CN1225839A - Diagnosis reagent for blood cardiac muscle myosin light chain I of myocardiac infarction - Google Patents

Abstract

The blood myocaridal myosin light-chain I diagnostic reagent mainly includes the high expression product of human myocardial myosin light-chain I gene in the colibacillus as positive control and single antibody and multiple antibody prepared by using said expression product as antigen. Said diagnostic method is of double-antibody sandwich method, i. e. uses the immobilized single antibody to trap the antigen being in the tested serum-myocardial myosin light-chain I, and ues the multiple antibody as testing antibody, so that according to the ELISA reading value measured after the reaction of enzyme and substrate and cut off value provided by said invention, if it is greater than cut off value, it is determined as pathogenic stage of acute myocardial infarction.

Description

The diagnosis reagent for blood cardiac muscle myosin light chain I of myocardial infarction

The present invention relates to the diagnostic reagent of human heart disease, especially about people's acute myocardial infarction, myocarditic new reagent for clinical diagnosis.

Cardiovascular disease is one of main disease of China, and particularly along with the increase of China resident aging degree, the mortality rate of acute myocardial infarction rises year by year, and the myocarditis case also greatly increases.At present, though the blood testing of acute myocardial infarction has clinical widely used creatine phosphokinase (CPK), lactic acid dehydrogenase (LDH) and glutamic oxaloacetic transaminase, GOT methods such as (GOT), but its early stage property, susceptiveness and persistency all can not satisfy clinical requirement, can only be suitable in two, three days after the patient falls ill, the phenomenon that causes the patient to die suddenly happens occasionally.Myocardial infarction sickness rate at home is very high, and particularly the northern area of China is much higher than south, reaches more than ten times.At present, because the raising that the increase of global aging degree has brought the cardiovascular disease incidence rate, this also provides vast market for the application of detectable.Therefore a kind of development of sensitivity, single-minded, early stage, persistent myocardial infarction detectable more becomes pressing for of domestic and international heart disease control and treatment.

Myosin is a kind of main structural protein in the muscle, plays an important role in muscle contraction, is made up of the light chain (light chain I and light chain II) that a heavy chain and two molecular weight are respectively 27KD and 20KD.Discover, because light chain in sour environment, easily dissociates from heavy chain.Early eighties, the Japan scientist at first finds, work as ischemia, when anoxia causes cardiac damage, cardiac muscular tissue's cardiac muscle myosin light chain that constantly dissociates for a long time in blood, and the direct destructive process of reflecting myocardium of variation of phasic property at that time are because people's cardiac muscle light chain I is more stable in blood, therefore can be used as of detecting heart disease new with important biochemical indicator (Yamada T.et al., Am Heart J 1998 Feb; 135 (2 Pt 1): 329-34; Hisatomi K.et al., Thorac Cardiovasc Surg 1996 Dec; 44 (6): 296-9; Ravkilde J.et al., J Am Coll Cardiol 1995 Mar1; 25 (3): 574-81; Ravkilde J.et al., Cardiology 1994; 84 (2): 135-44; Uchino T.et al., J Cardiovasc Surg 1993, Dec; 34 (6): 517-22).

Since above-mentioned theory was set up, many laboratory attempts of Europe, the United States and Japan were applied to the antibodies radioimmunoassay of people's cardiac muscle myosin light chain on the mensuration of people's myocardial infarction case, had obtained satisfied result.Yet, the external report that small-scale application in the laboratory is only arranged so far, the formal diagnostic kit of producing of Shang Weijian, trace it to its cause and mainly be: 1) myosin has suitable special nature, to from cardiac muscle, isolate the myosin of q.s and carry out fractionation light, heavy chain, must possess the theoretical basis of sturdy muscle protein research; 2) as the detection kit, people's cardiac muscle myosin light chain must be arranged as antigen control, its source is very restricted.

For this reason, the purpose of this invention is to provide a kind of diagnosis reagent for blood cardiac muscle myosin light chain I of myocardial infarction, be applied in early stage property, persistence and the specificity aspect of this diagnostic reagent all are better than the detection method of use at present greatly.

Myocardial infarction blood cardiac muscle myosin light chain I provided by the invention (HCMLC I) diagnostic reagent comprises that mainly the high expressed product of HCMLC gene in escherichia coli is as positive control and this expression product monoclonal antibody and the multi-resistance as antigen preparation.The utilization of monoclonal antibody has improved the specificity of diagnostic reagent greatly; Replace radioimmunology with the ELISA assay method, make it not only to have higher sensitivity but also do not produce pollution, detection means is convenient and easy.

It is diagnostic method that the present invention adopts the double-antibody sandwich elisa method, with antigen--the cardiac muscle myosin light chain I in the immobilised monoclonal antibody Acquisition Detection serum, monoclonal antibody prepares the gene engineering expression product that used antigen is HCMLC, with the anti-cardiac muscle myosin light chain I of horseradish peroxidase-labeled as detecting antibody, according to the antigenic content in the change in color mensuration serum of enzyme-to-substrate reaction back, finally compare according to ELISA reading value and marginal value provided by the invention (cut off value), greater than cut off value, be judged as the period of disease of acute myocardial infarction.Be that example divides five parts that content of the present invention is described in detail in detail with Chinese's cardiac muscle myosin light chain I below.One. the preparation of the gene clone of Chinese's cardiac muscle myosin light chain I and the total RNA of sequencing 1. people cardiac muscle

Postoperative people's cardiac muscle is removed other tissue, and getting ventricular muscles is experiment material, adds the extraction buffer of pre-cooling, uses tissue mashing machine's homogenate, and centrifugal back gained supernatant phenol: chloroform: the extracting of isoamyl alcohol mixed liquor disappears until the Denatured protein layer.The acquisition precipitation was total RNA after water added dehydrated alcohol.2. the preparation of the total mRNA of people's cardiac muscle

Extractive total RNA fully mixed (vibration) rearmounted 0 ℃ of refrigerator insulation 3-4 hour with efficient 0ligo (dT) cellulose or spends the night, gentle agitation or vibration mixing again after the taking-up, centrifuged deposit is collected supernatant after containing the Tris eluting of KCl, obtain to be precipitated as the total mRNA of people's cardiac muscle after adding dehydrated alcohol.3. the cDNA of HCMLC makes up

Gene order (the G.Jackowski of the HCMLC of delivering in 1988 according to Canadian G.Jackowski, Nucleic Acid Research, 1988), the synthetic gene 3 ' end and 5 ' with HCMLC of design is held corresponding two primers (5 ' GGAATTCCTTAGCTGGACATGATGT 3 ' and 5 ' GGAATTCCATGGCCCCCAAAAAGCC 3 '), and at the synthetic joint that connects restricted enzyme EcoRI simultaneously of primer.Extractive total mRNA takes out through AMV reverse transcriptase reverse transcription phenol, and ethanol precipitation obtains cDNA.4.cDNA polymerase chain reaction (PCR) amplification and clone

The pcr amplification of cDNA carries out (referring to molecular cloning operating guidance, T.Maniatis, E.F.Fritsch with above-mentioned two primers, J.Sambrook, 1989), PCR product (Fig. 1) is after the hydrolysis of restricted enzyme EcoR I, it is cloned the into EcoR I site of carrier puc19, check order waiting.5. the gene sequencing of HCMLC

Operate by the molecular cloning operating guidance of T.Maniatis with " dideoxy " mensuration of standard order, its result contains 588 bases as shown in Figure 2 altogether, and the aminoacid sequence of the HVMLC I of releasing from gene order contains 195 aminoacid altogether.But the gene order of the HCMLC of delivering with Canadian G.Jackowski is compared, two place's differences are arranged, one place is at the 24th, become alanine by glutamic acid, another place's difference is bigger, is promptly become-Lys-Pro-arginine-glutamine by-agedoite-arginine-serine-lysine from 98 to 101 amino acids.(see figure 3) for prove this two places difference no thanks in the polymerase chain reaction resultant error cause, the present invention begins common repeated experiments twice from total mRNA extracting, and takes different heart materials, the result repeats fully.The gene that proves Chinese HVMLC1 thus has distinctive sequence fragment, and both difference is estimated relevant with the difference of ethnic group.Two. the structure and the clone of the expression of HCMLC and the purification of expression product 1. expression plasmids

With the EcoR I it is cloned into the PCR product water of carrier puc19 and separate, the clone EcoR I site of advancing expression vector pGEX-3X is built into expression plasmid again.2. expression product induces purification

The single bacterium colony that contains expression plasmid LB (+Amp) in after the continuous culture, add IPTG and induce, 37 ℃ of overnight incubation.Centrifugal collection thalline, precipitation suspension MTPBS buffer, ultrasound wave breaks bacterium.Centrifugal behind the broken bacterium to remove cell debris, on reset and add Triton X-100 and get supernatant again after centrifugal and be splined on Glutathione Sepharose 4B post, earlier wash 10 column volumes behind the last sample with the PBS buffer, reuse Glutathion eluting just obtains the GST fusion expressed product (Fig. 4) of the HCMLC of purification.Three. Monoclonal Antibody 1. animal immunes of HCMLC expression product

Get female mice, add isopyknic Freund's complete adjuvant with the GST fusion expressed product of the HCMLC of purification mice is carried out the abdominal cavity initial immunity; Three all backs add isopyknic non-Freund's complete adjuvant with the same antigen of measuring mice are carried out the abdominal cavity immunity second time; Amount with immunity for the second time after two weeks is carried out abdominal cavity immunity for the third time to mice.

Merge first three day to mice immunized antigen, do not add any adjuvant, directly inject spleen.2. merge

Myeloma cell p3x63Ag8653 cultivates in complete culture solution, and the cell of the trophophase of taking the logarithm is used for merging.Aseptic condition takes out the spleen of immune mouse down, collects the splenocyte counting.The myeloma cell mixes with splenocyte, and centrifugal ten minutes, remove supernatant, wash cell once with non-complete culture solution, the centrifugal supernatant that eliminates of the same method, it is fast to break up cell agglutination, adds Polyethylene Glycol 4000, carries out cell fusion according to a conventional method.Fused cell adds HAT and selects culture fluid to place well culture plate to cultivate.Remove 1/2 volume cell culture fluid about 7 days, the fresh HAT that changes to 1/2 volume selects culture fluid, continues to cultivate, and treats hybridoma length to 10 ⁵Individual when above, detect in the cell culture fluid whether contain antibody with indirect elisa method, this indirect elisa method is as described below: envelope antigen is the GST fusion expressed product of the HCMLC of purification, 4 ℃ are spent the night, the washing back adds culture fluid to be measured, hatches for 37 ℃, and the washing back adds the HRP-goat-anti and belongs to IgG, 37 ℃ of insulations add substrate H after the washing ₂0 ₂And tetramethyl benzidine (TMB) colour developing, 450nm measures light suction degree, and OD0.5 is above positive.3. cloning

Adopt limiting dilution assay clone positive cell, repeated cloning, till positive rate 100%, obtain the monoclonal cell strain that anti-HCMLC is secreted in a strain through screening, called after HCMLC1-8 is (by the common micro-organisms center preservation of Beijing China Committee for Culture Collection of Microorganisms, on November 25th, 1998, deposit number is CGMCC NO.0370).Four. the polyclonal antibody preparation of HCMLC expression product

Get male White Rabbit, add isopyknic Freund's complete adjuvant with the GST fusion expressed product of the HCMLC of purification White Rabbit is carried out the shank initial immunity; Three week backs add isopyknic non-Freund's complete adjuvant with the GST fusion expressed product of the HCMLC of purification, and that White Rabbit is carried out shank is immune for the second time; Per two week backs are carried out immunity with the amount of immunity for the second time to White Rabbit, and immunity is 4 times altogether, and the White Rabbit to immunity before the blood sampling carries out supplementary immunization, the IgG in the purified blood serum also that takes a blood sample of the White Rabbit after immunity finishes.Five. the double-antibody sandwich elisa method detects the acute myocardial infarction period of disease

With the monoclonal antibody of anti-HCMLC expression product (HCMLC1-8,4000 *) bag quilt, place the back of spending the night and seals with defatted milk powder; After the washing, add the insulation of test serum (the HCMLC expression product of purification is as positive control) back; Washing methods is the same, adds the anti-HCMLC multi-resistance of the rabbit insulation of horseradish peroxidase-labeled, and the washing back adds the substrate H of horseradish peroxidase ₂O ₂And tetramethyl benzidine develops the color the 450nm absorbance in each hole reading on the ELISA detector.

The marginal value (cut off value) that provided in the reading of surveying and the diagnostic reagent of the present invention compare, be higher than the positive of marginal value, subcritical value negative.Advantage of the present invention and effect:

At present, be extensive use of creatine phosphokinase (CPK), lactic acid dehydrogenase (LDH) and the glutamic oxaloacetic transaminase, GOT methods such as (GOT) of the blood testing of myocardial infarction clinically, usually can only after falling ill, the patient be suitable in two, three days, its early stage property, susceptiveness and persistency all can not satisfy clinical requirement, and the phenomenon that the patient dies suddenly happens occasionally.And the diagnostic reagent that the present invention developed is compared with above-mentioned, has remarkable advantages on Clinical detection.At first be the early stage property that it detects, at 12 hours of patient's morbidity, just can detect the cardiac muscle myosin light chain I that discharges because of myocardial damage in the blood usually; Next is its susceptiveness and persistence, also is better than the detection method of using at present; Especially can in two weeks, constantly monitor patient, can prevent and treat the patient well and die suddenly, also can assess the protection and the therapeutical effect of medicine heart damage; add the specificity of its height; and,, be suitable for too as myocarditis etc. to other cardiomyopathy.Table 1 shows the comparison of carrying out with creatine phosphokinase (CPK), lactic acid dehydrogenase (LDH) and glutamic oxaloacetic transaminase, GOT methods such as (GOT).

The comparison of HCMLC-I (cardiac muscle myosin light chain I) and other clinical biochemical index among the table 1 acute myocardial infarction patients serum:

Biochemical indicator	The time that occurs the earliest in the serum (hour)	The time that peak value occurs (hour)	Persistent period in the serum (my god)
				CPK	????4～6	????16～24	????4～5
?CPK(MB)	????3	????18～36	????2～4
				?GOT	????～12	????12～48	????～7
?LDH	????6	????30～96	????7～10
				?HCMLC-I	????4～6	????30～144	????7～16

As seen from the table, during the myocardial infarction morbidity, the time that cardiac muscle myosin light chain I occurs in the serum is similar with CPK (MB) to CPK, all wants Zao than GOT and LDH, and continue to occur peak value and reach 16 days, and just can't detect about 7 days often appears in some other index.Thereby, with cardiac muscle myosin light chain I as diagnosis index, it is property in early days, susceptiveness, persistence and specificity aspect all are better than present employed detection method greatly, add that its testing process is very easy, used detecting instrument makes detectable provided by the invention have market and use value widely in various big hospital utilization already again.

Description of drawings: one. the pcr amplification product of HCMLC gene

1. λ DNA Hind III standard molecular weight

2.PCR product

Two. the gene order of HCMLC

1. the gene order of Chinese's cardiac muscle myosin light chain I

2. (the line part is identical to the gene order of the HCMLC of Canada's report

Sequence) three. the protein sequence of HCMLC

1. the protein sequence of Chinese's cardiac muscle myosin light chain I

2. the protein sequence of the HCMLC of Canada report (the line part is an identical sequence) four. the e. coli expression product of HCMLC

1. standard molecular weight albumen

2. the e. coli expression product of HCMLC

The gene clone and the sequencing of embodiment 1. HCMLC

1. the preparation of the total RNA of people's cardiac muscle

Postoperative people's cardiac muscle is removed other tissue, and getting 10 gram ventricular muscles is experiment material, adds extraction buffer (Tris-HCl pH8.9 O.02M, 0.5%SDS, 0.04M NaCl, the 0.005M MgCl of 6 times of volumes of pre-cooling ₂), use tissue mashing machine's homogenate, every homogenate one time one minute, paused one minute, triplicate, with 12000rpm/ minute, centrifugal 10 minutes, reset and add the phenol of 2 times of volumes on the gained: chloroform: the isoamyl alcohol mixed liquor, contain 0.2%SDS, 0.01M EDTA vibration 10 minutes, 10000rpm/ minute, centrifugal 10 minutes, supernatant repeated to disappear until the Denatured protein layer with this mixed liquor extracting.Water adds the dehydrated alcohol of 2.5 volumes, 1/10 volume 3M NaAc, and pH5.4 ,-70 ℃ of placements are spent the night.Centrifugal, 15000rpm/ minute, centrifugal 20 minutes, precipitation washed twice with 70% cold ethanol, and 15000rpm/ minute, centrifugal 5 minutes, precipitation was total RNA, drains stand-by.2. the preparation of the total mRNA of people's cardiac muscle

The total RNA of 4mg is dissolved in the aseptic redistilled water of 2ml in ice bath, add 0.5ml 2.5M KCl, 0.05M Tris-HCl, pH7.5 buffer.Get the efficient Oligo of 0.1g (dT) cellulose (magnificent company) and place beaker, remove buffer with inhale after the 0.5M KCl 0.01M Tris-HCl pH7.5 buffer soaked overnight as far as possible.Above-mentioned total rna solution is added in Oligo (dT) the cellulose buffer, and fully the rearmounted 0 ℃ of refrigerator of mixing (vibration) is incubated 3-4 hour or spends the night.Gentle agitation or vibration mixing again after the taking-up, 4 ℃ are centrifugal, and 6000rpm/ minute, centrifugal 5 minutes, precipitation was used 0.5M KCl, and 0.01M Tris-HCl washs to supernatant A ₂₆₀Nm＜0.03 is used 0.01MTris-HCl again instead, and pH7.5 is centrifugal after the washing precipitation in 54 ℃, collect supernatant, a little buffer of precipitation reuse is incubated 5 minutes in 54 ℃, centrifugal, merges the secondary supernatant, 2%NaCl 95% ethanol that adds 2.5 times of pre-coolings again, put-20 ℃ and spend the night centrifugally, precipitation is used ice-cold 2%NaCl, 75% washing with alcohol, precipitate is put after vacuum drains residual liquid, is dissolved in the total mRNA of the popular flesh of a small amount of aseptic redistilled water.3. the cDNA of HCMLC makes up

The gene order of the HCMLC of delivering in 1988 according to Canadian G.Jackowski, two primers have been synthesized in design, and at the synthetic joint that connects restricted enzyme EcoR I simultaneously of primer, it is in proper order: the primer I: 5 ' GGAATTCCTTAGCTGGACATGATGT 3 ', 17 nucleotide sequence complementations of gene 3 ' end of it and HCMLC; The primer II: 5 ' GGAATTCCATGGCCCCCAAAAAGCC 3 ', 17 nucleotide sequences of gene 5 ' end of it and HCMLC are identical.

Get the extractive total mRNA of 10 μ l (5 μ g/ μ l), 2 μ l primer I (1 μ g/ μ l), 7 μ l 5x AMB virus (AMV) buffer, 1 μ l RNasin (10unit/ μ l), 8 μ l4 * dNTP (each 10mmol), 4 μ l H ₂O adds 3 μ l AMV reverse transcriptases again, and 42 ℃, 105 minutes, add 2.1 μ l 10N NaOH, 37 ℃, 30 ', 1.8 μ l 12N HCl neutralization separates through Sephadex G-50, removes micromolecule template and unnecessary dNTP, takes out through phenol, and ethanol precipitation gets cDNA.4.cDNA polymerase chain reaction (PCR) amplification and clone

The pcr amplification of cDNA is undertaken by the molecular cloning operating guidance of T.Maniatis.

Contain 63 μ l ddH2O in the reactant liquor, 10 μ l, 10 * Taq buffer, 16 μ l dNTP (each 2.5m mol), 2 μ l primer I (1 μ g/ μ l), 2 μ l primer II (1 μ g/ μ l), 6 μ lcDNA strands (9.6ng), 1 μ l Taq archaeal dna polymerase (5unit) adds 100 μ l liquid petrolatums after mixing, and reacts by following program:

Degeneration annealing is synthetic

94℃????55℃????72℃

Circulation I 5 ' 2 ' 3 '

Circulation 2 is to circulation 24 1 ' 2 ' 3 '

' 2 ' 6 of circulating 25 1 '

Behind the reaction back sucking-off petrolatum, get 10 μ l and identify (Fig. 1) with 1.5% sepharose electrophoresis, remaining sample is ethanol precipitation after the phenol extracting.

The PCR product is cloned the into EcoR I site of carrier puc19 (magnificent company) according to the molecular cloning experiment guide of T.Maniatis etc. with it after the hydrolysis of restricted enzyme EcoR I, check order waiting.5. the gene sequencing of HCMLC

With " dideoxy " mensuration of standard order (referring to the molecular cloning operating guidance of T.Maniatis etc.), its result contains 588 bases as shown in Figure 2 altogether, and the aminoacid sequence of the HVMLC I of releasing from gene order contains 195 aminoacid altogether.But compare with the gene order of the HCMLC of Canadian G.Jackowski report, two place's differences are arranged, one place is at the 24th, become alanine by glutamic acid, another place's difference is bigger, is promptly become-Lys-Pro-arginine-glutamine by-agedoite-arginine-serine-lysine from 98 to 101 amino acids.(see figure 3) for prove this two places difference no thanks in the polymerase chain reaction resultant error cause, the present invention begins common repeated experiments twice from total mRNA extracting, and takes different heart materials, the result repeats fully.The gene that proves Chinese HVMLC1 thus has distinctive sequence fragment, and both difference is estimated relevant with the difference of ethnic group.Embodiment 2: the structure of the expression of HCMLC and the purification of expression product 1. expression plasmids and clone clone into the PCR product water of carrier puc19 with the EcoR I with it and separate, and the EcoR I site of cloning expression vector pGEX-3X (magnificent company) again is built into expression plasmid.2. expression product induces purification

The single bacterium colony that contains expression plasmid 2ml LB (+cultivate in Amp), 37 ℃ are spent the night.Change 1ml37 ℃ above-mentioned spend the night bacterium in 50ml LB (+cultivate in Amp), 37 ℃ spend the night after, change again 50ml37 ℃ above-mentioned spend the night bacterium in 500ml LB (+Amp) in, cultivated 3 hours, and in culture fluid, added 1.25ml IPTG (100m mol), 37 ℃ of overnight incubation for 37 ℃.

Centrifugal 6,000rpm collected thalline in 10 minutes, and precipitation is with MTPBS buffer (150mmolNaCl, 16mmol Na ₂HPO ₄, 4mmol NaH ₂PO ₄) being suspended in the 40mlMTPBS buffer after washing once, ultrasound wave breaks bacterium.Add the MTPBS buffer to 200ml behind the broken bacterium, centrifugal 10,000rpm, 20 minutes removing cell debris, on reset and add Triton X-100 to final concentration be 1%, centrifugal 10,000rpm, 10 minutes; Get the GlutathioneSepharose 4B post that supernatant is splined on 2ml, earlier wash 10 column volumes behind the last sample with the PBS buffer, reuse 10mmolGlutathion 50mmol Tris-HCl, the pH8.0 eluting just obtains the GST fusion expressed product (Fig. 4) of the HCMLC of purification.Embodiment 3: Monoclonal Antibody 1. animal immunes of HCMLC expression product

Get female BalB/C mice (5-7 week age), add isopyknic Freund's complete adjuvant with the GST fusion expressed product (50g/) of the HCMLC of purification mice is carried out the abdominal cavity initial immunity; Three all backs add isopyknic non-Freund's complete adjuvant with the same antigen of measuring mice are carried out the abdominal cavity immunity second time; Amount with immunity for the second time after two weeks is carried out abdominal cavity immunity for the third time to mice.

Merge first three day to the antigen of immune BalB/C mice, do not add any adjuvant, directly inject spleen with 50 μ g/.2. merge

Myeloma cell p3x63Ag8653 cultivates in complete culture solution, and the cell of the trophophase of taking the logarithm is used for merging.Aseptic condition takes out the spleen of immune mouse down, collects the splenocyte counting.Myeloma cell and splenocyte were with 1: 5 mixed, and 1000rpm centrifugal ten minutes removes supernatant, washes cell once with non-complete culture solution, the centrifugal supernatant that eliminates of the same method, and it is fast to break up cell agglutination, adds 50% Macrogol 4000 and carries out cell fusion.Fused cell adds HAT and selects culture fluid to place well culture plate (～10 ⁵Individual cells/well) cultivates.Remove 1/2 volume cell culture fluid about 7 days, the fresh HAT that changes to 1/2 volume selects culture fluid, continues to cultivate, and treats hybridoma length to 10 ⁵Individual when above, detect in the cell culture fluid whether contain antibody with indirect elisa method.This indirect elisa method is as described below:

Envelope antigen is the GST fusion expressed product (10 μ g/ml) of the HCMLC of purification, the every hole of 96 hole ELISA Plate adds 50 μ l, 4 ℃ are spent the night, the washing back adds culture fluid to be measured, hatches 1 hour for 37 ℃, and the washing back adds the HRP-goat-anti and belongs to IgG, 37 ℃ are incubated 30 minutes, add substrate H202 and TMB colour developing after the washing, 450nm measures light suction degree, and 0D0.5 is above positive.3. cloning

Adopt limiting dilution assay clone positive cell, repeated cloning till positive rate 100%, obtains the monoclonal cell strain that anti-HCMLC is secreted in a strain through screening, name HCMLC1-8.Embodiment 4: the polyclonal antibody preparation of HCMLC expression product

Get male White Rabbit (5-7 week age), add isopyknic Freund's complete adjuvant with the GST fusion expressed product (100 μ g/) of the HCMLC of purification White Rabbit is carried out the shank initial immunity; Three week backs add isopyknic non-Freund's complete adjuvant with the GST fusion expressed product (100 μ g/ only) of the HCMLC of purification, and that White Rabbit is carried out shank is immune for the second time; Per two week backs are carried out immunity with the amount of immunity for the second time to White Rabbit, and immunity is 4 times altogether, and the White Rabbit to immunity before the blood sampling carries out supplementary immunization with 100 μ g/ amount only, the IgG in its serum of purification also that takes a blood sample of the White Rabbit after the immunity end.Embodiment 5: the double-antibody sandwich elisa method detects the acute myocardial infarction period of disease

With the monoclonal antibody of the anti-HCMLC expression product of 5 μ g/ml (HCMLC1-8,4000 *) bag quilt, after 4 ℃ of placements were spent the night, the defatted milk powder 37C with 5% sealed 1 hour; It is inferior to give a baby a bath on the third day after its birth through cleaning mixture (0.27%Tween 20 for 20mmol Tris, 45mmol HCl), and each 5 minutes, add test serum (the HCMLC expression product of purification is as positive control), 37 ℃ are incubated 1 hour; Washing methods is the same, adds the anti-HCMLC multi-resistance of rabbit of horseradish peroxidase-labeled, and 37 ℃ are incubated 45 minutes, wash five times with above-mentioned cleaning mixture, add the substrate H of horseradish peroxidase at last ₂O ₂And tetramethyl benzidine develops the color the 450nm absorbance in each hole reading on the ELISA detector.

The marginal value (cut off value) that provided in the reading of surveying and the diagnostic reagent of the present invention compare, be higher than the positive of marginal value, subcritical value negative.

Claims (4)

1, a kind of diagnosis reagent for blood cardiac muscle myosin light chain I of myocardial infarction is characterized in that this diagnostic reagent comprises that mainly the high expressed product of HCMLC gene in escherichia coli is as positive control and this expression product monoclonal antibody and the multi-resistance as antigen preparation.

2, diagnostic reagent as claimed in claim 1 is characterized in that described HCMLC gene is Chinese's cardiac muscle myosin light chain I gene.

3、2,Ⅰ：ATG GCC CCC AAA AAG CCA GAG CCC AAG AAG GAT GAT GCC AAG GCA GCC CCC AAG GCA GCT 60CCA GCT CCC GCA CCT CCC CCT GAG CCT GAG CGC CCT AAG GAG GTC GAG TTT GAT GCT TCC 120AAG ATC AAG ATT GAG TTC ACA CCT GAG CAG ATT GAA GAG TTC AAG GAA GCC TTC ATG CTG 180TTC GAC CGC ACA CCC AAG TGT GAG ATG AAG ATC ACC TAC GGG CAG TGT GGG GAT GTC CTG 240CGG GCG CTG GGC CAG AAC CCC ACA CAG GCA GAA GTG CTC CGT GTC CTG GGG AAG CCA AGA 300CAG GAA GAG CTC AAT ACC AAG ATG ATG GAC TTT GAA ACT TTC CTG CCT ATG CTC CAG CAC 360ATT TCC AAG AAC AAG GAC ACA GGC ACC TAT GAG GAC TTC GTG GAG GGG CTG CGG GTC TTC 420GAC AAG GAG GGC AAT GGC ACT GTC ATG GGT GCT GAG CTT CGC CAC GTG CTG GCC ACG CTG 480GGT GAG AGG CTG ACA GAA GAC GAA GTG GAG AGG TTG ATG GCT GGG CAA GAG GAC TCC AAT 540GGC TGC ATC AAC TAT GAA GCA TTT GTG AAG CAC ATC ATG TCC AGC TAA 588Met Ala Pro Lys Lys Pro Glu Pro Lys Lys Asp Asp Ala Lys Ala Ala Pro Lys Ala Ala 20Pro Ala Pro Ala Pro Pro Pro Glu Pro Glu Arg Pro Lys Glu Val Glu Phe Asp Ala Ser 40Lys Ile Lys Ile Glu Phe Thr Pro Glu Gln Ile Glu Glu Phe Lys Glu Ala Phe Met Leu 60Phe Asp Arg Thr Pro Lys Cys Glu Met Lys Ile Thr Tyr Gly Gln Cys Gly Asp Val Leu 80Arg Ala Leu Gly Gln Asn Pro Thr Gln Ala Glu Val Leu Arg Val Leu Gly Lys Pro Arg 100Gln Glu Glu Leu Asn Thr Lys Met Met Asp Phe Glu Thr Phe Leu Pro Met Leu Gln His 120Ile Ser Lys Asn Lys Asp Thr Gly Thr Tyr Glu Asp Phe Val Glu Gly Leu Arg Val Phe 140Asp Lys Glu Gly Asn Gly Thr Val Met Gly Ala Glu Leu Arg His Val Leu Ala Thr Leu 160Gly Glu Arg Leu Thr Glu Asp Glu Val Glu Lys Leu Met Ala Gly Gln Glu Asp Ser Asn 180Gly Cys Ile Asn Tyr Glu Ala Phe Val His Ile Met Ser Ser 195

4, as claim 1,2,3 described diagnostic reagents, the monoclonal antibody that it is characterized in that the HCMLC gene expression product is cell strain of monoclonal antibody HCMLC1-8.

Images