponding isomer.

Time (min) A (%) B (%)

6.5????????????????100??????????????0

7.0????????????????40???????????????60

11.5???????????????40???????????????60

12.0???????????????100??????????????0

Derivative reaction carries out automatically with Hewlett-Packard 1090M chromatograph, detects under 338nm (bandwidth 4) and flow velocity 1.0ml/ branch.To residence time of D-aspartic acid and L-aspartic acid, be respectively 4.19 minutes and 4.54 minutes.

Centrifugal in Eppendorf centrifuge supernatant liquor suitably dilutes to remove cell from the sample of bio-transformation, and the value of being measured by HPLC falls among the linear section of typical curve like this.These thinning ratios are generally between 1: 100 and 1: 200, dilute with deionized water.

Among all embodiment, term " D-Asp " and " L-Asp " are as aspartic acid

The abbreviated notation of different isomerization body.

Table 1

	Time (hr)	???????D-Asp ???????(mg/ml)	??D-Asp ??(％)	???L-Asp ???(mg/ml)	???L-Asp ???(％)
						?0	??0.0000	???????29.300	??100.00	???28.870	???100.00
?1	??5.5000	???????29.320	??100.07	???12.050	???41.739
						?2	??24.500	???????29.250	??99.829	???0.17000	???0.58885
?3	??26.500	???????27.740	??94.676	???0.12000	???0.41566
						?4	??32.500	???????28.090	??95.870	???0.060000	???0.20783
?5	??47.500	???????28.060	??95.768	???0.030000	???0.10391
						?6	??52.000	???????28.390	??96.894	???0.020000	???0.069276
?7	??68.000	???????25.520	??87.099	???0.43000	???1.4894

In Fig. 2, figure the data in the table 1.About 24 hours, the about 0.17mg/ml of remaining L-aspartic acid percentage can ignore basically.Be used in the enzymic activity of composition in the bio-transformation, calculate by following formula:

0.5M??D，L-Asp＝0.25M?D-Asp+0.25M?L-Asp $\frac{0.25\mathrm{mol}}{L}\×1.1L=0.275\mathrm{mol},L-\mathrm{Asp}$

This value of back per hour equals every gram cell 114.6 μ mol L-aspartic acids, or greater than 100 times of the known enzymic activity of prior art.

At this moment the enrichment value of enantiomer is pressed column count: $\frac{29.25-0.17}{29.25+0.17}=0.988,D-\mathrm{Asp}$ Then whole-cell biological conversion reaction, cell is removed by centrifugal or ultra-filtration.The pH value mineral acid of acellular bio-transformation mixed solution, common sulfuric acid, be adjusted to the D-aspartic acid with solid precipitation Beta-alanine still the pH value in solution, typically pH value 2.0-2.5.Solid by filtration or additive method are collected, and clean so that D-to be provided aspartic acid with cold water.The rate of recovery is 50%～90%.

Embodiment 4

Again handle supernatant liquor with new fresh cell

In the present embodiment, handle again with new fresh cell from the supernatant liquor of embodiment 3.From embodiment 3, stop at 68 hours reaction solution, 7000rpm is centrifugal 45 minutes in the GS-3 rotor.From cell, be separated to supernatant liquor 990ml.This supernatant liquor of 963ml and the fresh cytomixis of 137ml are put in the 2L fermentor tank.Stir with 300rpm, pH controls and under 37 ℃ of temperature, bioconversion reaction takes place automatically.Pipette the about 1ml of sample every for some time, press the methods analyst of embodiment 3.

Table 2

	Time (hr)	??D-Asp ??(mg/ml)	??D-Asp ??(％)	??L-Asp ??(mg/ml)	??L-Asp ??(％)
						?0	??0.0000	??21.450	??100.00	??0.43000	??100.00
?1	??2.7500	??21.350	??99.534	??0.11000	??25.581
						?2	??13.500	??21.190	??98.788	??0.090000	??20.930
?3	??15.000	??20.770	??96.830	??0.080000	??18.605
						?4	??19.500	??21.480	??100.14	??0.090000	??20.930
?5	??23.500	??20.880	??97.343	??0.070000	??16.279
						?6	??39.000	??19.080	??88.951	??0.10000	??23.256
?7	??47.000	??17.280	??80.559	??0.16000	??37.209
						?8	??51.750	??17.010	??79.301	??0.23000	??53.488
?9	??68.500	??14.900	??69.464	??0.55000	??127.91

The data of diagram table 2 in Fig. 3.Although the concentration of L-aspartic acid is not high (0.43mg/ml) when t=0, during by 23.5 hours, concentration is reduced to zero (0.07mg/ml) basically.Can believe that the concentration increase of the L-aspartic acid that shows after 23.5 hours is owing to Evaporation, although can not get rid of synthetic that external enzyme accompanies.When reaction finishes (68.5 hours), the L-aspartic acid of 0.55mg/ml is only arranged.

Embodiment 5

Again the utilization of cell

Already used cell in embodiment 3 is placed in the fresh substrate, determines whether they still have activity.

Fresh D/L-aspartic acid substrate is by the method preparation of having described before among the embodiment 3.From the cell of embodiment 3, be suspended in again in the deionized water, add to 100ml.The pH of substrate (900ml, 0.5M D/L Asp) transfers to 7.0 with NaOH.After being placed in the fermentor tank of 2L, add cell (100ml).Do not have pH control, make substrate with deionized water.Pipette sample every certain hour, centrifugal, suitably dilute supernatant liquor, carry out D-and the acidity test of L-asparagine.Temperature is set in 37 ℃.

Table 3

	Time (hr)	??D-Asp ??(mg/ml)	??D-Asp ??(％)	????L-Asp ????(mg/ml)	??L-Asp ??(％)
						?0	??0.0000	??30.850	??100.00	????24.700	??100.00
?1	??6.2500	??30.820	??99.903	????17.130	??69.352
						?2	??15.250	??29.870	??96.823	????15.620	??63.239
?3	??25.750	??28.250	??91.572	????10.870	??44.008
						?4	??28.000	??27.980	??90.697	????9.5300	??38.583
?5	??44.250	??25.000	??81.037	????4.4200	??17.895
						?6	??63.500	??21.760	??70.535	????0.98000	??3.9676
?7	??65.000	??20.340	??65.932	????0.95000	??3.8462

In Fig. 4, also illustrate the data of table 3.These results show, even after circulation, L-aspartic acid-α-decarboxylase still has activity, so the result shows that this biological catalyst can recycle again.

Embodiment 6

The D/L aspartic acid is made substrate with at different enzyme cell loading capacitys

1.0M the D/L-aspartic acid is made substrate, measures the reaction to 2 kinds of enzyme cell loading capacitys, the cell of 100g/ml is appointed as reaction " A " at this, and the cell of 50g/ml is appointed as reaction " B " at this.

133.1g the D/L-aspartic acid is adjusted pH to 7.0 with about 600ml deionized water dissolving with NaOH, has used 100ml 10N NaOH and a spot of 1.0N NaOH.Amount of substrate among the reaction A is added to 963ml with deionized water.Reaction adds the cell that is stored in the 137ml in the cold house and begins.For reaction B, amount of substrate adds to cumulative volume 981.5ml.Reaction begins with the 65.0ml cell.

Two kinds are reflected in the 2L fermentor tank, and pH7.0 does not regulate pH continuously, carry out under 37 ℃.Pipette sample every certain hour, centrifugal, the dilution supernatant liquor is delivered the HPLC that carries out D-and L-aspartic acid and is analyzed.Table 4 shows the result of reaction A, and table 5 shows the result of reaction B.

Table 4

	Time (hr)	??L-Asp ??(mg/ml)	??L-Asp ??(％)	???D-Asp ???(mg/ml)	??D-Asp ??(％)
						???0	??0.0000	??53.600	??100.00	???54.850	??100.00
???1	??2.0000	??50.680	??94.552	???49.340	??89.954
						???2	??4.5000	??44.920	??83.806	???50.710	??92.452
???3	??7.0000	??42.260	??78.843	???50.230	??91.577
						???4	??22.500	??35.680	??66.567	???54.490	??99.344
???5	??24.000	??34.420	??64.216	???50.780	??92.580
						???6	??31.000	??32.660	??60.933	???51.450	??93.801
???7	??37.500	??27.950	??52.146	???53.850	??98.177
						???8	??47.000	??20.710	??38.638	???52.370	??95.479
???9	??50.500	??18.490	??34.496	???51.080	??93.127
						??10	??53.800	??13.730	??25.616	???46.500	??84.777
??11	??58.000	??13.410	??25.019	???50.040	??91.231
						??12	??70.000	??6.1300	??11.437	???52.400	??95.533
??13	??72.000	??5.3900	??10.056	???50.430	??91.942

Table 5

	Time (hr)	??L-Asp ??(mg/ml)	??L-Asp ??(％)	???D-Asp ???(mg/ml)	??D-Asp ??(％)
						???0	??0.0000	??56.730	??100.00	???57.440	??100.00
???1	??2.0000	??52.420	??92.403	???53.770	??93.611
						???2	??4.5000	??51.340	??90.499	???52.310	??91.069
???3	??7.0000	??50.470	??88.965	???53.860	??93.767
						???4	??22.500	??44.260	??78.019	???53.650	??93.402
???5	??24.000	??44.280	??78.054	???53.460	??93.071
						???6	??31.000	??40.590	??71.549	???51.740	??90.077
???7	??37.500	??38.650	??68.130	???55.000	??95.752
						???8	??47.000	??35.420	??62.436	???53.410	??92.984
???9	??50.500	??34.920	??61.555	???54.310	??94.551
						??10	??53.800	??31.780	??56.020	???55.060	??95.857
??11	??58.000	??30.860	??54.398	???53.420	??93.001
						??12	??70.000	??24.300	??42.834	???54.060	??94.116
??13	??72.000	??26.830	??47.294	???54.230	??94.412

The data of diagram table 4 and table 5 in Fig. 5.The result shows that the transformation efficiency of 100g/l is faster than 50g/l.Yet the transformation efficiency under the concentration of substrate of 1.0M D/L-aspartic acid is than slow at the 0.5M concentration of substrate.(seeing embodiment 3 and Fig. 2).In addition, the 1.0M substrate is after following 72.0 hours, and the L-aspartic acid is reduced to 5.39mg/ml from initial concentration 53.6mg/ml, and reduced rate is 90%.

Embodiment 7

L-aspartic acid-α-decarboxylase NH ₄Among the OH and substrate

This embodiment shows, by the working method of front embodiment, uses NH ₄OH replaces NaOH, in and the influence of substrate D/L-aspartic acid.Cell freezing is stored in-80 ℃.

133.1g D/L-aspartic acid (1mol) is dissolved in the deionized water of about 600ml, uses dense NH ₄OH transfers pH to about 7.The final volume of substrate reaches 963ml, adds the cell of the fresh thawing of 137ml then.Mixture is placed in the fermentor tank of 2L, and temperature is adjusted to 37 ℃.Without automatic temp control, yet, pipette sample monitoring pH value, use 50%NH ₄OH transfers pH.Pipette the about 1ml of sample every certain hour, centrifugal, supernatant liquor refrigerated storage before the dilution is carried out HPLC and is analyzed.

Table 6

	Time (hr)	???L-Asp ???(mg/ml)	??L-Asp ??(％)	??D-Asp ??(mg/ml)	??D-Asp ??(％)
						?0	??0.0000	???55.260	??100.00	??55.740	??100.00
?1	??3.0000	???54.670	??98.932	??53.380	??95.766
						?2	??6.0000	???49.100	??88.853	??56.370	??101.13
?3	??9.0000	???47.810	??86.518	??56.680	??101.69
						?4	??19.000	???43.490	??78.701	??59.270	??106.33
?5	??23.500	???39.120	??70.793	??54.930	??98.547
						?6	??28.000	???36.290	??65.671	??52.620	??94.403
?7	??32.500	???33.540	??60.695	??50.900	??91.317
						?8	??43.000	???30.37	??54.958	??53.520	??96.017
?9	??49.000	???21.580	??39.052	??51.100	??91.676

Data in Fig. 6 in the diagram table 6.With Na ⁺Salt is compared, and is using NH ₄ ⁺The L-Asp utilization ratio is slower during salt.

Embodiment 8

L-aspartic acid-α-decarboxylase is at the activity of D/L-glutamine and D/L-L-Ala

Present embodiment shows L-aspartic acid-α-decarboxylase at 2 kinds of potential amino acid substrate, the activity of D/L-glutamine and D/L-L-Ala.The D/L-aspartic acid is with comparing.

The preparation of substrate by solid amino acid racemic mixture is dissolved in the deionized water of about 75ml, is adjusted pH to 7.0 with 10N NaOH and is carried out.Then, add volume to 100ml with deionized water.Used cell freezing was stored about 1 month, melted then, before experimentizing, was stored in the refrigerator about 1 month.

Reaction is undertaken by the described same procedure of front embodiment.Pipette the about 0.20ml of supernatant samples every certain hour, centrifugal, refrigerated storage before HPLC analyzes is carried out HPLC by the method described in the embodiment of front and is analyzed.Table 7 shows reaction result.

Table 7

	Time (hr)	??L-Glu ??(mg/ml)	????D-Glu ????(mg/ml)	????L-Ala ????(mg/ml)	???D-Ala ???(mg/ml)	?L-Glu ?(％)	??D-Glu ??(％)	??L-Ala ??(％)	??D-Ala ??(％)	???L-Asp ???(mg/ml)	???O-Asp ???(mg/ml)	??L-Asp ??(％)	??D-Asp ??(％)
														??0	??0	??29.350	????29.440	????19.320	???19.190	?100.00	??100.00	??100.00	??100.00	???26.810	???29.890	??100.0	??100.0
??1	??3.5	??28.400	????29.010	????18.960	???18.590	?96.763	??98.539	??98.137	??96.873	???14.050	???29.850	??52.406	??99.866
														??2	??8.5	??28.740	????29.520	????18.730	???18.370	?97.922	??100.27	??96.946	??95.727	???12.660	???29.900	??47.221	??100.03
??3	??24	??28.200	????29.350	????18.320	???17.930	?96.082	??99.694	??94.824	??93.434	???9.4700	???29.740	??35.323	??99.498
														??4	??55	??28.000	????29.840	????17.830	???17.580	?95.400	??101.36	??92.288	??91.610	???0.3300	???30.120	??1.2309	??100.77

The data of diagram table 7 in Fig. 7, the result shows, in used all isomer substrates except the L-aspartic acid, the specificity of the method for claim and enzyme prepared product, in the presence of enzyme, all stablized constantly until 55 hours, show that the L-aspartic acid is unique substrate of this enzyme.The L-aspartic acid as whole detailed process explanation, is reduced to 1.23% of starting raw material amount.

Embodiment 9

Temperature studies

Present embodiment shows that L-aspartic acid-α-decarboxylase is reflected at the activity of 37 ℃, 45 ℃ and 50 ℃

133.1g D/L-aspartic acid (1mol) is with deionized water dissolving, adjust pH to 7.0 with 10NNaOH.Be approximately 100ml.Fresh cell from-80 ℃ of thawings, being added to final concentration is 100g/l.With 3 2L fermentor tanks, the cell of each fermentor tank filling 963ml substrate solution and 137ml is heated to 37 ℃ and 45 ℃ then under 300rpm stirs, perhaps be heated to 50 ℃ under 450rpm stirs.Pipette the about 1ml of sample every certain hour, transfer pH to 7.0 with NaOH or HCl.Centrifugal remove cell after, measure the D-of supernatant liquor and the content of L-aspartic acid.

Reaction result under table 8 shows 37 ℃, table 9 shows 45 ℃ reaction result, table 10 shows 50 ℃ reaction result.

Table 8

	Time (hr)	??D-Asp ??(mg/ml)	?D-Asp ?(％)	???L-Asp ???(mg/ml)	?L-Asp ?(％)
						??0	?0.0000	??55.000	?100.00	???53.700	?100.00
??1	?2.5000	??54.310	?98.745	???48.940	?91.136
						??2	?4.0000	??54.440	?98.982	???47.600	?88.641
??3	?6.0000	??54.470	?99.036	???46.170	?85.978
						??4	?8.0000	??54.760	?99.564	???44.810	?83.445
??5	?10.000	??55.840	?101.53	???42.120	?78.436
						??6	?12.000	??56.760	?103.20	???42.120	?78.462
??7	?20.000	??55.460	?100.84	???35.960	?66.965
						??8	?24.000	??55.390	?100.71	???34.840	?64.879
??9	?29.000	??53.990	?98.164	???28.040	?54.078
						?10	?34.000	??53.440	?97.164	???28.040	?54.078
?11	?44.000	??52.960	?96.291	???21.670	?40.354
						?12	?48.000	??52.940	?96.255	???18.440	?34.339
?13	?68.000	??49.940	?90.800	???5.9700	?11.117
						?14	?92.000	??50.670	?92.127	???0.91500	?1.7039

Table 9

	Time (hr)	??D-Asp ??(mg/ml)	?D-Asp ?(％)	???L-Asp ???(mg/ml)	?L-Asp ?(％)
						??0	?0.000	??55.280	?100.00	???54.410	?100.00
??1	?2.5000	??54.820	?99.168	???50.100	?92.079
						??2	?4.0000	??53.960	?97.612	???47.110	?86.583
??3	?6.0000	??53.460	?96.708	???43.130	?79.269
						??4	?8.0000	??54.040	?97.757	???39.310	?72.248
??5	?10.000	??54.870	?99.258	???36.800	?67.635
						??6	?12.000	??54.060	?97.793	???34.540	?63.481
??7	?20.000	??52.360	?94.718	???24.690	?45.378
						??8	?24.000	??51.310	?92.818	???23.210	?42.658
??9	?29.000	??53.830	?97.377	???21.700	?39.882
						?10	?34.000	??52.880	?95.658	???19.310	?35.490
?11	?44.000	??53.640	?97.033	???15.800	?29.039
						?12	?48.000	??52.730	?95.387	???16.700	?30.822
?13	?68.000	??53.560	?96.889	???16.050	?29.498
						?14	?92.000	??53.560	?96.889	???13.370	?24.573

Table 10

	Time (hr)	???D-Asp ???(mg/ml)	?D-Asp ?(％)	??L-Asp ??(mg/ml)	?L-Asp ?(％)
						??0	?0.000	???54.89	?48.47	??100.0	?100.0
??1	?1.000	???54.30	?52.78	??98.93	?108.9
						??2	?3.000	???58.01	?40.61	??105.7	?83.78
??3	?5.0000	???58.16	?36.97	??106.0	?73.63
						??4	?7.000	???58.51	?35.69	??106.6	?73.63
??5	?9.000	???58.88	?33.99	??107.3	?70.13
						??6	?13.50	???59.62	?34.19	??108.4	?70.54
??7	?23.00	???56.71	?31.98	??103.3	?65.98
						??8	?25.00	???59.85	?31.86	??109.0	?65.73
??9	?27.00	???56.87	?26.89	??103.6	?55.48
						?10	?32.00	???57.30	?25.85	??104.4	?53.33
?11	?37.50	???58.48	?27.54	??106.5	?58.82
						?12	?47.00	???57.93	?25.58	??105.5	?52.77
?13	?52.00	???58.74	?27.28	??107.0	?56.28
						?14	?57.00	???65.56	?32.42	??119.4	?66.89
?15	?71.00	???57.17	?25.52	??104.2	?52.65
						?16	?77.00	???57.85	?25.86	??105.4	?53.35
?17	?81.00	???57.41	?25.54	??104.6	?52.69
						?18	?99.75	???59.36	?26.14	??108.1	?53.93

In Fig. 8, illustrate table 8,9 and 10 data together.These results show that under all 3 kinds of temperature, the D-isomer is stablized constant.Under 37 ℃, L-isomer to 99.75 hour almost completely is consumed.Under 45 ℃ and 50 ℃, show that initial rate increases with comparatively high temps, but as if after time expand, enzyme become instability and inactivation.Though to the method and composition of this claim, moderate temperature is preferred, speed of reaction can increase by improving temperature of reaction.

Claims (36)

1. method for preparing the D-aspartic acid, this method is included under the condition of suitable generation D-aspartic acid and Beta-alanine, D, the solution of L-aspartic acid or its salt contacts with the composition that comprises microorganism cells or its extract, and wherein the activity of the L-aspartic acid-α-decarboxylase of composition spends 100 μ mol L-aspartic acids greater than every gram cell per hour.

2. the process of claim 1 wherein that the L-aspartic acid-α-decarboxylase of composition per hour is approximately the L-aspartic acid that every gram cell spends 100～2000 μ mol.

3. the process of claim 1 wherein that the L-aspartic acid-α-decarboxylase of composition per hour is approximately the L-aspartic acid that every gram cell spends 100～1000 μ mol.

4. the process of claim 1 wherein that composition comprises microbial cell or the cell extract with the panD gene transformation of coding L-aspartic acid-α-decarboxylase.

5. the method for claim 4, biology wherein is a bacterium.

6. the method for claim 5, bacterium wherein is the bacterium that is selected from Colibacter, bacillus, klebsiella family, Rhodopseudomonas, salmonella, proteus, Azotobacter and rhizobium.

7. the method for claim 6, wherein bacterium is an intestinal bacteria W3110 bacterial strain.

8. the method for claim 4, wherein the panD gene source is in the bacterium that is selected from intestinal bacteria B strain, e. coli k12 strain, intestinal bacteria NIHJ strain, intestinal bacteria Tennessee strain, proteus vulgaris, cadaverine bacillus, azotobacter vinelandii, rhizobium leguminosarum and clover rhizobia.

9. the method for claim 7, wherein bacterium is an e. coli k12 strain.

10. the method for claim 4, wherein composition comprises cell or the cell extract of intestinal bacteria NS3291.

11. the contact that the process of claim 1 wherein is included in incubation D under the pH of about 4 ℃～70 ℃ temperature and about 2～12, L-aspartic acid or its salt and said composition.

12. the method for claim 11, contact wherein are included in incubation D under envrionment temperature and the about pH7.0, L-aspartic acid or its salt and composition.

13. the process of claim 1 wherein that composition comprises cell or the cell extract that is fixed on the activated substrate.

14. the method for claim 13, wherein activated substrate is selected from sintered glass, porous ceramics, bentonite, diatomite, gac, agarose and agarose derivative, Mierocrystalline cellulose and derivatived cellulose, polyacrylamide, polyacrylamide derivative, poly-azetidine, alginate, carrageenan and Chromosorb.

15. a method for preparing the D-aspartic acid comprises (a) preparation D, the aqueous solution of L-aspartic acid or its salt; (b) D, the aqueous solution of L-aspartic acid or its salt, under about 4 ℃～70 ℃ temperature and about 2～12pH, with the composition incubation, the L-aspartic acid-α-decarboxylase of said composition spends the L-aspartic acid of 100 μ mol greater than every gram cell per hour; And (c) regain D-aspartic acid and Beta-alanine.

16. the method for claim 15, wherein the activity of the L-aspartic acid-α-decarboxylase of composition per hour is approximately the L-aspartic acid that every gram cell spends 100～2000 μ mol.

17. the method for claim 15, wherein the activity of the L-aspartic acid-α-decarboxylase of composition per hour is approximately the L-aspartic acid that every gram cell spends 100～1000 μ mol.

18. the method for claim 15, wherein composition comprises cell or the cell extract of a kind of organism of the gene transformation with coding L-aspartic acid-α-decarboxylase.

19. the method for claim 17, organism wherein is a bacterium.

20. the method for claim 19, bacterium wherein are selected from Colibacter, bacillus, klebsiella family, Rhodopseudomonas, salmonella, proteus, Azotobacter and rhizobium.

21. the method for claim 20, bacterium wherein are intestinal bacteria W3110 bacterial strains.

22. the method for claim 18, wherein the panD gene source is in the bacterium that is selected from intestinal bacteria B strain, e. coli k12 strain, intestinal bacteria NIHJ strain, intestinal bacteria Tennessee strain, proteus vulgaris, cadaverine bacillus, azotobacter vinelandii, rhizobium leguminosarum and clover rhizobia.

23. the method for claim 22, wherein cell is an e. coli k12 strain.

24. the method for claim 18, wherein composition comprises cell or the cell extract of intestinal bacteria NS3291.

25. the method for claim 15, contact wherein are included in incubation D under envrionment temperature and the about pH7.0, L-aspartic acid or its salt and composition.

26. composition, its L-aspartic acid-α-decarboxylase spend the L-aspartic acid of 100 μ mol greater than every gram cell per hour.

27. the composition of claim 26 comprises that with carrier microorganism transformed cell or cell extract this carrier includes the panD gene of coding L-aspartic acid-α-decarboxylase.

28. the composition of claim 27, wherein carrier is a plasmid.

29. the composition of claim 28, wherein plasmid is pIF309.

30. the composition of claim 27, microorganism wherein is a bacterium.

31. the composition of claim 30, wherein bacterium is selected from the bacterium of Colibacter, bacillus, klebsiella family, Rhodopseudomonas, salmonella, proteus, Azotobacter and rhizobium.

32. the method for claim 31, wherein bacterium is an e. coli k12 strain.

33. the composition of claim 27, wherein the panD gene source is in the bacterium that is selected from intestinal bacteria B strain, e. coli k12 strain, intestinal bacteria NIHJ strain, intestinal bacteria Tennessee strain, proteus vulgaris, cadaverine bacillus, azotobacter vinelandii, rhizobium leguminosarum and clover rhizobia.

34. the composition of claim 27, said composition comprise cell or the cell extract of intestinal bacteria NS3291.

35. the composition of claim 26, wherein the activity of the L-aspartic acid-α-decarboxylase of said composition per hour is approximately the L-aspartic acid that every gram cell spends 100～2000 μ mol.

36. the composition of claim 26, wherein the activity of the L-aspartic acid-α-decarboxylase of said composition per hour is approximately the L-aspartic acid that every gram cell spends 100～1000 μ mol.

Images