CN1241636A - Nuclease plasmid resisting HPV16E6 and its application in treatment of human papilloma virus and tumor - Google Patents
Nuclease plasmid resisting HPV16E6 and its application in treatment of human papilloma virus and tumor Download PDFInfo
- Publication number
- CN1241636A CN1241636A CN 99116265 CN99116265A CN1241636A CN 1241636 A CN1241636 A CN 1241636A CN 99116265 CN99116265 CN 99116265 CN 99116265 A CN99116265 A CN 99116265A CN 1241636 A CN1241636 A CN 1241636A
- Authority
- CN
- China
- Prior art keywords
- ribozyme
- cell
- gene
- plasmid
- caski
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The plasmid may be dissolved in solution compounded with water, TE or other buffering liquid and may be produced into dry powder through freeze drying. It can block HPV16E6 gene expression in the RNA level, block the cell period development of HPV-relating tumor, induce tumor cell to wither, reverse partially the malignant phenotype of cervix cancer and other tumor, and make tumor cells easy to be killed by immunocyte. It may be used in the treatment and research of human papilloma virus and relative tumors, such as cervix cancer, stomatic cancer and laryngeal cancer.
Description
The present invention relates to contain the eukaryon expression plasmid of anti-HPV16E6 ribozyme gene, can be used for human papillomavirus and related neoplasms thereof, as the treatment of cervical cancer, oral carcinoma, laryngocarcinoma etc.
At present, human papillomavirus (HPV, Human Papillomaviruses) be the human tumor virus disease because of in an of paramount importance viroid.High-risk HPV easily causes malignant tumour, and closely related with morbidities such as cervical cancer, penile cancer, oral carcinoma, laryngocarcinoma and skin carcinomas, wherein modal type is HPV
16And HPV
18Ribozyme (Ribozyme) is meant the RNA molecule of catalytic activity, and it can be effectively, sequence specific ground cutting target RNA.Because Ribozyme can cut target RNA in sequence-specific ground, thus can be in mRNA level blocking-up target gene expression.Research shows, main and its E of the carinogenicity of HPV
6, E
7Gene is relevant.Therefore this research and design, synthesized anti-HPV16E6 ribozyme, its target site is the 170th site on the HPV16E6 gene, and it is cloned in eukaryon expression plasmid PcDNA3.Do not see the research report of relevant anti-HPV16E6 ribozyme at present both at home and abroad as yet.
The purpose of this invention is to provide a kind of eukaryon expression plasmid that can be used to treat and study containing of human papillomavirus and related neoplasms thereof of anti-HPV16E6 ribozyme gene.
We are with HPV16E
6Gene is a target gene, has designed its ribozyme of the special cutting of energy, and has carried out clone, expression and activity identification; Confirm this anti-HPV16E
6Ribozyme can be effectively, sequence specific ground cutting HPV16E
6MRNA.Plasmid can be applicable to human papillomavirus and relative disease thereof, as cervical cancer, laryngocarcinoma, oral carcinoma etc., treatment and research.Cell and experimentation on animals confirm, anti-HPV16E
6Ribozyme can be blocked HPV16E at rna level
6Expression of gene, the cell cycle progress of blocking-up HPV related neoplasms, inducing apoptosis of tumour cell, part reverses the malignant phenotype of tumours such as cervical cancer, therefore can be used for tumor treatment such as cervical cancer, oral carcinoma, laryngocarcinoma.Be research tool on the other hand with the ribozyme,, can study the variation of cellular oncogene, cancer suppressor gene, signal transduction mechanism, thereby deeply inquire into the carcinogenic mechanism of HPV by the expression of blocking-up oncogene.
Anti-HPV16E
6The effective concentration 0.1ug/ul-100ug/ul of ribozyme plasmid, optimum concn 0.1ug/ul-10ug/ul.
Source of the present invention:
(1) design: with HPV
16Gene order is an analytical sequence, adopts computer software at HPV16E6 gene design specificity hammerhead ribozyme.
(2) synthetic anti-16HRz ribozyme gene (each two chain), and introduce restriction enzyme site, so that clone's assembling.A.5’CTAGATATCATGTACTGATGAGTCCGTGAGGACGAAAGTTGTTTGGGTAC3’
Xba?I Kpn?IB.5’CCAAACAACTTTCGTCCTCACGGACTCATCAGTACATGATAT3’
(3) will resist 16HRz ribozyme gene to pack in the prokaryotic expression plasmid, carry out the external cutting experiment of ribozyme, then again ribozyme gene be packed in the eukaryon expression plasmid (PcDNA3), be built into anti-HPV16E
6The ribozyme plasmid.This plasmid carries by means of liposome or virus vector etc., is used for human papillomavirus and related neoplasms thereof, as cervical cancer, laryngocarcinoma, oral carcinoma etc., treatment and research.
The example in detail of the following stated the preparation of the embodiment of the invention 1 experiment material: 1.pc16Rz, pcDNA3 plasmid: pRSV-Rz523 is the eukaryon expression plasmid of anti-HPV16E6 ribozyme, pcDNA3 is the eukaryon expression plasmid of no goal gene, it is transformed the JM105 recipient bacterium, a large amount of preparations and purifying.2.CaSKi the cultivation of cell, HL60 cell, K562 cell: the CaSKi cell is the strain of HPV16 male human cervical carcinoma cell: HL60 cell behaviour granulocyte leukemia cell strain is a NK opposing cell; The K562 cell is human erythroleukemia cell's strain, is the NK sensitive cells.More than three kinds of cells by the cultivation of going down to posterity of this chamber.3. animal: 4 age in week nude mice, female, body weight 20-26 gram is provided by No.1 Military Medical Univ.'s animal center.4. main agents: G418, MTT, HPV16E6 monoclonal antibody, the bcl-2 of FITC mark, c-myc, fas, p-53 monoclonal antibody.Experimental technique:
1. transfection CaSKi cell: with liposome method is pc16Rz, the pcDNA3 transfection CaSKi cell respectively of 10ug/ul with concentration, by G418 (400ug/ml) resistance screening, with positive colony cell amplification and preservation, called after CaSKi-R, CaSKi-P cell respectively.Detect the expression of anti-HPV16E6 ribozyme in CaSKi-R, CaSKi-P cell with RNA dot blot method, the result confirms can stably express in the anti-CaSKi-R cell.
2. the CaSKi characteristics of cell biology of transfection is observed: the form of observation of cell and growth conditions under inverted microscope, measure cell growth curve, measure cell soft-agar cloning rate of formation, and by the proteic expression of HPV16E6 in the CaSKi cell of immunohistochemical methods SABC method and Flow cytometry transfection.CaSKi, CaSKi-R, CaSKi-P cell growth rate are close.Compare with the CaSKi cell, CaSKi-R cell expressing HPV16E6 albumen obviously reduces, and the soft-agar cloning rate of formation significantly reduces, and the CaSKi-P cell does not have this change.
3. CaSKi, CaSKi-R, CaSKi-P cell are collected according to a conventional method, the upflowing cell instrument detects, and every routine sample is surveyed 5,000 nucleus, and detected result is transported to computer and is for data processing, and special software is made cell cycle analysis.Found that the CaSKi-R apoptosis rate is apparently higher than CaSKi and CaSKi-P.Utilize the changing conditions of cells were tested by flow cytometry CaSKi, CaSKi-R, CaSKi-P three kinds of cell bcl-2, c-myc, genetic expressions such as fas, p-53, find that the expression of said gene all changes.Compare with the CaSKi cell, CaSKi-R cell bcl-2 expresses reduction, and c-myc expresses enhancing, and fas expresses enhancing, and p-53 expresses enhancing.And CaSKi-P compares with CaSKi, and said gene is expressed not have obviously and changed.Result of study confirms that the transfection ribozyme can raise the expression of c-myc, fas, p-53, reduces the expression of bcl-2, thereby starts apoptosis mechanism, promotes apoptosis of tumor cells.
4. the killing activity of immunologically competent cell detects: induce from healthy human blood and prepare immunocompetence NK, LAK, CD3AK cell, and induce CaSKi, CaSKi-R cell and rIL-2 co-activation killer cell (claiming CASKI and CASKI-R cell) respectively, with their action effect cells (being called for short E).With CaSKi-R, CaSKi-P, CaSKi, K562 and HL60 cell is target cell (being called for short T), getting effect target ratio was respectively 20: 1,10: 1,5: 1,2.5: 1,1: 1, mixed culture is mixed MTT (1mg/ml) after 24 hours in 96 orifice plates, with independent effector cell and target cell is contrast, and three multiple holes are all established in each experiment.The MTT effect adds the Virahol vibration after 4 hours, survey the 570nmOD value, gets each experiment OD570 value mean, calculates the effector cell and kills and wounds percentage, relatively killing activity.NK, LAK, CD3AK cell are significantly higher than the CaSKi cell to CaSKi-R cell killing rate, and CaSKi, CaSKi-R do not have significant difference with the killing activity of rIL-2 co-activation killer cell respectively, and the killing activity of CaSKi-R is higher than the CaSKi cell.
5. nude mice becomes the knurl experiment: get some amount, exponential phase growth, vigor at the CaSKi more than 95%, CaSKi-R, CaSKi-P cell, be inoculated in the big leg outer side intracutaneous of nude mice right hind successively, about 1 * 10
6Individual oncocyte; To becoming the knurl situation to observe weekly 2 times, observed for 6 weeks altogether after the tumour transplatation, the length of record tumour, wide.Found that the one-tenth knurl ability of CaSKi-R cell significantly is lower than the CaSKi cell, and CaSKi-P becomes the knurl ability not have significant difference with the CaSKi cell.
Embodiment 2:
With concentration is pc16Rz, the pcDNA3 plasmid difference transfection CaSKi cell of 0.1ug/ul, carries out (1) cell growth curve according to the method for embodiment 1 then and measures and morphological observation; (2) cell soft-agar cloning rate forms experiment; (3) apoptosis rate is measured and the apoptogene analysis; (4) immunologically competent cell killing experiments; (5) nude mice becomes the knurl experiment.Can draw to draw a conclusion: the pc16Rz of 0.1ug/ul can reduce tumour cell soft-agar cloning rate of formation, improve the apoptosis of tumor cells rate, start apoptogene, improve the susceptibility that tumour cell kills and wounds immunologically competent cell, reduce tumour cell in the intravital one-tenth knurl of nude mice ability.
Embodiment 3:
With concentration is pc16Rz, the pcDNA3 plasmid difference transfection CaSKi cell of 100ug/ul, carries out (1) cell growth curve according to the method for embodiment 1 then and measures and morphological observation; (2) cell soft-agar cloning rate forms experiment; (3) apoptosis rate is measured and the apoptogene analysis; (4) immunologically competent cell killing experiments; (5) nude mice becomes the knurl experiment.Can draw to draw a conclusion: the pc16Rz of 10ug/ul can reduce tumour cell soft-agar cloning rate of formation, improve the apoptosis of tumor cells rate, start apoptogene, improve the susceptibility that tumour cell kills and wounds immunologically competent cell, reduce tumour cell in the intravital one-tenth knurl of nude mice ability.
Claims (4)
1. the eukaryon expression plasmid of anti-HPV16E6 (HPV 16 E6 gene) ribozyme is characterized in that: (1) design: with HPV
16Gene order is an analytical sequence, adopts computer software at HPV16E6 gene design specificity hammerhead ribozyme, and the target site of this ribozyme is 170 sites on the E6 gene.(2) synthetic anti-16HRz ribozyme gene (each two chain), and introduce restriction enzyme site, so that clone's assembling.A.5’CTAGATATCATGTACTGATGAGTCCGTGAGGACGAAAGTTGTTTGGGTAC3’
Xba I Kpn IB.5 ' CCAAACAACTTTCGTCCTCACGGACTCATCAGTACATGATAT3 ' (3) will resist 16HRz ribozyme gene to pack in the prokaryotic expression plasmid, carry out the external cutting experiment of ribozyme, this ribozyme gene is cloned in carrier for expression of eukaryon such as PcDNA3, constitute the eukaryon expression plasmid of anti-HPV16E6 ribozyme.Damping fluid such as water soluble or TE wiring solution-forming, or make dry powder with freeze-drying.
2. according to the described plasmid of claim 1, it is characterized in that effective concentration 0.1ug/ul-100ug/ul. in the solution
3. according to the described plasmid of claim 1, it is characterized in that optimum concn 0.1ug/ul-10ug/ul. in the solution
4. according to the described plasmid of claim 1 to 3, this plasmid carries by means of carriers such as liposome or virus, is used for human papillomavirus and relative disease thereof, as cervical cancer, laryngocarcinoma, oral carcinoma etc., treatment and research.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 99116265 CN1241636A (en) | 1999-07-05 | 1999-07-05 | Nuclease plasmid resisting HPV16E6 and its application in treatment of human papilloma virus and tumor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 99116265 CN1241636A (en) | 1999-07-05 | 1999-07-05 | Nuclease plasmid resisting HPV16E6 and its application in treatment of human papilloma virus and tumor |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1241636A true CN1241636A (en) | 2000-01-19 |
Family
ID=5279100
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 99116265 Pending CN1241636A (en) | 1999-07-05 | 1999-07-05 | Nuclease plasmid resisting HPV16E6 and its application in treatment of human papilloma virus and tumor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1241636A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002092796A1 (en) * | 2001-05-15 | 2002-11-21 | Liang Qiao | Papilloma pseud-virus and it's preparation |
| CN1293093C (en) * | 2002-08-30 | 2007-01-03 | 马润林 | Pronucleus preparation of nipple tumour virus capsid protein and application |
| CN104404076A (en) * | 2014-11-04 | 2015-03-11 | 珠海雅马生物工程有限公司 | Method for knockout of human papillomavirus E6E7 gene by zinc finger nucleases |
-
1999
- 1999-07-05 CN CN 99116265 patent/CN1241636A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002092796A1 (en) * | 2001-05-15 | 2002-11-21 | Liang Qiao | Papilloma pseud-virus and it's preparation |
| US8129144B2 (en) | 2001-05-15 | 2012-03-06 | Loyola University Chicago | Papilloma pseudovirus and preparation |
| CN1293093C (en) * | 2002-08-30 | 2007-01-03 | 马润林 | Pronucleus preparation of nipple tumour virus capsid protein and application |
| CN104404076A (en) * | 2014-11-04 | 2015-03-11 | 珠海雅马生物工程有限公司 | Method for knockout of human papillomavirus E6E7 gene by zinc finger nucleases |
| CN104404076B (en) * | 2014-11-04 | 2017-10-03 | 珠海雅马生物工程有限公司 | The method that human papillomavirus E 6/E 7 gene is knocked out using Zinc finger nuclease |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lowy et al. | In vitro tumorigenic transformation by a defined sub-genomic fragment of bovine papilloma virus DNA | |
| Beaudenon et al. | A novel type of human papillomavirus associated with genital neoplasias | |
| Tsunokawa et al. | Transforming activity of human papillomavirus type 16 DNA sequence in a cervical cancer. | |
| EP0931830B1 (en) | Cytopathic viruses for therapy and phophylaxis of neoplasia | |
| LaPorta et al. | Human papilloma viral DNA replicates as a stable episome in cultured epidermal keratinocytes. | |
| Terrier et al. | Structure and expression of c-myc and c-fos proto-oncogenes in thyroid carcinomas | |
| Salazar et al. | Induction of p53 protein expression by sodium arsenite | |
| US20200276252A1 (en) | Isolated Recombinant Oncolytic Adenoviruses, Pharmaceutical Compositions, and Uses Thereof for Drugs for Treatment of Tumors and/or Cancers | |
| CA2273825C (en) | Cytopathic viruses for therapy and prophylaxis of neoplasia | |
| Agarwal et al. | Interferon and retinoic acid suppress the growth of human papillomavirus type 16 immortalized cervical epithelial cells, but only interferon suppresses the level of the human papillomavirus transforming oncogenes | |
| Schell et al. | Verrucous carcinoma of the foot associated with human papillomavirus type 16 | |
| CN111303265B (en) | One kind contains131I-labeled Caerin1.1 polypeptide and application thereof | |
| CN110248671A (en) | Therapeutic agent comprising oncolytic poxvirus and NK cell and its application in the drug for the treatment of tumour and/or cancer | |
| CN110101664A (en) | For delivering the system of nucleic acid drug and preparation method thereof with specific cleavage HPV16 type gene function | |
| Munday et al. | Papillomaviral skin diseases of humans, dogs, cats and horses: A comparative review. Part 1: Papillomavirus biology and hyperplastic lesions | |
| Babaei et al. | Mesenchymal stem cells loaded with oncolytic reovirus enhances antitumor activity in mice models of colorectal cancer | |
| Sato et al. | N-propionyl-cysteaminylphenol-magnetite conjugate (NPrCAP/M) is a nanoparticle for the targeted growth suppression of melanoma cells | |
| Liu et al. | Systemic genetic transfer of p21WAF− 1 and GM-CSF utilizing of a novel oligopeptide-based EGF receptor targeting polyplex | |
| CN1241636A (en) | Nuclease plasmid resisting HPV16E6 and its application in treatment of human papilloma virus and tumor | |
| Gómez-Navarro et al. | Gene therapy for carcinoma of the breast: Pro-apoptotic gene therapy | |
| Kamiński et al. | Increased natural killer cell activity in patients with epidermodysplasia verruciformis | |
| Mathew et al. | Immortalized mouse epithelial cell models to study the role of apoptosis in cancer | |
| ES2288318T3 (en) | USE OF DNA-PK. | |
| CN109453392A (en) | Line interactions between protein protein inhibitor and its purposes in the preparation of antitumor drugs | |
| Robinson et al. | Tumorigenicity and other properties of cells from ten continuous human esophageal carcinoma cell lines in nude mice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |