CN1219974A - Recombinant nucleic acid sequences and methods for determining both genotoxicity and mutagenicing of sample and kinetics of genetoxicity - Google Patents
Recombinant nucleic acid sequences and methods for determining both genotoxicity and mutagenicing of sample and kinetics of genetoxicity Download PDFInfo
- Publication number
- CN1219974A CN1219974A CN96180308A CN96180308A CN1219974A CN 1219974 A CN1219974 A CN 1219974A CN 96180308 A CN96180308 A CN 96180308A CN 96180308 A CN96180308 A CN 96180308A CN 1219974 A CN1219974 A CN 1219974A
- Authority
- CN
- China
- Prior art keywords
- promotor
- nucleic acid
- host microorganism
- recombinant nucleic
- luminous
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A recombinant nucleic acid sequence comprising an SOS regulated promoter with an induction ratio higher than 40, said promoter being operatively linked to a reporter encoding nucleic acid sequence encoding a reporter resulting in a signal that can be assayed as light production. A biosensor comprising such a nucleic acid sequence and methods for determining genotoxicity and the presence of multiple genotoxic compounds using such a biosensor are disclosed.
Description
The multiple different use microbe to screen genotoxicity and/or the method for toxic chemical are arranged at present.Ames test (Maron and Ames, 1983) is a kind of method and thereby worldwide recommended use of the most widely used mensuration toxic chemical seemingly.But finish this test and will spend about three days time, this method is also with some significant disadvantages simultaneously.
But introduced the method for finishing in some short period of time, these methods comprise, amount according to the beta galactosidase enzyme of lacZ genetic expression detects the SOS reaction that causes because of dna damage, and wherein said lacZ gene is positioned at umuD, C that SOS regulates or the downstream of sfiA stress-induced type promotor.These tests are called uses Salmonella typhimurium to test (Quillardat etc., 1982) as the umu test (Oda etc., 1985) and the use intestinal bacteria of host microorganism as the SOS colour developing of host microorganism.In umu test and SOS colour developing test, in the presence of sample to be checked, cultivate host microorganism, this host microorganism of the destruction of continuing.The substrate that adds beta galactosidase enzyme then adds inhibitor and stops subsequent reaction after about 10 minutes, carry out OD then at two wavelength places and measure and calculate the beta galactosidase enzyme activity.These tests have overcome the problem that Ames tests length consuming time, but they also have the shortcoming of self, i.e. sensitivity is low and still need 7-8 hour detection time, and particularly the detection sensitivity of nitro-aromatic and polycyclic aromatic hydrocarbons is low.In addition, this detection method also needs a large amount of operations and adds various reagent, thereby makes the very complicated and cost height of this method.Because necessary smudge cells, so only may carry out a kind of detection by pair cell in order to detect any inducing action.
EP-A-0649905 addresses, and the SOS gene is placed on the active upstream region of gene of expressing luciferase, so that the expression of luciferase and SOS expression of gene take place simultaneously, thereby can overcome the shortcoming of above-mentioned test.Can in the short period of time, detect or measure mutagen by detection is luminous then.It is said that any SOS gene all is useful, and be that example is described with umuD, C gene (when being used for the umu test) in an embodiment.In addition, wait conventionally test to compare, because it is less to detect required sample volume in this test, so think that it has improved the sensitivity that detects with SOS colour developing test and umu test.Except but it must be the SOS induction type, there the sequence that does not link to each other with stand-by promotor again.Again because luminous be at once, so can be than using the Lac system earlier detect, thereby shortened detection time.
Also disclose among the WO94/13831 (DuPont) with the bioluminescence gene mixture and be used in combination stress-induced type promotor, so that genetically engineered microorganism to be provided.They point out, " is useful though proved stress reaction in detecting various environmental hazards, and it must be connected with the sensitive reporter gene that is easy to detect ".DuPont company provides a stress-induced type promotor inventory well known in the prior art widely, and these promotors may be useful, but the present invention is not only limited to these.List and comprise the promotor of following regulation system: heat-shocked, SOS, hydrogen peroxide, super-oxide, lipid acid hunger, general stress, stationary state, emergent, katabolic product activation, P utilizes and N utilizes.In an embodiment, they used promotor katG that promotor recA that bak promoter dnaK that heat-shocked regulates and grpE, SOS regulate and uvrA, oxidative damage regulate and micF, general stress promotor uspA, stationary phase promotor xthA, from the his promotor of amino acid starvation system, relate to the lac promotor of the hungry system of carbon, from the phoA promotor of phosphoric acid salt restriction system with from the glnA promotor of nitrogen restriction system.Estimating that they enumerate so many example from the promotor of the different adjustment mode of wide range, is to illustrate that their system has the suitability of wide region.Wherein do not point out or deducibility in preferred promotor or any indivedual promotor of using certain particular group.Only enumerate a promotor that specific SOS regulates among the embodiment (embodiment 12 of patent application) therein significantly, wherein provided the result that promotor recA that SOS regulates obtains.Microorganism is contacted with the sample that is added with mutagenic compound ethidium bromide (concentration is 0.25mg/ml), and recording inductivity in 180 minutes after adding mutagenic compound is 1.9.Add 0.5 μ g/ml ametycin, measure inductivity after 100 minutes.According to the difference of used test bacterial strain, inductivity changes between 4.7 to 20.Embodiment 12 according to the patent application of DuPont can obviously see The above results.
We have found the subgroup of a stress-induced type promotor unpredictablely, i.e. the subgroup of SOS promotor of regulating, and it combines with luminous reporter gene and is used for microflora and estimates the result that mutagenicity is improved.This subgroup does not comprise the RecA promotor that SOS regulates.This subgroup has the characteristics of the many DuPont of being better than RecA-luciferase systems and other microbial poison property testing system known in the art.Make promoter mutation with ad hoc fashion and further testing and develop in these new systems, we can improve its performance to a greater degree.Finished new testing method in addition.These new testing method make us can obtain that do not addressed, how better data in any so far existing microbial poison property testing.
The present invention relates to comprise the recombinant nucleic acid sequence that inductivity is higher than promotor 40, that SOS regulates, said promotor is effectively connected on the nucleotide sequence of coding reporter molecule, coded reporter molecule can produce can luminous form mensuration signal.According to the present invention, preferably contain in the recombinant nucleic acid sequence higher inductivity, particularly be higher than the promotor of 50 inductivity.Can be according to detecting inductivity such as people such as M.Schnurr disclosed method in Biochimie (1991) 73,423-431.In addition, also can select Peterson K.R. and Mount D.W. (1987) for use, molecular biology magazine, 193, the method described in the 27-40.These disclosures are all classified this paper reference as.The recA promotor that disclosed and luciferase are united use in the prior art does not fall into this big class, because the inductivity of recA is much lower.It is 11X under 30 ° inducing temperature.Inductivity is an art-recognized term, and can determine by method known to those skilled in the art.Provided how to determine the method for inductivity among the embodiment of the document, and determined the many numerical value and the inductivity of a large amount of promotors.The low inductivity of recA may be why not it is specially adapted to reason based on the smart detector system of promotor inducing action.In the system that SOS regulates, the RecA promotor is derivative the earliest promotor.Because of lacking the signal that produces, metabolite discerned by RecA protein.It also may have second kind of function and can assist archaeal dna polymerase to walk around damage in mutagenesis.In preceding 20 minutes behind dna damage, uvrA, B, C, D gene are activated, and begin cutting reparation.The regroup reparation approach that is called RecF reorganization approach then in about 40 minutes time is very active.The last SOS mutagenesis approach that relates to umuD, C of just being induced.
The minimum level of the employed ametycin of DuPont system of giving an example in the above-mentioned patent application is 500ng/ml.Wherein do not provide the indication and the prompting that can detect lower mutagenic compound level.In native system, then can detect the mitomycin of 7ng/ml.Therefore native system is than high about 80 times of sensitivity pointed in the DuPont system.We find, the inductivity that obtains from the concentration of 7.5ng/ml in our system is higher than 2.
We for example understand online detection for the first time.Because need destroy cell, be impossible so carry out online detection with these systems with SOS or Ames system.Described other tests also just are used for single point and detect.We have now found that, might differentiate the multiple mutagenic compound that exist in the sample, and determine the kinetics of inducing of these materials.Unpredictalbe generally is that luminous if timing detects, the existence of multiple mutagenic compound will provide different detectable signals.People can calculablely be the reverse side situations, storage effect promptly occurs.But it illustrates that clearly the promotor that SOS regulates has constituted one group of promotor that shows this adjustment feature, and promptly for various inducibility chemical substance, the mode of inducing has difference more, thereby exists discrepant detectable signal.This new method is very simple on using, and can realize the automatization of signal detection.This novel method only need be cultivated the microorganism of the promotor that comprises the SOS adjusting, said promotor can be imitated on the nucleotide sequence that is connected to the coding reporter molecule, said reporter molecule can produce can be luminous the signal measured of form, and microorganism is contacted with testing sample, then-measure luminous in the culture, said mensuration is carried out in different time points,-determine the S-N ratio on said time point,-data are mapped, the kinetics of the genotoxicity of said data represented said sample, the indication of wherein a plurality of peaks has different dynamic (dynamical) several genes toxic chemicals of inducing.Luminous detection is preferably carried out continuously.Preferred online this method of finishing.The such fact of embodiment and description of drawings: in containing the sample of multiple mutagenic compound, can detect a plurality of peaks.
In a preferred embodiment, luminous detection is carried out continuously.From realizing detecting the automatization of several genes toxic agents existence and the angle of tolerance range, this point is to make us interested especially.The high more test macro of signal noise ratio is just sensitive more.Interested other factors are degree of fluctuation of inducedvelocity, expression degree and signal noise ratio.Selected promotor is not only depended in the change of these factors, and depends on the character of host strain and genotoxicity agent.In actual the use, the signal noise ratio of 2 kinds of concentration toxic chemicals will be equal to or higher than 2.Based on above-mentioned one or more features, those skilled in the art can select to be suitable for most the system of their state.Following embodiment for example understands the broad applicability of new bio-sensor system.The new shown result of biosensor of the present invention constitutes the various embodiments of the new dna sequence dna of the present invention in intestinal bacteria and the Salmonella typhimurium.All new biosystems of test are all good than standard A mes and SOS colour developing test based on Salmonella typhimurium and coli strain.System of the present invention is quicker, more accurate and sensitiveer.We clearly illustrate at those known toxic agents that provide false negative result in SOS colour developing test and Ames test, and promptly known test provides false negative result really, and system of the present invention provides positive findings.Particularly Vulkamycin. PA-93, sodiumazide, ametycin, nalidixic acid (naladixic acid), hydrogen peroxide, pyrene and phenanthrene (phenantrene) have been done to illustrate.Test macro of the present invention is particularly suitable for detecting the existence of PAH (polyaromatic).
System of the present invention in addition need not detect and destroys cell in order to provide, thus can continue after be used for further test, and the more important thing is detectable signal can be provided within a certain period of time.Therefore traceable and definite sample induce kinetics.
An important embodiment of the present invention is the fact that relies in such, promptly now can obtain the method that the several genes toxic chemical exists in a kind of test sample first, said method may further comprise the steps :-cultivation comprises and has the host microorganism that SOS regulates the nucleotide sequence of promotor, wherein said promotor is effectively connected on the nucleotide sequence of coding reporter molecule, coded reporter molecule can produce can be luminous the signal measured of form,-measure the luminous of culture, said mensuration is carried out on each time point, continuous detecting preferably, and detection signal noise ratio on said time point, then to these data mappings, the genotoxicity kinetics of said data represented said sample, wherein a plurality of peaks show and have the multiple different dynamic (dynamical) determining presence of genotoxic compound of inducing that has.
Because in the host cell of the biological sensing system of having selected new dna sequence dna and being applied to provide new, we have also created very sensitive and biosystem fast, can determine the genotoxicity of sample in 5 minutes to 2 hours time.
Therefore another embodiment of the invention comprises the method for determining that determining presence of genotoxic compound exists in the sample, said method may further comprise the steps :-cultivation host microorganism, said host microorganism comprises that one comprises the nucleotide sequence of the promotor that inductivity regulates greater than 20 SOS, said promotor is effectively connected on the nucleotide sequence of coding reporter molecule, coded reporter molecule can produce can be luminous the signal of form mensuration;-on a plurality of time points, measure the luminous of culture ,-determine culture luminous whether change taken place, increasing luminous is the indication that has determining presence of genotoxic compound.The inductivity of preferred promoter is 40 or higher, and the suitableeest is 50 or higher.In the method that determining presence of genotoxic compound exists in aforementioned test sample, it is luminous that embodiment preferred is included in a plurality of time point determinings.Continuous detecting is then better.In addition, preferably also have the following step :-detect luminous signal noise ratio at said time point ,-luminous signal to be mapped to noise data, the genotoxicity kinetics of said figure representative sample can be used for measuring the genotoxicity kinetics of said sample.The most handy biosensor of the present invention is finished aforesaid method.Such biosensor comprises host strain, and said bacterial strain contains the new nucleic acid sequence of the present invention just like other place limited in this specification sheets.Host strain better is a microorganism, for example intestinal bacteria or salmonella typhimurium strain.Specifically, the Salmonella typhimurium Ames test strain of application standard has been as host strain, and provides very suitable embodiment for biosensor of the present invention.Bacterial strain of the present invention is attractive to be that it is applicable in genotoxicity and the toxotest.The example of Ames test strain is TA98, TA100, TA102, TA104, TA1535 and TA1538, or new salmonella typhimurium strain TA7001 to TA7006 and TA7046 (Gee etc., 1994).The Ames bacterial strain still is a generally accepted bacterial strain in world's medicine technology in addition.For the biosensor of the present invention that comprises as the Ames bacterial strain of host strain, this bacterial strain can not only be used for the genotoxicity test according to the present invention, but also can be used for the Ames test in succession.Other suitable host strains that can become multi-functional bacterial strain are that those skilled in the art are conspicuous.
Various embodiments to the nucleotide sequence of the present invention that is suitable for being applied to biosensor of the present invention among the embodiment have been done to illustrate.Comprising the nucleotide sequence that inductivity is higher than the promotor that 40 SOS regulates is a part of the present invention, and said promotor is effectively connected on the nucleotide sequence of coding reporter molecule, coded reporter molecule can produce can luminous form mensuration signal.Biosensor of the present invention comprises in each embodiment disclosed herein the nucleotide sequence of any.In addition, such dna sequence dna is applicable to finishing all methods of the present invention disclosed herein.
The suitable promotor that regroup is repaired in the promotor comprises RecF, RecJ, RecN, RecO, RecQ, ruv and uvrD promotor.The embodiment illustrated RecN promotor.Another promotor that is suitable for is the SfiA promotor, and it has also done to illustrate in an embodiment.In addition, the sudden change promotor that can induce during recombinational repair, inductivity is higher than the promotor group that 40 above-mentioned SOS regulates also is a suitable embodiment of the present invention.Such mutant may have stronger promotor intensity or regulating effect, but very importantly the SOS regulating effect is not destroyed.An example of the sudden change of particularly suitable is included in the sudden change that takes place at least one LexA binding site, and a LexA binding site retentive activity is arranged at least in addition.Such preferred sudden change will have the sudden change that does not change the wild-type promoter sequence at said another LexA binding site at least.The example of such mutant is the RecN mutant (RecN1-3) with serial ID No.7.Have LexA such mutant that suddenlys change and be specially adapted to detect in the method that a plurality of genotoxicity agent exist, and be applicable to the kinetics of inducing that detects this class sample by the disclosed the inventive method in this specification sheets other places.Such mutant also is extremely sensitive in fast.They are specially adapted to detect the appearance and/or the accumulation of degraded of genotoxicity intermediate or meta-bolites.This can be to transform in the soil at the field of pollutent and its degradation product biological example, also can be used in the drug test.
Having found to provide the mutant of the another kind of type of useful feature is the mutant that contains up-promoter mutation.Up-promoter mutation is a recognized techniques term, and results of mutation is that promoter sequence is more similar in appearance to the concensus sequence of RNA polymerase binding site.Such sudden change can contain sudden change in promotor-35 zone.This class sudden change example of RecN promotor is provided with the RecN2-4 mutant forms with serial ID No.8 among the embodiment.We also provide the example of the combination mutant with LexA and up-promoter mutation, and it is the RecN3-4 mutant with serial ID No.9.Other improvement also are possible in principle, for example-10 better spacing between the sudden change of promoter region and-35 and-10 zones.The two kinds of selections in back are also uncorrelated for recN, because this promotor has shown and σ
35Promoter sequence has good consistence.In view of this-35 is not best,, we can provide and σ so illustrating
35Consistent promoter sequence has the sudden change of closer compatibility can cause the improvement of function.
Except promoter sequence, nucleotide sequence of the present invention also comprises the nucleotide sequence of the reporter molecule of encoding, the reporter molecule of this nucleic acid sequence encoding can produce can be luminous the signal measured of form.Such sequence is as known in the art.Nucleotide sequence by the coding reporter molecule that contains luciferase A and B gene has constituted suitable embodiment.In an embodiment preferred, said sequence also comprises luciferase C, D and E gene, and these genes are that to produce the limited lipid acid substrate can be used for recirculation necessary.The detailed description of relevant these sequences is found in the PCT/EP patent application of submitting on February 28th, 1,992 9200445.
The preferred method of the present invention is included in and uses the microorganism that is suitable for as the Ames test strain in of the present invention any method as described herein, said microorganism further comprises new nucleotide sequence of the present invention, carry out traditional Ames test then, thereby a kind of method of using same bacterial strain to carry out genotoxicity mutagenicity and toxotest is provided.
New nucleotide sequence Another application of the present invention is to use the microorganism that comprises said sequence to detect toxicity.Preferred host cell is the cell that can produce the high noisy signal.As if the nucleotide sequence of the present invention that for example has up-promoter mutation as indicated above be well suited for this application.This application can draw the IC50 calculated value of toxic product.In other words, this application can constitute the method that a kind of test sample toxic compounds exists, this method may further comprise the steps :-cultivation host microorganism, said host microorganism is a disclosed host microorganism of the present invention among any embodiment of this paper,-measure the luminous of culture, and-determine culture luminous whether change taken place, luminous reduction is promptly indicated and is had the toxic chemical that is contained in the scope of the invention.
In a word, the present invention may have following advantage :-might identify exist in the sample present the dynamic (dynamical) at least two kinds of determining presence of genotoxic compound of not isogeneous induction.-might utilize such as S9 between metabilic stage or between degradative phase, in time identify the formation of intermediate genotoxicity product in as bioreediation.-can utilize online detection genotoxicity of same cell and general toxicity kinetics.-can 5 minutes in 4 hours, preferably in 3 hours, more preferably in 2 hours, finish test rapidly, and provide clear and definite result.-before signal detection, do not need the pair cell culture to anticipate.-when the general toxicity of online detection determining presence of genotoxic compound or liquid solution, do not need to destroy cell.-availablely further check in 4 hours according to bacterial strain of the present invention, preferably in 3 hours, more preferably in 2 hours, find to have the material of selecting for use of genotoxicity, to check phase shift mutation or base pair replacement according to the Ames method with same cell.-because basic luminescence reduces is the indication of general toxicity, so do not need internal contrast when detecting toxicity.-because the test duration of experiment is limited, so do not need strict aseptic condition.-because the test duration of experiment is limited, so do not need specimen is carried out the chemically stable property testing.Description of drawings
Fig. 1: (Fig. 1 a) and the restriction map of having cloned the derivative pMOL890 (Fig. 1 b) of sfiA promotor in this carrier for promoter probe vector pMOL877.
Fig. 2: promoter probe vector pMOL877 and in this carrier, cloned recN promotor (pMOL1066, recN1-2), the recN promotor (pMOL1067 that has the LexA2 site of inactivation, recN1-3), the recN promotor (pMOL1068 that has up-promoter mutation, rec2-4) and simultaneously have the Lex A2 site of inactivation and the promotor of up-promoter mutation (pMOL1069, derivative pMOL1066 recN3-4) (Fig. 2 a), the restriction map of pMOL1067 (Fig. 2 b), pMOL1068 (Fig. 2 c) and pMOL1069 (Fig. 2 d).
Fig. 3: with signal/noise of the intestinal bacteria ED8739 that contains pMOL890, pMOL1066, pMOL1067, pMOL1068 or pMOL1069 that handles through 64ppm MMS than the photoinduction kinetics that provides.Luminously measure in during 2 hours.
Fig. 4: with signal/noise of the intestinal bacteria ED8739 that contains pMOL890, pMOL1066, pMOL1067, pMOL1068 or pMOL1069 that handles through 64ppm MMS than the photoinduction kinetics that provides.Luminously measure in during 5 hours.
Fig. 5: to containing the intestinal bacteria of pMOL1066, pMOL1067, pMOL1068 or pMOL1069, provided the dose-effect curve of MMS (concentration is 0.5-128ppm) with the form of peak signal/noise comparison concentration.
Fig. 6: to containing the intestinal bacteria ED87391106 of pMOL1066, pMOL1067, pMOL1068 or pMOL1069, provided the dose-effect curve of UV-light (irradiation time is 2-10 second) with the form of peak signal/noise comparison irradiation time.
Fig. 7: the photoinduction kinetics that provides than form with signal/noise of the Salmonella typhimurium TA98 that contains pMOL1067 or pMOL1068 that handles through 64ppm MMS and TA104.Luminously measure in during 5 hours.
Fig. 8: the photoinduction kinetics that provides than form with signal/noise of the Salmonella typhimurium TA98 that contains pMOL1067 or pMOL1068 that handles through 25.6ppb 4-NQO and TA104.Luminous is to measure in 5 hours time.
Fig. 9: with the combination of TA98 (pMOL1067) test MMS and Vulkamycin. PA-93.In graphical sysmbol, first numerical value is represented the amount (ppm number) of MMS, is thereafter Vulkamycin. PA-93 value (ppm number).
Figure 10: with the combination of TA104 (pMOL890) test MMS and Vulkamycin. PA-93.In the graphical sysmbol, first numerical value is represented the amount (ppm number) of MMS, is thereafter Vulkamycin. PA-93 value (ppm number).
Figure 11: the MMS that arranges with the functional form that uses resultant signal/noise ratio that bacterial strain TA98 (pMOL1067) obtains and the genotoxicity of Vulkamycin. PA-93 combination.
Figure 12: the MMS that arranges with the functional form that uses resultant signal/noise ratio that bacterial strain TA104 (pMOL890) obtains and the genotoxicity of Vulkamycin. PA-93 combination.
Figure 13: when TA98 (pMOL1067) when the toxic product R116 of different concns is incubated, the signal of this bacterial strain/noise is than in time reduction situation.
Figure 14: when TA98 (pMOL1068) when the toxic product R116 of different concns is incubated, the signal of this bacterial strain/noise is than in time reduction situation.
Figure 15: the genotoxicity value of the sample of in the bioreediation process of PAH Contaminated soil, obtaining.The data of this experiment are to use TA104 (pMOL890) to obtain.Behind S9 extract metabolic activation, detect genotoxicity.Use TA104 (pMOL1067) or TA104 (pMOL1068) to obtain similar data.
Figure 16: the appearance of genotoxicity degraded intermediate during the fluoranthene of degrading with bacterial strain LB208.The data of this experiment are to use TA104 (pMOL890) to obtain, but use TA104 (pMOL1067) or TA104 (pMOL1068) also to obtain similar result.The genotoxicity increase shows has genotoxicity intermediate degraded product to form.With peak signal/noise ratio expression genotoxicity.Extract the genotoxicity intermediate down in pH2.5.Need not or with the situation of (#) S9 metabolic activation under determine genotoxicity.The colibacillary sfiA promotor of the structure of experimental data promotor-lux syzygy: the structure of sfiA-lux syzygy
Bacterium SOS reaction is under the proteinic control of many adjustings, wherein the most important thing is RecA protein (proteolytic enzyme) and LexA repressor.The existence of genotoxicity product causes dna damage.It will activate the DNA repair system, and the part activation is that RecA protein from non-activity changes over activated proteolytic enzyme.This RecA proteolytic enzyme has high affinity to the LexA repressor, because the proteolysis effect of RecA makes it gradually by inactivation.Dissociate with its binding site on the promotor that LexA regulates behind the LexA inactivation, thereby cause the activation of promotor and transcribing of its corresponding gene.Being in one of promotor under the LexA control is the sfiA promotor.The sfiA promotor has a LexA binding site, and this site is overlapping to some extent with the transcripting start point of-10 zones and this promotor, and its transcriptional activation needs dissociating of LexA.Know that also the sfiA promotor is the strongest promotor that is under the bacterium SOS reaction control, its inductivity is 100.With PCR pieces clone sfiA promotor.Based on disclosed sfiA sequence, the mode that flank is connected to Hind III and EcoR I restriction site is designed primer (Beck and Bremer, 1980) by the RCR fragment.Primer 94C79 (Seq.ID No.1) identification is 59 to 87 sfiA sequence from the position: the TTTAAGCTTCCCGTCACCAACGACAAAATTTGCGAGGC underscore partly is a Hind III restriction site, and the sfiA sequence then illustrates with tilted letter.Primer 94C96 (Seq.ID No.2) identification 400 to 376 complementary sfiA:AAGAATTCCCGACTCAGTTTTTGTTGCGG underscore from the position be EcoR I restriction site, complementary sfiA sequence is then represented with tilted letter.
In the enterprising performing PCR amplification of intestinal bacteria HB101 chromosomal DNA, produce the tack PCR fragment of 352bp.With this fragment cloning in the single EcoR I site of pMOL877.Plasmid pMOL877 is derived from IncQ plasmid RSF1010, and also contains promoterless LuxCDABE operon except the tetracyclin resistance mark.Single EcoR I site is positioned at the upstream of this operon.After the digestion of EcoR I, use the Klenow archaeal dna polymerase that the sticky end in EcoR I site is filled into tack.Connect the electroreception attitude cell (Murray etc., 1977) of back with reaction mixture transformed into escherichia coli ED8739.Select transformant according to cell at the energy for growth that contains on the substratum of tsiklomitsin, transformant is transferred in two parts of rich mediums that contain tsiklomitsin, use flat board of UV-irradiation then with toothpick.Use radioautography to see and show the luminous positive colony of UV light-induced type.Analyze the plasmid inclusion of (restricted enzyme cutting analysis and PCR) 4 positive colonies, all clones all demonstration contain same recombinant plasmid.To contain the plasmid of deriving based on pMOL877 that is in the following LuxCDABE gene of sfiA promoter transcription control names and is pMOL890.Provided the restriction map of pMOL877 and pMOL890 among Fig. 1 a and the 1b respectively.
But, can upstream under the LexA control and that can be cloned into the Lux reporter gene system at other promoter sequences that SOS was activated between the reaction period will be in as the suitable surrogate of sfiA promotor.So can obtain showing the new construct of genotoxicity as luminous function.Useful especially is to have the SOS-promotor that is higher than 40 inductivity.Interesting is not participate in SOS mutagenesis, but partly participates in the SOS-promotor of RecF recombinational repair approach.This group promotor comprises recF, recJ, recN, recO, recQ, ruv and uvrD (being called recL in the past).In view of SOS mutagenesis promotor RecA and umu have only 11 and 28 low inductivity respectively, so think that they are not too useful.After having studied document, select following candidate's promoter sequence to do further research :-colibacillary recN promotor;-colibacillary ruv promotor; The muc promotor of-escherichia coli plasmid pHM101.
Select recN to carry out further cut-and-try work from these candidate's promotors, because RecN is the main composition composition of inducing SOS reaction back cell, and known road LexA has strict regulating effect (Finch etc., 1985 to it; Picksly etc., 1985).Colibacillary recN promotor: the structure of recN-lux syzygy
The recN promotor has three LexA binding sites, one and-35 region overlappings, and another transcripting start points with-10 zones and this promotor are overlapping.Infer that the 3rd LexA binding site is positioned at the coding region.It is different from the sfiA promotor of having only a LexA binding site in this respect.The recN promotor has following sequence (Seq ID No.3; Rostas etc., 1987), wherein pointed out-35 and the position in-10 zones (italics) and the position of two LexA binding sites (underscore part):
GCCTCTTTACTTGTATATAAAACCAGTTTATACTGTACACAATAACAGTAA
-35?????LexA1????????-10??????LexA2
This promotor has similarity with consistent promoter sequence (Seq.ID No.4) " TTGACA-16/17bp-TATAAT ", but the important G in-35 districts is replaced by T.Therefore, under inductive condition the expression of recN may than the sequence in-35 zones be TTGATC the sfiA promotor slightly a little less than.
Carry out following cloning experimentation according to this information :-usefulness pcr amplification method clone wild-type recN promotor.Synthetic two primers of all introducing EcoR I restriction site, i.e. the primer 1 serial ID No.5 of promoter region upstream and the primer 2 serial ID No.6 in downstream.Primer 1 is positioned at the position 28-49 of recN sequence.Primer 2 is positioned at the position 550-526 (complementary) of recN sequence.GAATTC indication EcoR I site in the primer.People such as Rostas (1987) disclose the recN sequence.These restriction sites are that the cloning promoter fragment is needed in pMOL877 lux reporter gene carrier.-from promoter sequence, remove the LoxA2 binding site.For this purpose, select to have the primer 3 of serial ID No.7 (AAAGAATTCTTATTGTGTACAGTATAAACTGG), this primer has been done modification at last three base pair places of LexA2 binding site.These three base pairs constitute a concensus sequence, and all guard on all Lex binding sites of intestinal bacteria and Salmonella typhimurium.The base pair that 5 of primer 3 ' end shows with italics does not also meet the wild-type dna sequence dna, selects this sequence to introduce an EcoR I restriction site.For pcr amplification recN promotor, this primer must be used in combination with primer 1.Primer 3 is complementary to the position 360-338 (Rostas etc., 1987) of recN sequence.
The primer 4 that use has serial ID No.8 (being equivalent to the position 294-331 on the 1987 described recN such as Rostas) AAAAGAATTCTAATTTTACGCCAGCCTCTTGACTGTAT imports " promotor synergy " sudden change.This primer is introduced a G (boldface type) and is introduced an EcoR I restriction site at 5 of promoter region ' end on the consistent position in-35 districts.Like this, 5 of primer 4 ' base pair that end is represented with italics just is not consistent with the wild-type dna sequence dna.In the pcr amplification of recN promotor, must unite and use this primer and primer 2.-from promoter sequence, remove the LexA2 binding site, and import " promotor synergy " sudden change.Can use primer 3 and 4 to unite the pcr amplification that carries out the recN promotor for this reason.
Use above-mentioned each promoter region to primer amplification recN gene.Also imported extra sudden change.Obtain following PCR fragment thus:
*RecN1-2, wild-type recN promotor (=serial ID No.3)
*RecN1-3 lacks the recN promotor (=serial ID No.9) in LexA2 site
*RecN2-4 has the recN promotor (=serial ID No.10) of up-promoter mutation
*RecN3-4 has the recN promotor (=serial ID No.11) of the up-promoter mutation that lacks the LexA2 site.
Digest these PCR fragments and be cloned into the EcoR I and be cut among the linear luxCDABE expression vector pMOL877 with the EcoR I.With connecting mixture transformed into escherichia coli ED8739 (Met
-, RecA
+).RecA
+Phenotype is that the SOS abduction delivering of acquisition promotor-lux syzygy is necessary.Use the UV-irradiation be used to detect the sfiA-lux syzygy as previously mentioned to induce light emission, contain the transformant of required promotor-lux syzygy with evaluation.For every kind of promoter construct, identify respectively and show UV light-induced photoemissive positive colony.So obtain following plasmid and coli strain:
*PMOL1066 among the bacterial strain CM2081, it contains recN1-2 lux syzygy (wild-type recN promotor).
*PMOL1067 among the bacterial strain CM2082, it contains recN1-3 lux syzygy (the recN promotor that lacks the LexA2 site).
*PMOL1068 among the bacterial strain CM2083, it contains recN2-4 lux syzygy (the recN promotor that has up-promoter mutation).
*PMOL1069 among the bacterial strain CM2084, it contains recN3-4 lux syzygy (the recN promotor that has the up-promoter mutation that lacks the LexA2 site).
Provided the restriction map of recN-lux syzygy plasmid pMOL1066 to pMOL1069 among Fig. 2 a-d.Use promotor-lux construct in intestinal bacteria, to carry out luminous test
In order to use the inducibility of the different promoter construct of bacterium SOS systems inspection,, use 64ppm MMS to induce experiment according to method provided below.Get in contrast without the inductive cell.The result is shown in Fig. 3 and 4 with signal/noise ratio.
Can draw to draw a conclusion according to these results:
*The pMOL890 (sfiA) that contains wild-type sfiA promotor is well induced and is expressed (Fig. 3 and Fig. 4) after SOS induces.In addition, induce curve and use recN-lux syzygy pMOL1066 (recN1-2) and the quite similar (see figure 4) of the observed curve of pMOL1067 (recN1-3).
*The pMOL1066 (recN1-2) that contains wild-type recN promotor induces the back than the expression of its derivative less better (also being about total light yield) (Fig. 3 and Fig. 4) at SOS.Induce curve and use sfiA-lux syzygy pMOL890 and the quite similar (see figure 4) of the observed curve of pMOL1067 (recN1-3).
*The recN1-3 that contains the recN promotor that lacks the LexA2 site is well induced after SOS induces and is expressed.In addition, it is induced curve and uses the observed curve of sfiA-lux syzygy very similar (Fig. 3 and Fig. 4).
*The recN2-4 that contains the recN promotor of the sub-synergy sudden change of tape starting is induced well after SOS induces and is expressed.Use the total light yield of this construct and initially induce kinetics even than using pMOL890 and pMOL1067 faster (Fig. 3).Yet, by signal/noise than expression induce curve ratio to use pMOL890 and pMOL1067 the time performance bigger fluctuation (see figure 4) is arranged.Therefore as if this construct is to detect good candidate's construct that determining presence of genotoxic compound exists, but it not too is suitable for detecting the existence of the individual gene toxic chemical in the mixture.
*The recN3-4 that contains the recN promotor of the up-promoter mutation that lacks the LexA2 site has very strong luminous, but the signal noise ratio is relatively poor.Therefore, this construct is unsuitable for as genotoxicity biosensor (Fig. 3 and Fig. 4).
In another experimentalists and technicians, detect the dose-effect curve of the intestinal bacteria 1106 that contain pMOL1066, pMOL1067, pMOL1068 or pMOL1069 respectively at MMS (concentration is 0.5-128ppm) and UV-irradiation (irradiation time is 2-10 second).These result of experiment are shown in Fig. 5 and 6.
In two experiments, obtained best result with pMOL1068 (recN2-4), pMOL1069 (recN3-4) then provides minimum signal/noise ratio.Use the sfiA-lux syzygy among the pMOL890 to obtain similar result.Based on these results, decision imports this four recN promotors-Lux fusion constructs (pMOL1066-pMOL1069) in Salmonella typhimurium Ames test strain TA98, TA100, TA104, TA1535 and TA1538, and sfiA-lux syzygy (pMOL890), and the inducing action as the function of SOS reaction (owing to the existence of genotoxicity product is brought out) of testing them.In Salmonella typhimurium, import promotor-lux fusion constructs and test
In Ames test salmonella typhimurium strain TA98, TA100, TA104, TA1535 and TA1538, import all five kinds of plasmids, pMOL890 and pMOL1066 to pMOL1069.The general feasibility of the overall conversion of Ames test strain is described thus.In Salmonella typhimurium, carry out the mutagenicity test
For check import pMOL890, pMOL1066, pMOL1067, pMOL1068 or pMOL1069 whether to the feature of the Salmonella typhimurium that is used for the mutagenesis test influence to some extent (according under the situation that has or do not exist the mutagenesis product from His
-To His
+Reply frequency determined), carry out standard A mes test with the derivative strain that contains above-mentioned plasmid of original Ames test strain and they.According to Maron and the described step of Ames (1983), MMS, 4-NQO, Nifurazolidone (furazolidone), 2-AF and benzo-α-pyrene are tested.The results are shown among the table 1A to 1G.All do not provide and test resulting result, but the comparison between the result who provides from table and table 1A and 1B, 1C and the 1D can draw such conclusion: import the His answer feature that plasmid does not change recombinant bacterial strain with original Ames.Therefore, can use recombinant bacterial strain to carry out traditional Ames test.In Salmonella typhimurium, carry out luminous test
For inducibility, use 64ppm MMS or 25.6ppb4-NQO to induce experiment according to following disclosed method with the different escherichia coli promoter construct of the bacterium SOS systems inspection of Salmonella typhimurium.Get in contrast without the inductive cell.Provided the result who uses recN-lux syzygy pMOL1067 and pMOL1068 to obtain among Fig. 7 and 8 with signal/noise ratio expression.
From these accompanying drawings (Fig. 7 and Fig. 8) as can be seen, induce kinetics slightly faster than with regard to the viewed kinetics of inducing of pMOL1067 (RecN1-3) with what pMOL1068 (RecN2-4) recorded, but will be higher than pMOL1068 (RecN2-4) with peak signal/noise ratio that pMOL1067 (RecN1-3) obtains.Therefore for the genotoxicity test, two constructs all are useful and complement one another.Find with the observed result of pMOL890 (sfiA) similar to result with pMOL1067.
Measure the minimum detectable concentration (MDC, nmol/ measures) of 13 kinds of products, wherein use the Salmonella typhimurium Ames test strain that contains pMOL890, pMOL1066, pMOL1067, pMOL1068 or pMOL1069.Provided in the table 2 with containing the Salmonella typhimurium TA104 of pMOL890, pMOL1066, pMOL1067, pMOL1068 or pMOL1069, and contained the result that the Salmonella typhimurium TA98 of pMOL890, pMOL1067 or pMOL1068 obtains.Give the MDC value that records with SOS colour developing test and Ames in the document in addition.For some product, can't calculate the MDC value of Ames test, and only indicate the positive (pos) or negative (neg) reaction.Table 1A: use salmonella typhimurium strain TA98, TA100, TA104, TA1535 and TA1538 carry out the Ames test to MMS
Table 1B: with the salmonella typhimurium strain TA98 that contains pMOL890
*, TA100
*, TA104
*, TA1535
*And TA1538
*MMS is carried out the Ames test
| ??????????????????????????????His +The revertant number | ||||||||||
| ???????TA98 | ????????TA100 | ???????TA104 | ??????TA1535 | ??????TA1538 | ||||||
| ?MMS?1μl | ????41 | ????38 | ????1120 | ????1282 | ????988 | ????836 | ????27 | ????38 | ????11 | ????12 |
| ?MMS?0,2μl | ????23 | ????32 | ????604 | ????560 | ????582 | ????404 | ????23 | ????24 | ????15 | ????15 |
| ?MMS?0,1μl | ????22 | ????35 | ????344 | ????392 | ????432 | ????512 | ????27 | ????18 | ????23 | ????20 |
| Average blank | ????????29 | ?????????146 | ???????478 | ????????32 | ????????15 | |||||
| Conclusion | ????????- | ??????????+ | ????????+ | ????????- | ????????- | |||||
| ?????????????????????His +The revertant number | ||||||||||
| ???????TA98 * | ???????TA100 * | ??????TA104 * | ??????TA1535 * | ?????TA1538 * | ||||||
| ?MMS?1μl | ????22 | ????27 | ????536 | ????528 | ????672 | ????724 | ????29 | ????26 | ????29 | ????27 |
| ?MMS?0,2μl | ????26 | ????28 | ????242 | ????314 | ????428 | ????325 | ????24 | ????24 | ????27 | ????28 |
| ?MMS?0,1μl | ????25 | ????27 | ????160 | ????152 | ????224 | ????218 | ????32 | ????32 | ????28 | ????36 |
| Average blank | ????????26 | ????????88 | ???????100 | ????????30 | ????????28 | |||||
| Conclusion | ????????- | ?????????+ | ????????+ | ?????????- | ?????????- | |||||
Table 1C: use salmonella typhimurium strain TA98, TA100, TA104, TA1535 and TA1538 carry out the Ames test to 4-NQO
Table 1D: with the salmonella typhimurium strain TA98 that contains pMOL890
*, TA100
*, TA104
*, TA1535
*And TA1538
*4-NQO is carried out the Ames test
Table 1E: with the salmonella typhimurium strain TA98 that contains pMOL890
*, TA100
*, TA104
*, TA1535
*And TA1538
*Nifurazolidone is carried out the Ames test
Table 1F: with the salmonella typhimurium strain TA98 that contains pMOL890
*, TA100
*And TA104
*2-AF is carried out the Ames test
Have (+S9) or do not have (S9) to carry out carrying out under the situation of metabolism activation test chart 1G: with the salmonella typhimurium strain TA98 that contains pMOL890
*, TA100
*And TA104
*Benzo-α-pyrene is carried out the Ames test
Have (+S9) or do not have (S9) to carry out testing under the situation of metabolism activation
Table 2: with containing pMOL890, pMOL1066, pMOL1067, the salmonella typhimurium strain TA104 of pMOL1068 or pMOL1069, with contain pMOL890, pMOL1066, pMOL1067, the salmonella typhimurium strain TA98 of pMOL1068 or pMOL1069 determines the minimum detectable concentration (MDC is with nmol/ test expression) of 13 kinds of products.Give the literature value of SOS colour developing test and Ames test.Table 3
| ?????????????????His +The revertant number | ||||||||||
| ???????TA98 | ?????????TA100 | ?????????TA104 | ??????TA1535 | ??????TA1538 | ||||||
| ?4-NQO?1μl | ????310 | ????348 | ????2288 | ????2160 | ????1520 | ????1760 | ????52 | ????38 | ????370 | ????360 |
| ?4-NQO?0,1μl | ????69 | ????60 | ????400 | ????440 | ????544 | ????520 | ????46 | ????48 | ????50 | ????51 |
| ?4-NQO?0,01μl | ????47 | ????50 | ????182 | ????174 | ????272 | ????448 | ????40 | ????38 | ????16 | ????15 |
| Average blank | ????????38 | ??????????131 | ?????????359 | ????????45 | ????????12 | |||||
| Average blank+DMSO | ????????33 | ??????????125 | ?????????374 | ????????31 | ????????15 | |||||
| Conclusion | ?????????+ | ???????????+ | ??????????+ | ????????- | ?????????+ | |||||
| ???????????????????His +The revertant number | ||||||||||
| ???????TA98 * | ??????TA100 * | ???????TA104 * | ?????TA1535 * | ??????TA1538 * | ||||||
| ?4-NQO?1μl | ????138 | ????189 | ????482 | ????461 | ????527 | ????691 | ????29 | ????25 | ????167 | ????192 |
| ?4-NQO?0,1μl | ????27 | ????37 | ????112 | ????101 | ????149 | ????161 | ????27 | ????26 | ????35 | ????40 |
| ?4-NQO?0,01μl | ????8 | ????15 | ????76 | ????86 | ????93 | ????106 | ????27 | ????26 | ????10 | ????14 |
| Average blank | ????????32 | ????????69 | ?????????95 | ????????30 | ????????33 | |||||
| Average blank+DMSO | ????????35 | ????????73 | ????????102 | ????????28 | ????????36 | |||||
| Conclusion | ?????????+ | ?????????+ | ?????????+ | ????????- | ????????+ | |||||
| ???????????????????His +The revertant number | ||||||||||
| ??????TA98 * | ??????TA100 * | ???????TA104 * | ??????TA1535 * | ?????TA1538 * | ||||||
| Nifurazolidone 10mmol | ????26 | ????30 | ????532 | ????544 | ????640 | ????620 | ????49 | ????38 | ????17 | ????18 |
| Nifurazolidone 1mmol | ????20 | ????14 | ????124 | ????132 | ????320 | ????308 | ????30 | ????15 | ????15 | ????7 |
| Nifurazolidone 0,1mmol | ????19 | ????8 | ????98 | ????108 | ????158 | ????140 | ????31 | ????22 | ????7 | ????9 |
| Average blank | ????????12 | ????????127 | ?????????135 | ????????36 | ?????????9 | |||||
| Average blank+DMSO | ????????11 | ????????118 | ?????????157 | ????????38 | ????????11 | |||||
| Conclusion | ?????????+ | ?????????+ | ??????????+ | ?????????- | ????????+/- | |||||
| ???????????????????His +The revertant number | ||||||||||||
| ???????????TA98 * | ??????????????TA100 * | ????????????TA104 * | ||||||||||
| ?2AF????670mmol???+S9 | ????5600 | ????6250 | ????2 | ????3 | ????548 | ????464 | ||||||
| ?2AF????670mmol???-S9 | ????62 | ????68 | ????0 | ????3 | ????120 | ????118 | ||||||
| ?2AF????67mmol????+S9 | ????3200 | ????2560 | ????134 | ????108 | ????350 | ????368 | ||||||
| ?2AF????67mmol????-S9 | ????34 | ????31 | ????11 | ????5 | ????115 | ????110 | ||||||
| ?2AF????67mmol????+S9 | ????576 | ????555 | ????73 | ????52 | ????178 | ????162 | ||||||
| ?2AF????6,7mmol???+S9 | ????9 | ????9 | ????1 | ????3 | ????144 | ????142 | ||||||
| ?2AF????6,7mmol???+S9 | ????52 | ????53 | ????33 | ????42 | ????188 | ????162 | ||||||
| Average blank+DMSO+S9 | ????12 | ????15 | ????22 | ????44 | ????51 | ????43 | ????184 | ????156 | ????130 | |||
| Average blank+DMSO-S9 | ????2 | ????3 | ????5 | ????33 | ????36 | ????27 | ????126 | ????90 | ????140 | |||
| Average blank+S9 | ????17 | ????12 | ????18 | ????59 | ????39 | ????45 | ????180 | ????192 | ????172 | |||
| Average blank-S9 | ????7 | ????9 | ????7 | ????4 | ????7 | ????10 | ????166 | ????160 | ????150 | |||
| Conclusion | ??????????????+ | ????????????????+ | ?????????????????+ | |||||||||
| ???????????????????????His +The revertant number | ||||||||||||
| ????????TA98 * | ???????????TA100 * | ???????????TA104 * | ||||||||||
| ?BαP????600mmol????+S9 | ????29 | ????33 | ????74 | ????73 | ????57 | ????69 | ||||||
| ?BαP????600mmol????-S9 | ????0 | ????0 | ????6 | ????3 | ????21 | ????19 | ||||||
| ?BαP????200mmol????+S9 | ????49 | ????50 | ????59 | ????58 | ????87 | ????87 | ||||||
| ?BαP????200mmol????-S9 | ????0 | ????0 | ????7 | ????23 | ????26 | ????32 | ||||||
| ?BαP?????50mmol????+S9 | ????446 | ????38 | ????64 | ????54 | ????82 | ????85 | ||||||
| ?BαP?????50mmol????-S9 | ????0 | ????0 | ????15 | ????11 | ????29 | ????27 | ||||||
| ?BαP?????10mmol????+S9 | ????24 | ????24 | ????67 | ????80 | ????97 | ????1062 | ||||||
| Average blank+DMSO+S9 | ????2 | ????0 | ????2 | ????21 | ????36 | ????27 | ????50 | ????50 | ????57 | |||
| Average blank+DMSO-S9 | ????0 | ????0 | ????0 | ????0 | ????0 | ????3 | ????22 | ????26 | ????25 | |||
| Average blank+S9 | ????0 | ????5 | ????4 | ????29 | ????25 | ????28 | ????49 | ????78 | ????41 | |||
| Average blank-S9 | ????0 | ????0 | ????0 | ????0 | ????0 | ????0 | ????28 | ????36 | ????31 | |||
| Conclusion | ???????????+ | ???????????????+ | ???????????????+ | |||||||||
| Minimum detectable concentration (MDC, nmol/ test) |
| ??????????????????????????TA104 | ????TA98 | ???TA98 | ???TA104 | ????SOS | ????AMES | |||||
| Product | ??pMOL1066 | ??pMOL1067 | ??pMOL1068 | ??pMOL1069 | ??pMOL1067 | ??pMOL1068 | ??pMOL890 | ??pMOL890 | The colour developing test | |
| The 2-aminofluorene | ????0.44 | ????0.22 | ????0.22 | ????0.22 | ????0.44 | ????0.22 | ????0.14 | ????0.14 | ????3.56 | ????0.67 |
| 2,4,5,7-tetranitro-9-Fluorenone | ????0.022 | ????0.011 | ????0.022 | ????0.011 | ????0.022 | ????0.011 | ????0.056 | ????0.011 | ????0.24 | ????0.001 |
| ??K2Cr207 | ????21.8 | ????5.4 | ????1.4 | ????10.9 | ????5.4 | ????1.4 | ????2.7 | ????2.7 | ????136 | ????91 |
| ??H2O2 | ????11.8 | ????11.8 | ????11.8 | ????5.9 | ????1.5 | ????1.5 | ????8.5 | ????3.8 | ????23 | Negative |
| Vulkamycin. PA-93 | ????1.26 | ????0.32 | ????1.26 | ????0.32 | ????0.079 | ????0.63 | ????0.57 | ????1.26 | Negative | Positive |
| ??ICR191 | ????1.1 | ????0.55 | ????0.55 | ????1.1 | ????0.28 | ????0.14 | ????0.14 | ????0.14 | ????0.13 | Positive |
| ?? | ????1.095 | ????0.55 | ????1.095 | ????0.55 | ????5.5 | ????5.5 | ????2.2 | ????2.2 | ????11 | Positive |
| Casamino acids | Negative | Negative | Negative | Negative | Negative | Negative | Negative | Negative | ????？ | ??????- |
| Nifurazolidone | ???0.00044 | ??0.00022 | ???0.00022 | ??0.00044 | ???0.00176 | ???0.00176 | ??0.00176 | ??0.00176 | ????0.01 | ????0.1 |
| Benzo (α) pyrene | ????0.16 | ????0.079 | ????0.16 | ????0.16 | ????0.16 | ????0.16 | ????1.59 | ????0.32 | ????0.7 | ????4 |
| 4-nitroquinoline-N-oxide compound | ????0.0034 | ????0.0017 | ????0.0008 | ????0.0017 | ????0.0017 | ????0.0008 | ????0.0008 | ????0.0005 | ????0.006 | ????0.003 |
| Methylmethanesulfonate | ????7.3 | ????7.3 | ????7.3 | ????7.3 | ????7.3 | ????7.3 | ????7.3 | ????7.3 | ????20 | ????60 |
| ??CdCl2 | Negative | Negative | Negative | Negative | Negative | Negative | Negative | Negative | Negative | Negative |
| Reagent | The result | Ames | SOS | Classification | Note |
| ICR191 | Sun | Sun | Sun | Acridine | |
| Endoxan | Cloudy | Sun | Cloudy | Antitumor drug | |
| Ametycin | Sun | Cloudy | Sun | Antitumor drug | |
| Methotrexate | Sun | Sun | Sun | Antitumor drug | |
| Nifurazolidone | Sun | Sun | Sun | Biocide | |
| Vulkamycin. PA-93 | Sun | Sun | Cloudy | Biocide | |
| carbadox | Sun | Sun | Sun | Biocide | |
| Nifuroxazide | Sun | Sun | Sun | Biocide | |
| Nalidixic acid | Sun | Cloudy | Sun | Biocide |
| Ethylene thiourea | Cloudy | Sun | Cloudy | Sterilant | |
| Carbarvl | Sun | Sun | Sun | Sterilant | |
| Lindane | Cloudy | Cloudy | Cloudy | Sterilant | |
| Pentachlorophenol | Sun | Sun | Sun | Weedicide |
| SeO 2 | Sun | Sun | Do not survey | Metal | Oxygenant |
| ZnCl 2 | Cloudy | Cloudy | Cloudy | Metal | Industrial |
| CdCl 2 | Cloudy | Cloudy | Cloudy | Metal | Industrial |
| K 2Cr 2O 7 | Sun | Sun | Sun | Metal | Oxygenant |
| H 2O 2 | Sun | Cloudy | Sun | Superoxide | Oxygenant |
| Sodiumazide | Sun | Sun | Cloudy | Trinitride | Industrial |
| Benzo (α) pyrene | Sun | Sun | Sun | PAH (five rings) | Environmental pollutant |
| Sun | Sun | Sun | PAH (Fourth Ring) | Environmental pollutant | |
| Naphthalene | Cloudy | Cloudy | Cloudy | PAH (Fourth Ring) | Environmental pollutant |
| Pyrene | Sun | Cloudy | Sun | PAH (Fourth Ring) | |
| 2,4,5,7-tetranitro-9-Fluorenone | Sun | Sun | Sun | PAH (three rings) | Environmental pollutant |
| 4-nitroquinoline-N-oxide compound | Sun | Sun | Sun | PAH (three rings) | Environmental pollutant |
| Fluoranthene | Sun | Sun | Sun | PAH (three rings) | Environmental pollutant |
| Anthracene | Cloudy | Cloudy | Cloudy | PAH (three rings) | Environmental pollutant |
| Luxuriant and rich with fragrance | Sun | Cloudy | Sun | PAH (three rings) | Environmental pollutant |
| N-Nitrosodiethylamine | Sun | Sun | Sun | Nitrosamine | |
| The 2-aminofluorene | Sun | Sun | Sun | Aromatic amine | |
| Casamino acids | Cloudy | Can not survey * | Cloudy | Amino acid | |
| Sodium laurylsulfonate | Cloudy | Cloudy | Cloudy | Anionic detergent | |
| Glucose | Cloudy | Cloudy | Cloudy | Sugar | |
| Methylmethanesulfonate | Sun | Sun | Sun | Sulphonate | |
| Ethyl methane sulfonate | Sun | Sun | Sun | Sulphonate |
Can not survey
*: owing to have the Histidine solvent, fuel,
| Hydrazine | Sun | Sun | Sun | Hydrazine | Rocket fuel |
| Epicholorohydrin | Sun | Sun | Sun | Propylene oxide | Solvent |
| The UV ray | Sun | Sun | Do not survey | Hertzian wave | Treatment ray, sunlight, |
| The RX ray | Sun | Sun | Sun | Hertzian wave | The treatment ray |
Select two kinds of products, i.e. casamino acids and CdCl
2As negative control.Because contain Histidine in the casamino acids, so can not detect it with the Ames test.
As can be seen from Table 2, can obtain best result with the bacterial strain that contains pMOL890, pMOL1067 or pMOL1068.The result who obtains with all constructs all is better than the result who obtains with SOS colour developing test, and wherein exception is that ICR191 provides similar result.These results also are better than the result who obtains with the Ames test greatly, and wherein exception is 2,4,5,7-tetranitro-9-Fluorenone.Therefore can think, provide one to test quicker, sensitive approach more when in Salmonella typhimurium Ames test strain, using sfiA and recN-lux genetic fusant (pMOL890, pMOL1066, pMOL1067, pMOL1068 or pMOL1069) to detect genotoxicity than SOS colour developing test and Ames.
Table 3 has provided with the result who contains the TA98 of pMOL1067 or pMOL1068 and the genotoxicity test that the TA104 bacterial strain carries out.Because similar, so only provide last test result (positive or negative) with the test result that these bacterial strains obtain.Test also obtains similar result with Ames in SOS colour developing test (SOS).The reagent of being tested is to be considered as representational reagent usually in following a few class: medicine, biocide, Insecticides (tech) ﹠ Herbicides (tech), mineral compound, polyaromatic, laboratory chemical substance, solvent, fuel and electromagnetic radiation.From this table, as can be seen, can use the TA Ames test strain of heterozygosis to detect the genotoxicity of all kinds of tested products, and test the result who obtains with use SOS colour developing test and Ames and have only very little difference.
In the time will comparing with the result who obtains with SOS colour developing test, can draw as drawing a conclusion with the result that TA98 that contains pMOL890, pMOL1067 or pMOL1068 and TA104 bacterial strain obtain:
When product is feminine gender in doing to test with TA98 that contains pMOL890, pMOL1067 or pMOL1068 and TA104 bacterial strain, also be negative with SOS colour developing test.Yet having the Vulkamycin. PA-93 of genotoxicity and sodiumazide is negative in SOS colour developing test, is positive but contain in the TA98 of pMOL890, pMOL1067 or pMOL1068 and the test that the TA104 bacterial strain is done in use.Therefore can think with containing the TA98 of pMOL890, pMOL1067 or pMOL1068 and the test that the TA104 bacterial strain is done, for the genotoxicity test, because do not obtain false negative result, so more more accurate than SOS colour developing test.When product was feminine gender in doing to test with TA98 that contains pMOL890, pMOL1067 or pMOL1068 and TA104 bacterial strain, it also was negative in the Ames test.Different is that endoxan and ethylene thiourea are negative in testing with TA98 that contains pMOL890, pMOL1067 or pMOL1068 and TA104 bacterial strain.This phenomenon is understandable, because these products do not bring out bacterium SOS reaction.
Discovery is false-negative genotoxicity product in the Ames test, for example ametycin, nalidixic acid, hydrogen peroxide, pyrene and phenanthrene are being done in the test positive with TA98 that contains pMOL890, pMOL1067 or pMOL1068 and TA104 bacterial strain.Therefore can think, the test of being done with the TA98 that contains pMOL890, pMOL1067 or pMOL1068 and TA104 bacterial strain not only as Ames good testing, and more accurate in the test of environmental pollutant such as PAH.The test of the genotoxicity product of combination
The reaction of different constructs when having more than one genotoxicity products in the checkout sample.This is a very important aspect, because environmental sample usually contains more than one genotoxicity pollutent.In addition, many medicament production that must carry out genotoxicity test being arranged may be the combination of different active gene toxicant (as antitumor or AIDS drug).TA98 and TA104 that use contains pMOL1067 or pMOL890 experimentize.Select these two kinds of constructs to be because they show similar kinetics and the best signal/noise of inducing than (seeing Fig. 7 and Fig. 8) in Salmonella typhimurium.As the test product, can adopt several combinations of MMS and Vulkamycin. PA-93.Select to use these products to be because we find that they have the different kinetics (for example, use pMOL1067, MMS provided maximum value after 2 hours, then observed the peak signal noise with Vulkamycin. PA-93 after 4 hours and compared) of inducing.These result of experiment examples have been listed among Fig. 9 and 10.
From these results as can be seen, (recN 1, and bacterial strain 3-lux) can detect at least two kinds of individual gene toxic chemicals in the mixture of determining presence of genotoxic compound with containing pMOL890 (sfiA-lux) or pMOL1067.This is just in time opposite with desired situation, because be contemplated that increase rather than two one maximum values of peak signal.
Checked also whether the data that obtain with MMS and Vulkamycin. PA-93 combination in the former experiment can produce the genotoxicity ordering of used various combination, and whether this ordering is with the same with different test strain [for example using TA98 (pMOL1067) and TA104 (pMOL890)] gained result.For this reason, calculate the resultant signal/noise ratio of every kind of combination being tested, then with them from low paramount the ordering.The visible different test strain of result produces rational, identical ordering.About example is shown in Figure 11 and 12.Toxotest
Different constructs also produces the bias light signal under the situation that does not have the genotoxicity product, this is called noise.This noise signal can be used as the metric signal that detects toxicity rather than determining presence of genotoxic compound.Think particularly can show relatively than bacterial strain high noisy, that contain pMOL890 and pMOL1068 and be well suited for this toxotest (their noise can be elevated to 13000 relative light units from 100 in 4 hours experimentations) that the bacterial strain that contains pMOL1066 or pMOL1067 with low noise is use little (their noise is elevated to 750 relative light units from 20 in 4 hours experimentations) then.As shown in Figure 13 and 14, when the toxic product R116 with different concns handled, the luminous quantity of observing the TA98 bacterial strain that contains pMOL1067 or pMOL1068 reduced.
Relatively as seen Figure 13 and 14 uses the observed signal of TA98 (pMOL1068)/noise ratio more than detected more constant with TA98 (pMOL1067).Because bacterial strain TA98 (pMOL1068) has much higher basic luminescence amount,, and then cause the fluctuation of signal/noise data of calculating also less so the error importance in the measurement of luminous quantity is not too big.Bacterial strain TA98 (pMOL1068), also having other bacterial strains that contain pMOL890 or pMOL1068 is of great use for the IC50 calculated value of toxic product.Preferred bacterial strain will show the same with bacterial strain TA98 (pMOL1068) at least basic luminescence amount.The test of environmental sample
Show that the bacterial strain contain pMOL890, pMOL1067 or pMOL1068 is sensitiveer than traditional Ames test when the test potential environmental pollutant (as PAH) because pure product tested, so use these bacterial strains to come the test environment sample.The example that provides is :-estimation is to the appearance of the bioreediation-water-soluble PAH degraded product of PAH Contaminated soil
With 500ppm mixture (the Borneff mixture that contains naphthalene, phenanthrene, anthracene, fluoranthene, pyrene and benzo-α-pyrene) contaminated soil sample.In bio-reactor, handle this soil then to stimulate degradation by bacteria PAH.In order to estimate the bioreediation of soil and to check the reduction of genotoxicity, get the 10g pedotheque in during 3 weeks.Extract these samples with hexane (1ml/g soil), and extract is concentrated 100 times.With 1 to 8 times of spissated extract dilution, and be used for genotoxicity test (being with or without metabolic activation).Calculate the genotoxicity value of every kind of sample as (be higher than during the highest positive extent of dilution signal/noise of 2 than the) * product of (extension rate).For example, if find that signal/noise ratio is 2.8 when diluting 4 times, then the genotoxicity value of this sample is 11.2.To the mapping of genotoxicity value, this can make good evaluation to the genotoxicity of this contaminated soil.Provided relevant experimental data among Figure 15.
As can be seen from Figure 15, As time goes on, reducing appears in the genotoxicity of PAH Contaminated soil.The bacterial strain that this proof contains pMOL890, pMOL1067 or pMOL1068 is applicable to the bioreediation effect of following the tracks of and estimating the soil that has polluted the genotoxicity product very much.Generally contain and have the bacterial strain that inductivity is higher than the sequence of the promotor that 40 SOS regulates and all can be used in the preferred embodiments of the invention, wherein said promotor effectively links to each other with the nucleotide sequence of coding reporter molecule, coded reporter molecule can produce can be luminous the signal measured of form.Any host microorganism of claim all is applicable in such test.
In order to analyze the generation of water-soluble intermediate PAH degraded product, the degraded of luxuriant and rich with fragrance, fluorenes and fluoranthene is detected.For this reason, with the saturated basic M9 substratum that does not add extra carbon source of 0.1%PAH, and can the degrade bacterial strain of PAH of inoculation.Took out sample (200ml) in per 3 days, and concentrate it according to people's such as Grifoll (1994) method.Under pH2.5 or pH7 condition, extract and with sample concentration to 5ml.In each 1ml of every kind of sample of 37 ℃ of dryings, and be suspended in again among the 100 μ l DMSO.Getting wherein, 1 μ l is used for the genotoxicity test.Observing luxuriant and rich with fragrance genotoxicity increased before this, reduced again then; Fluorenes does not demonstrate the obvious increase of genotoxicity, but the genotoxicity of visible fluoranthene increases.This shows formation and the accumulation that the genotoxicity midbody compound is arranged.Provided the result of estimation bacterial strain LB208 degraded fluoranthene among Figure 16.Only provide the data of extracting under the pH2.5 condition.
As can be seen, the bacterial strain that contains pMOL890, pMOL1067 or pMOL1068 is applicable to the degraded of estimation genotoxicity pollutent and the appearance and the accumulation of genotoxicity intermediate degraded product from this experiment.In a word, can have that inductivity is higher than 20, preferably is higher than 40, the bacterial strain that most preferably is higher than the sequence of the promotor that 50 SOS regulates is used for preferred embodiment with containing, wherein said promotor effectively links to each other with the nucleotide sequence of coding reporter molecule, coded reporter molecule can produce can be luminous the signal of form mensuration.Any host microorganism of claim is all applicable in such test.As to the DMSO extract of the soil of gazoline pollution analysis proved, also might carry out toxotest to environmental sample.The high more toxicity that makes of the concentration of extract becomes to increasing (data not shown goes out) more.With the toxic standard operating instructions of recN-lux bacterium test cdna
1. foreword
This test is based on the bacterium that contains as the Fei Shi vibrios lux operon of a SOS system part, and wherein said lux operon is in the control of recN gene transcription down.After the genotoxicity product was incubated, the recN promotor was prevented releasing with cell, caused the expression of lux operon.This expressing gene produces luminous with toxic functional form.Yet the test of using the sfiA-lux bacterial strain to finish is also carried out in the same way.Those skilled in the art also can use this method, and other system of the promotor that the SOS of containing of the present invention is regulated tests.
2. bacterial strain-TA104 recN1-3-TA104 recN2-4-TA98 recN1-3-TA98 recN2-4
3. material
3.1 substratum
3.1.1869 substratum (pH=7)
Every liter of deionized water contains: Tryptones 10g, yeast extract 5g, NaCl 5g, glucose D1g, CaCl
22H
2O 0.345g, halfcystine 30mg.
To cultivate based on 120 ℃ of autoclavings 20 minutes.Add tsiklomitsin (20 μ g/ml) and penbritin (100 μ g/ml).Nutrient media storage is standby in 4 ℃.
3.1.2 barren 869 substratum (pH=7)
Every liter of deionized water contains: Tryptones 2g, yeast extract 1g, NaCl5g, glucose D1g, CaCl
22H
2O 0.345g, halfcystine 30mg.
3.2 S9 composition
3.2.1?S9
Use standard method from rats'liver, to obtain arochlors inductive microsome component S 9.Can obtain it from the pharmaceutical factory.
3.2.2 KCl/MgCl
2Solution
KCl6.15g, MgCl
26H
2O 4.7g, adding distil water is to 100ml.Autoclaving is also stored under room temperature.
3.2.3?0.1M?β-NADP
β-NADP 500mg adds sterile distilled water 6.53ml, is stored in-20 ℃ with every part 500 μ l in freeze pipe.
3.2.4 1M G-6-P (G6P)
G6P 282mg adds sterile distilled water 1ml, is stored in-20 ℃ in freeze pipe.
3.2.5 phosphate buffered saline buffer 0.2M (pH=7.4)
60ml 0.2M NaH
2PO
4H
2O, 440ml 0.2M Na
2HPO
4, transfer pH to 7.4 and, be stored under the room temperature with 100ml equal portions autoclaving.
3.3 chemical substance-DMSO: the solvent-MMS of hydrophobic product: without the following positive control-4NQO that does test of metabolism situation: without the positive control-2AF of the hydrophobic product of test under the metabolism situation: through the following positive control tested done of S9 metabolism situation
3.4 equipment
96 hole microtiter plate photometers, it is computer-controlled, data can be recorded on the working stroke paper.
4. testing method
4.1 keeping of culture with initial
4.1.1 keep
Scrape and seldom measure the permanent culture of refrigerated and be inoculated in 25ml 869 substratum (seeing 3.1.1).In the last 37 ℃ of overnight incubation of rotary shaker (170rpm) (ON).Add 2.5mlDMSO morning next day.Bacterial suspension divided install in the freezing test tube and in-80 ℃ of preservations.Get a test tube and be used for test as the bacterium that is recommended as Ames bacterial strain (rfa, pKM101 etc.).
4.1.2 initial test cultures
Inoculate 5ml 869 substratum (seeing 3.1.1) with 40 μ l bacterium stostes (seeing 4.1.1), and go up overnight incubation at rotary shaker (170rpm) in 37 ℃.In morning next day, 20 μ l overnight culture are inoculated in barren 869 substratum of 2.5ml (seeing 3.1.2).37 ℃ are rocked (170rpm) and cultivated 1 hour down.
4.2 the dilution of test product
4.2.1 stock solution
Select the concentration of stock solution as the function of solubleness and required maximum concentration.Be weighed into several milligrams of products (Amg) and add the solvent of volume required (Vml) in bottle, to obtain required concentration (Smg/ml), calculating formula is V=A/S.
4.2.2 the dilution of test product
In 8 bottles (1-8 number), respectively add 50 μ l solvent (H
2O or DMSO).In 1 bottle (No. 9), add 100 μ l stock solutions.From No. 9 bottle transferase 45 0 μ l to 8 bottles, mix 5 times and get 50 μ l and transfer to that the rest may be inferred in No. 7 bottles with liquid getting device, up to No. 2 bottles.Mix the back and from No. 2 (#2), discard 50 μ l.
In each bottle, add barren 869 substratum of 450 μ l.Getting 10 μ l from each bottle changes in 96 orifice plates :-move into hurdle 1,2 and 3 (=solvent control) from No. 1 bottle ,-move into hurdles 4 from No. 2 bottles, move into hurdles 5 from No. 3 bottles, so up to the hurdle 11.
4.2.3 the preparation of positive control
The application of positive control is referring to 3.3 joints.
2AF (8ppm): the 6400ppm solution of preparation in DMSO; The twice dilution is until 800ppm in 50 μ l DMSO; Add barren 869 substratum of 450 μ l (=80ppm); In hole E12, F12, G12, H12, respectively shift 10 l.
4NQO (4ppb): the 1000ppm solution of preparation in DMSO; Adding 960 μ l DMSO in 40 these solution of μ l (=40ppm); Adding 990 μ l DMSO in 10 these solution of μ l (=0.4ppm); Barren 869 substratum of adding 450 μ l in this 0.4ppm solution of 50 μ l (=40ppb); Shift 10 μ l to hole A12, B12, C12, D12.
MMS (16ppm): 5 μ l MMS are added to 995 μ l H
2O (=6400ppm); At 50 μ l H
2Dilute 2 times among the O until 1600ppm; In this 1600ppm solution of 50 μ l, add barren 869 substratum of 450 μ l; Shift 10 μ l to hole A12, B12, C12, D12.
4.3 adding or do not add the S9 mixture experimentizes
4.3.1 add the S9 mixture
Prepared fresh S9 mixture before generally in joining bacterium
In pipe, mix gently: 100 μ l KCl:MgCl
2(3.2.2), 100 μ l β-NADP (3.2.3), 50 μ l G6P (3.2.4), 2500 μ l phosphate buffered saline buffers (3.2.5), barren 869 substratum of 2500 μ l (3.1.2), 132 μ l S9.-adding bacterium
Mix gently: 140 μ l bacterial suspensions (4.1.2), barren 869 substratum of 860 μ l, 400 μ l S9 mixtures.
Shift 90 μ l extremely:
Hole E1 is to E12:TA104 recN1-3
Hole F1 is to F12:TA104 recN2-4
Hole G1 is to G12:TA98 recN1-3
Hole H1 is to H12:TA98 recN2-4
4.3.2 do not add the S9 mixture
In 140 μ l bacterial suspensions (4.1.2), add barren 869 substratum of 1260 μ l.
Shift 90 μ l extremely:
Hole A1 is to A12:TA104 recN1-3
Hole B1 is to B12:TA104 recN2-4
Hole C1 is to C12:TA98 recN1-3
Hole D1 is to D12:TA98 recN2-4
5. measure
Be placed on 96 hole flat boards on the photometer and begin and measure (1 second/hole; Every circulation primary 300 seconds; 60 circulations; 30 ℃).
6. calculate
After finishing mensuration, with data storage on work schedule.With these group data transfer to automatic calculating believe/make an uproar than big paper on, make chart and also make final report (FR).
7. estimate
Think that under following situation product has genotoxicity:
1) at least under 2 concentration, signal/noise ratio is equal to or higher than 2;
2) clearly dosage-effect reaction is arranged.Reference :-Beck E. and Bremer E. (1980).The nucleotide sequence of the ompA gene of the outer membrane protein II * of coding e. coli k12.Nucleic acids research, 8:3011-3027.-Finch P.W., Chambers P. and Emmerson P.T.1985. intestinal bacteria recN gene product are accredited as main SOS albumen.The bacteriology magazine, 164:653-658.-Gee P., Maron D.M. and Ames B.N. (1994). the detection of mutagens and classification: a cover base specific Salmonellas test strain.Institute of NAS newspaper, 91:11606-11610.-Grifoll M., Selifonov S.A. and Chapman P.J. (1994).Evidence by the new way of pseudomonas kind degraded fluorenes.Applied environment microbiology, 60:2438-2449.-Maron D.M. and Ames B.N. (1983). improving one's methods of Salmonellas mutagenicity test.Mutation research, 113:173-215.-Murray N.E., Brammar W.J. and Murray K. (1977). can simplify the lambda particles phage that the vitro recombination body reclaims.Mol.Gen?Genet.,150:53-61。-Oda Y., Nakamura S., Oki I., Kato T. and Stinagawa H. (1985).The assessment of the new system of testing environment mutagens and carcinogen (umu test).Mutation research, 147:219-229.-Peterson K.R. and Mount D.W. (1987). unsettled LexA41 (Ts1-1) albumen is prevented the division phenotype that causes e. coli k12 to the differentiation of SOS gene.The molecular biology magazine, 193:27-40.-Picksly S.M., Morton S.J. and Lloyd R.G. (1985). the recN site of e. coli k12: the analysis of molecules of its gene product and evaluation.Mol.Gen.Genet.,201:301-307。-Quillardet P., Huisman O., D ' Ari.R. and Hofnung M. (1982) the .SOS test that develops the color, a kind of in e. coli k12 the SOS function induce the method for direct mensuration genotoxicity.Institute of NAS newspaper, 79:5971-5975.-Rostas K., Morton S.J., Picksley S.M. and Lloyd R.G. (1987). the nucleotide sequence of intestinal bacteria recN gene and LexA regulation and control.Nucleic acids research, 15:5041-5049.-Schnarr M., Oertel-Buchheit P., the DNA binding characteristic of Karmaier M. and Granger-Schnarr M. (1991) LexA repressor.Biochemie,73:423-431。
Claims (25)
1. comprise the recombinant nucleic acid sequence that inductivity is higher than the promotor that 40 SOS regulates, said promotor is effectively connected on the nucleotide sequence of coding reporter molecule, coded reporter molecule can produce can luminous form mensuration signal.
2. according to the recombinant nucleic acid sequence of claim 1, wherein promotor is selected from one group by promotor that can the molecular SOS of derivative startup regulates during regroup is repaired.
3. according to any one recombinant nucleic acid sequence in the aforementioned claim, wherein promotor is selected from special member, RecO, RecQ, ruv and the uvrD of RecF, RecJ, RecN, RecF approach.
4. according to any one recombinant nucleic acid sequence in the aforementioned claim, wherein promotor is RecN (Seq.ID.No.3).
5. according to any one recombinant nucleic acid sequence in the aforementioned claim, wherein promotor contains the sudden change that can improve promotor intensity or regulating effect, and said sudden change does not destroy the SOS regulating effect.
6. according to any one recombinant nucleic acid sequence in the aforementioned claim, wherein promotor contains at least one active LexA binding site and has sudden change in another LexA binding site at least.
7. according to any one recombinant nucleic acid sequence in the aforementioned claim, wherein promotor contains at least one active LexA binding site, and has sudden change in another LexA binding site at least, and said sudden change does not change the wild-type promoter sequence.
8. according to any one recombinant nucleic acid sequence in the aforementioned claim, wherein promotor be sudden change RecN promotor that following nucleotide sequence ID.No.7 is arranged (=rec1-3).
9. according to any one recombinant nucleic acid sequence in the aforementioned claim, wherein promotor contains up-promoter mutation.
10. according to any one recombinant nucleic acid sequence in the aforementioned claim, wherein promotor contains the up-promoter mutation in said promotor-35 zone.
11. according to any one recombinant nucleic acid sequence in the aforementioned claim, wherein promotor be RecN promotor with sudden change of following nucleotide sequence ID.No.9 (=rec2-4).
12. according to the recombinant nucleic acid sequence of claim 1, wherein promotor is sfiA.
13., contain luciferase A and B gene in the nucleotide sequence of the reporter molecule of wherein encoding according to any one recombinant nucleic acid sequence in the aforementioned claim.
14. according to any one recombinant nucleic acid sequence in the aforementioned claim, contain luciferase A and B gene in the nucleotide sequence of the reporter molecule of wherein encoding, and produce required luciferase C, D and the E gene of limited lipid acid substrate that is used for recirculation.
15. contain the host microorganism of the recombinant nucleic acid sequence of any one in the aforementioned claim.
16. according to the host microorganism of claim 15, said host microorganism is intestinal bacteria.
17. according to the host microorganism of claim 15, said host microorganism is a Salmonella typhimurium.
18. according to the host microorganism of claim 17, said host microorganism also has the feature of suitable Ames test microbes.
19. according to the host microorganism of claim 17 or 18, said host microorganism is selected from TA98, TA100, TA102, TA104, TA1535, TA1538, TA7001 to TA7006, and TA7041 to TA7046.
20. the method that the several genes toxic chemical exists in the test sample, said method may further comprise the steps :-cultivation host microorganism, said host microorganism comprises the nucleotide sequence of the promotor that has the SOS adjusting, said promotor is effectively connected on the nucleotide sequence of coding reporter molecule, coded reporter molecule can produce and can be determined as the signal that light takes place,-measure the luminous of culture, said mensuration is carried out on each time point, preferably measure continuously, and on said time point detection signal/noise ratio, the gained data are mapped, the genotoxicity kinetics of said data represented said sample, wherein a plurality of peaks show and have the multiple dynamic (dynamical) determining presence of genotoxic compound of not isogeneous induction that has.
21. the method that determining presence of genotoxic compound exists in the test sample, said method may further comprise the steps :-cultivation host microorganism, said host microorganism comprises and has the nucleotide sequence that inductivity is higher than the promotor that 20 SOS regulates, said promotor is effectively connected on the nucleotide sequence of coding reporter molecule, coded reporter molecule can produce can be luminous the signal measured of form,-on a plurality of time points, preferably measure the luminous of culture continuously, and-determine culture luminous whether change taken place, increase luminous promptly showing and have determining presence of genotoxic compound.
22. the genotoxicity dynamics methods of test sample, said method comprises the step of finishing defined in the claim 21, wherein on a plurality of time points, preferably measure continuously luminous, also finish following step in addition :-luminous signal/noise the ratio of detection on said time point, and-with luminous signal/noise data mapping, said figure represents the kinetics of the genotoxicity of said sample.
23. according to claim 20,21 or 22 method, wherein host microorganism is according to any one host microorganism among the claim 15-19.
24. the genotoxicity of test sample and the method for mutagenicity, said method comprises the method for finishing claim 23, finishes traditional Ames test then.
25. the method that the test sample toxic compounds exists, said method may further comprise the steps :-cultivation host microorganism, said host microorganism is according to any one host microorganism among the claim 15-19,-measure the luminous of culture, and-determine culture luminous whether change taken place, luminous reduction promptly shows and has toxic chemical.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB961803088A CN1209459C (en) | 1996-04-25 | 1999-01-28 | Recombinant nucleic acid sequences and methods for determining both genotoxicity and mutagenicing of sample and kinetics of genetoxicity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB961803088A CN1209459C (en) | 1996-04-25 | 1999-01-28 | Recombinant nucleic acid sequences and methods for determining both genotoxicity and mutagenicing of sample and kinetics of genetoxicity |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410076860 Division CN1629297A (en) | 1996-04-25 | 1996-04-25 | Recombinant nucleic acid sequence and method for detecting gene toxicity, mutagenicity and dynamics of gene toxicity for the samples |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1219974A true CN1219974A (en) | 1999-06-16 |
| CN1209459C CN1209459C (en) | 2005-07-06 |
Family
ID=5127792
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB961803088A Expired - Lifetime CN1209459C (en) | 1996-04-25 | 1999-01-28 | Recombinant nucleic acid sequences and methods for determining both genotoxicity and mutagenicing of sample and kinetics of genetoxicity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1209459C (en) |
-
1999
- 1999-01-28 CN CNB961803088A patent/CN1209459C/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| CN1209459C (en) | 2005-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kawai et al. | 16S ribosomal DNA-based analysis of bacterial diversity in purified water used in pharmaceutical manufacturing processes by PCR and denaturing gradient gel electrophoresis | |
| Watanabe et al. | Molecular detection, isolation, and physiological characterization of functionally dominant phenol-degrading bacteria in activated sludge | |
| Christensen et al. | Establishment of new genetic traits in a microbial biofilm community | |
| Trotochaud et al. | 6S RNA function enhances long-term cell survival | |
| Sangwan et al. | Detection and cultivation of soil Verrucomicrobia | |
| Dong et al. | Genomic interspecies microarray hybridization: rapid discovery of three thousand genes in the maize endophyte, Klebsiella pneumoniae 342, by microarray hybridization with Escherichia coli K-12 open reading frames | |
| Gordon et al. | Chromosome and low copy plasmid segregation in E. coli: visual evidence for distinct mechanisms | |
| Billard et al. | Bioluminescence-based assays for detection and characterization of bacteria and chemicals in clinical laboratories | |
| Heitzer et al. | Physiological considerations of environmental applications of lux reporter fusions | |
| Hübner et al. | Genes for 2, 4, 5-trichlorophenoxyacetic acid metabolism in Burkholderia cepacia AC1100: characterization of the tftC and tftD genes and locations of the tft operons on multiple replicons | |
| Johnsen et al. | Quantitative selective PCR of 16S ribosomal DNA correlates well with selective agar plating in describing population dynamics of indigenous Pseudomonas spp. in soil hot spots | |
| Saint-Ruf et al. | Massive diversification in aging colonies of Escherichia coli | |
| Tolker-Nielsen et al. | Visualization of specific gene expression in individual Salmonella typhimurium cells by in situ PCR | |
| Wretlind et al. | Protease-deficient mutants of Pseudomonas aeruginosa: pleiotropic changes in activity of other extracellular enzymes | |
| Piñar et al. | Detection of indigenous Halobacillus populations in damaged ancient wall paintings and building materials: molecular monitoring and cultivation | |
| Chase et al. | Escherichia coli mutants deficient in exonuclease VII | |
| Mansfeldt et al. | Meta-analyses of Dehalococcoides mccartyi strain 195 transcriptomic profiles identify a respiration rate-related gene expression transition point and interoperon recruitment of a key oxidoreductase subunit | |
| Urwyler et al. | Advantage of MALDI‐TOF‐MS over biochemical‐based phenotyping for microbial identification illustrated on industrial applications | |
| Comte et al. | Biochemical, transcriptional and translational evidences of the phenol-meta-degradation pathway by the hyperthermophilic Sulfolobus solfataricus 98/2 | |
| Kanitkar et al. | Loop-mediated isothermal amplification (LAMP) for rapid detection and quantification of Dehalococcoides biomarker genes in commercial reductive dechlorinating cultures KB-1 and SDC-9 | |
| Bhagwat et al. | Computational methods and evaluation of RNA stabilization reagents for genome-wide expression studies | |
| Sanchez et al. | Identification of genes required for swarming motility in Bacillus subtilis using transposon mutagenesis and high-throughput sequencing (TnSeq) | |
| Mourembou et al. | Rise of Microbial Culturomics: Noncontiguous Finished Genome Sequence and Description of Beduini massiliensis gen. nov., sp. nov. | |
| Miura et al. | Screening of genes involved in isooctane tolerance in Saccharomyces cerevisiae by using mRNA differential display | |
| Audia et al. | DNA microarray analysis of the heat shock transcriptome of the obligate intracytoplasmic pathogen Rickettsia prowazekii |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CI01 | Correction of invention patent gazette |
Correction item: Published date Correct: 19971106 False: 19990812 Number: 27 Page: 595 Volume: 21 Correction item: international publication Correct: WO97/41251 False: WO1999/039565 Number: 27 Page: 595 Volume: 21 Correction item: International application date Correct: 19960425 False: 19990128 Number: 27 Page: 595 Volume: 21 Correction item: International application Correct: PCT/EP96/01745 False: PCT/FR1999/000173 Number: 27 Page: 595 Volume: 21 |
|
| CI03 | Correction of invention patent |
Correction item: Published date Correct: 19971106 False: 19990812 Number: 27 Page: The title page Volume: 21 Correction item: international publication Correct: W097/41251 False: W01999/039565 Number: 27 Page: The title page Volume: 21 Correction item: International application date Correct: 19960425 False: 19990128 Number: 27 Page: The title page Volume: 21 Correction item: International application Correct: PCT/EP96/01745 False: PCT/FR1999/000173 Number: 27 Page: The title page Volume: 21 |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INTERNATIONAL APPLICATION INTERNATIONAL PROCLAMATION PUBLICATION DATE INTERNATIONAL APPLICATION DATE; FROM: PCT/FR1999/000173 WO1999/039565 1999.8.12 1999.1.28 TO: PCT/EP96/01745 WO97/41251 1997.11.6 1996.4.25 |
|
| ERR | Gazette correction |
Free format text: CORRECT: INTERNATIONAL APPLICATION INTERNATIONAL PROCLAMATION PUBLICATION DATE INTERNATIONAL APPLICATION DATE; FROM: PCT/FR1999/000173 WO1999/039565 1999.8.12 1999.1.28 TO: PCT/EP96/01745 WO97/41251 1997.11.6 1996.4.25 |
|
| CX01 | Expiry of patent term |
Granted publication date: 20050706 |
|
| EXPY | Termination of patent right or utility model |