CN1219056C - Phytase APPB and DNA for coding same - Google Patents

Abstract

The present invention relates to a phytic acid enzyme APPB, DNA for encoding the phytic acid enzyme, expression vectors containing the phytic acid enzyme, recombination yeast cells containing the expression vectors, and animal food containing the phytic acid enzyme. The phytic acid enzyme APPB has the advantages of high specific activity, capability of resisting pepsin and trypsin and strong expression capability. Compared with the existing phytic acid enzymes, the phytic acid enzyme APPB has reduced production cost, and animal feed products containing the phytic acid enzyme can be used for the enzymolysis of phytic acid phosphorus in animal bodies.

Description

The DNA of phytase APPB and this phytase of encoding

Technical field

The present invention relates to a kind of phytase, particularly a kind of phytase APPB also relates to the DNA of this phytase that encodes simultaneously, and contains the expression vector and the recombinant yeast cell that contains this expression vector of this phytase.

Background technology

Phytase is mainly used in the intravital phytate phosphorus of enzymolysis animal and makes it be degraded to inositol and phosphoric acid in the prior art, can absorbed phosphorus thereby replenish to animal, thereby avoid animal to produce rickets and osteoporosis; Also avoid simultaneously phytate phosphorus and the intravital multiple metal ion (Zn of animal ²⁺, Ca ²⁺, Cu ²⁺, Fe ²⁺Deng) and the protein chelating become corresponding insoluble mixture, and cause animal can't effectively utilize to these nutritive elements.

Chinese invention patent 97121731.9 discloses a kind of phytase, and this phytase expression amount on the lab scale level reaches 5 * 10 ⁵U/mL brings up to 1 * 10 with expression amount on the pilot scale level ⁶The U/mL fermented liquid.But in this research, because the phytase specific activity that is adopted is lower, though the absolute expression amount of phytase has reached 10mg zymoprotein/mL fermented liquid in recombinant bacterial strain, has reached higher level, but the enzymic activity in the unit volume fermented liquid still is on the low side, thereby production cost is higher.

The antitrypsin of phytase and pepsic ability are one of key factors that influences the phytase practical application effect.The effect place of phytase is the gi tract of animal, animal secretes multiple protein enzymes such as stomach en-, trypsinase with digest food in gi tract, phytase itself is exactly a kind of protein, also might be lost activity by these proteasome degradations, this must have certain resistance to the proteolytic enzyme in the animal gastrointestinal tract with regard to requiring phytase.Igbasan (Igbasan.Arch anim nutr in 2000,53:353-373,2000) result of study shows, the phytase of originated from fungus comprises present commercial phytase, and the ability of its antipepsin is all relatively poor, with pepsin after 60 minutes, the remaining activity of phytase is no more than 33%, only has the phytase APPA remaining activity in intestinal bacteria source also to maintain about 95%, has good antipepsin ability.But Rodriguez further discovers (Rodriguez.Arch BiochemBiophys, 365:262-267,1999), though APPA has good antipepsin ability, it is antitrypsin not really, handle after 30 minutes and 2 hours, enzymic activity has lost 87% and 95% respectively.

Summary of the invention

The objective of the invention is to overcome weak point of the prior art, and a kind of specific activity height, simultaneously antipepsin and trypsinase, articulate phytase APPB be provided, further purpose of the present invention is to provide a kind of DNA of this phytase of encoding, the present invention also aims to provide a kind of, by this carrier transformed host cells and the animal-derived food product that contains this phytase by this DNA deutero-carrier.

The objective of the invention is to realize by following approach.

Phytase APPB, it is the phytase of the purifying of the aminoacid sequence shown in a kind of APPB of having ID NO:1.

Biological phytase APPB derives from a kind of intestinal bacteria biology among the present invention, and it has good while antipepsin and tryptic ability.Report most phytases at present, the phytase that comprises fungies such as deriving from aspergillus and genus bacillus is antipepsin (Igbasan.Archanim nutr not all, 53:353-373,2000), and derive from colibacillary phytase APPA (Greiner, Arch Biochem Biophys, 303:107-113,1993; Rodriguez, Biochem Biophys Res Commun, 257:117-123,1999) good stomach en-resistance is arranged, but to trypsin-resistant very poor (Rodriguez.Arch Biochem Biophys, 365:262-267,1999).The phytase that does not also have at present report simultaneously stomach en-and trypsinase all to be had high resistance.

The present invention adopts the phytase APPB behind the purifying to carry out the mensuration of antipepsin and trypsinase ability, found that, stomach en-and trypsin acting are after 2 hours, the enzymic activity of phytase all still maintains more than 90%, has good while antipepsin and tryptic activity (see figure 1).

Phytase APPB among the present invention has high specific acitivity, and its specific activity reaches 3.2 * 10 ⁶The U/mg zymoprotein is than the phytase (1 * 10 in aspergillus source ⁵U/mg) highly 30 times (see VanGorcom R.F.M.et al., 1995; Yao Bin etc., Chinese invention patent 97121731.9,2000), higher 6 times than the phytase (Lassen, US Patent 6060298,2000) in Peniophora source.As seen phytase APPB of the present invention has the specific activity higher than phytase in the prior art.

Phytase of the present invention can be transformed by technology such as chemosynthesis after round pcr, site-directed mutagenesis technique, the gene design, uses expression system to express.Selectable expression system comprises low wait eukaryotic expression system such as yeast, filamentous fungus etc.; Prokaryotic expression system intestinal bacteria, genus bacillus, lactobacillus, baculovirus etc.; High eukaryotic expression system such as corn, soybean, paddy rice, pig, chicken, duck and various fish and insect etc.Among the present invention, for phytase gene can be efficiently expressed in pichia spp, we remove the original signal peptide sequence of phytase gene APPB by the method for PCR, improved phytase gene is inserted on the Yeast expression carrier that has α-factor signal peptide sequence, behind transformed yeast cell, stable integration is to yeast chromosomal, and this recombination yeast is after fermentation culture, and the phytase albumen of expression is secreted in the substratum under the guiding of signal peptide.After measured, the phytase expression amount reaches 4 * 10 ⁶U/mL, high nearly 15 times of being reported than the highest patent of international expression level (VanGorcom R.F.M.et al., Patent No.US 5436156,1995).

The present invention result after deliberation also shows (as shown in Figure 2), and the phytase of expression accumulates with the increase of induction time, peaks when inducing 106 hours, and when expression amount at this moment reached the 4mg/mL fermented liquid, enzymic activity reached 4 * 10 ⁶The U/mL fermented liquid.The zymoprotein molecular weight size of expressing is about 50kD, and about the big 5kDa of theoretical molecular than phytase, this may be because carried out modification-glycosylation behind the protein translation.Above result proves that phytase gene has not only obtained expression, effectively secretion, and the phytase of expressing has normal biologic activity.

This phytase:

1) molecular weight is 45kDa;

2) active pH value scope is 2.0～7.5;

3) Wen Dingxing pH value scope is 2.0～9.0;

4) active temperature range is 4～75 ℃;

5) Wen Dingxing temperature range is 4～75 ℃.

Further also be this phytase:

1) active optimum pH is 4.5;

2) active optimum temperature range is 35～60 ℃.

The present invention can also realize as follows.

The DNA of the phytase of the purifying of the aminoacid sequence of coding shown in APPB ID NO:1.

Can be specially

The DNA of the phytase of the purifying of the aminoacid sequence of coding shown in APPB ID NO:1, it has the nucleotide sequence shown in the APPB ID NO:2.

The present invention derives from colibacillary phytase gene sequence (Rodriguez, Biochem Biophys Res Commun, 257:117-123,1999) to what reported, required PCR primer P1 and the P2 of design synthetic clone phytase APPB gene:

P1：5’TC GAATTCATGAAAGCGATCTTAATCCCA 3’

P2：5’CT GAATTCTTACAAACTGCACGCCGG 3’

Genomic dna with intestinal bacteria CGMCC1.1541 is that template is carried out pcr amplification reaction, show by DNA complete sequence analysis result then, 1299 Nucleotide of phytase APPB structure gene total length, 432 amino acid of encoding, 22 amino acid of N end are signal peptide.The theoretical molecular of inferring from amino acid is about 45kDa.This gene is compared with the phytase gene that derives from fungi, and homology is very low, and derives from colibacillary appA (Dassa, Mol Gen Gent, 200:68-73,1985; Greiner, Arch Biochem Biophys, 303:107-113,1993) and appA2 (Rodriguez, Biochem Biophys Res Commun, 257:117-123,1999) gene has higher homology, amino acid sequence homology reaches 97.9% and 96.7% respectively, 9 and 15 amino acid whose differences are arranged respectively, but the phytase of APPB coding has antipepsin and tryptic ability simultaneously, and the phytase that derives from colibacillary appA and appA2 coding equally of report can not antitrypsin, difference on comprehensive gene order and the zymologic property proves that phytase APPB is the new gene of the more good phytase of a character.

A kind of duplicating and expression vector, it contains the DNA of phytase of the purifying of the aminoacid sequence of coding shown in APPB ID NO:1.

This duplicating with expression vector can be specially again

It contains the DNA of phytase of the purifying of the aminoacid sequence of coding shown in APPB ID NO:1, and this DNA has the nucleotide sequence shown in the APPB ID NO:2.

Carrier is reproducible DNA construct.It is used to increase, express the gene of coding phytase APPB, also can be used to enlarge the gene of production, clone's phytase APPB.And the carrier that contains phytase APPB all has the fundamental characteristics of phytase APPB.

A kind of host cell, it is duplicated and expression vector transforms or transfection by a kind of, and this carrier contains the DNA of phytase of the purifying of the aminoacid sequence of coding shown in APPB ID NO:1.

This host cell can further be specially

It is duplicated and expression vector transforms or transfection by a kind of, and this carrier contains the DNA of phytase of the purifying of the aminoacid sequence of coding shown in APPB IDNO:1, and this DNA has the nucleotide sequence shown in the APPB IDNO:2.

A kind of animal-derived food product, it forms main points is that it contains the phytase just like aminoacid sequence shown in the APPB ID NO:1.

Contained phytate phosphorus can not effectively be utilized by the simple stomach animal in the animal body, thereby has caused many problems in the process of feeding, and (1) causes the waste of phosphorus source.Phosphorus source in the feed can not be utilized effectively on the one hand, in order to satisfy the demand of animal to phosphorus, must additionally add inorganic phosphorus in feed again on the other hand, has improved feed cost.(2) form high phosphorus ight soil and contaminate environment.About 85% phytate phosphorus can directly be excreted by animal in the feed, and a large amount of phosphorus makes water and soil earth be subjected to severe contamination in the ight soil.(3) phytate phosphorus still is a kind of antinutritional factor, and it is in the meeting and multiple configuration metal ions Zn in the process of digesting and assimilating of animal intestine gastropore ²⁺, Ca ²⁺, Cu ²⁺, Fe ²⁺Deng and the protein chelating become corresponding insoluble mixture, thereby reduced the effective utilization of animal to these nutritive elements.

The animal-derived food product that contains just like aminoacid sequence phytase shown in the APPB ID NO:1 then can address the above problem, the cost of making phytase has been reduced a lot, and this phytase has also improved greatly than the suitability and the validity of phytase of the prior art in Digestive tract, obviously thus, the present invention has outstanding characteristics and obvious improvement.

In sum, the present invention has following advantage compared to existing technology: the invention provides phytase APPB specific activity height, energy while antipepsin and trypsinase, articulate, production cost than existing phytase reduces, and the animal-feed goods that contain this phytase then can be used for the intravital phytate phosphorus of enzymolysis animal.

Description of drawings

Fig. 1 is used for the residual enzyme activity after Expressing Recombinant Phytase APPB uses trypsinase and pepsin different time.

Fig. 2 is the SDS-PAGE of the phytase that different induction time accumulated in the 5L fermentor tank.

1 is the standard protein molecule; 2-10 is respectively and induced the back 0,12,24,36,48,60,72,96,108 hour

Fig. 3 is the physical map of recombinant yeast expression vector pFY02.

Embodiment

Below in conjunction with embodiment the present invention is described in more detail.

Most preferred embodiment:

Present embodiment comprises following step: 1, the screening of the bacterial strain of phytase; 2, the purifying of phytase APPB; 3, the zymologic property research of phytase APPB; 4, from intestinal bacteria, obtain phytase APPB; 5, the transformation of phytase gene APPB; 6, the construction procedures of phytase APPB on Yeast expression carrier; 7, the program of yeast conversion and screening recombination yeast strain system; 8, recombination yeast is in the program of 5 liters of fermentor tank middle-high density fermentative production phytases.

The preparation of experiment material among the embodiment:

1) bacterial strain and carrier coli strain E.coli DH _5a, plasmid pUC18 etc. is available from Promega company, yeast strain Pichia pastorisGS115 (His-Mut ⁺), plasmid pPIC9 is so kind as to give by Canadian Alberta doctor D.Luo of university.

2) enzyme and test kit restriction enzyme, ligase enzyme, Taq enzyme, Mung bean enzyme are Boehringer company product.T ₇DNA sequence kit purchases the company in Pharmacia.Invitro mutagenesis systems Kit, random primer labelling Kit and PCR Kit all purchase the company in Promega.

3) biochemical reagents DNA synthetic agent is a Milipore company product.Primer is synthetic with the ABI Cyclone of company dna synthesizer.IPTG, X-Gal, SDS and sodium phytate are Sigma company product.TEMED, ammonium persulphate, acrylamide and methylene diacrylamide are Promega company product.

4) substratum intestinal bacteria substratum be LB (1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0).The yeast perfect medium is YPD (1% yeast extract, 2% peptone, 2% glucose); The yeast conversion substratum is RDB[18.6% sorbyl alcohol, 2% glucose, 1.34%YeastNitrogen Base W/O amino acids (YNB), 0.00004%Biotin, 0.005% L-glutamic acid, 0.005% methionine(Met), 0.005% Methionin, 0.005% leucine, 0.005% Isoleucine, 2% agarose)]; It is MM (1.34%YNB, 0.00004%Biotin, 0.5% methyl alcohol, 1.5% agarose) and MD (1.34%YNB, 0.00004%Biotin, 2% glucose, 1.5% agarose) that yeast is selected substratum; Yeast inducing culture BMGY[1% yeast extract, 2% peptone, 1.34%YNB, 0.00004%Biotin, 1% glycerine (V/V)] and BMMY (replace glycerine divided by 0.5% methyl alcohol, all the other compositions are identical with BMGY).The recombination yeast fermention medium is 10 * Basal Salts (2.67% phosphoric acid, 0.093% calcium sulfate, 1.82% vitriolate of tartar, 1.49% sal epsom, 0.413% potassium hydroxide, 4% glycerine or a glucose); Used trace salt solution PTM1 (0.6% copper sulfate, 0.008% sodium iodide, 0.3% manganous sulfate, 0.02% Sodium orthomolybdate, 0.002% boric acid, 0.05% cobalt chloride, 2% zinc chloride, 6.5% ferrous sulfate, 0.025% vitamin H, 0.5% sulfuric acid) in the fermentation.

1, the screening of the bacterial strain of phytase

Obtain 34 strain intestinal bacteria with ordinary method, be inoculated in the LB nutrient solution, 37 ℃ of overnight incubation, be transferred in the 50mL LB nutrient solution by 1% inoculum size, 37 ℃ are cultured to OD value 1.0, centrifugal collection thalline, thalline is resuspended in the 5mL 0.25mol/L acetate buffer solution (pH5.0), the ultrasonic disruption thalline, 15000rpm removed cell debris in centrifugal 15 minutes, and supernatant liquor is used to carry out phytase activity mensuration.Collecting bacterial cell disruption extracting survey enzyme activity determination method is: the enzyme diluent of 0.2mL adds the sodium phytate of 0.8mL 1.25mmol/L, 37 ℃ of insulation 30min, add 1mL 10%TCA and stop enzyme reaction alive, add 2mL ferrous sulfate-ammonium molybdate colour developing liquid then, 700nm measures content of inorganic phosphorus.Contrast makes enzyme-deactivating for add 1mL 10%TCA earlier in the enzyme diluent of 0.2mL, adds the substrate insulation with volume again.A unit of enzyme activity (U) is defined as: under certain condition, it is a unit of enzyme activity that per minute discharges the required enzyme amount of 1nmol inorganic phosphorus.The bacterial strain of the generation phytase that screens is intestinal bacteria CGMCC1.1541.

2, the purifying of phytase APPB

The cytoclasis liquid that contains phytase concentrates with 85% ammonium sulphate precipitation, purifying  KTA FPLC fast liquid chromatography instrument (Pharmacia company) purifying.The concentrated solution that contains enzyme is at first used the desalination of HiPrep_26/10_Desalting post, damping fluid is 20mmol/L HAc-NaAc (pH5.0), flow velocity is 5mL/min, collect elution peak, then separate with ion exchange column Hitrip_SP_Sepharose_XL (5mL), the A pump is 20mmol/L HAc-NaAc (pH5.0), the B pump is 1mol/L NaCl, 20mmol/L HAc-NaAc (pH5.0) high-salt buffer, flow velocity is 2mL/min, high-salt buffer is from 10 post beds of 0～100% gradient elution, the fraction collection elution peak, further use gel column Superdex_75_HR_10/30 purifying by the elution peak after the enzyme assay, damping fluid is similarly 20mmol/L HAc-NaAc (pH5.0), and flow velocity is 0.5mL/min, collects elution peak and obtains pure protein.

3, the zymologic property research of phytase APPB

Be used for carrying out detailed zymologic property research by the phytase albumen behind the FPLC fast liquid chromatography instrument purifying.

Optimal pH be determined as the substrate sodium phytate, with the damping fluid of a series of different pH values (pH2.0,2.5,3.0,3.5 HCl-Gly damping fluid; PH4.0,4.4,5.0,5.5,5.8 HAc-NaAc damping fluid; PH6.0, imidazoles-HCl of 6.5; PH7.0,7.5,8.0,9.0 Tris-HCl damping fluid) preparation, in these different buffer systems, carry out enzymatic reaction under 37 ℃, measure enzymic activity.The result shows that it is the suitableeest to be pH4.5.

The ph stability of phytase is determined as the 37 ℃ of insulations after 30 minutes in the damping fluid of a series of different pH values of phytase albumen, carries out enzymatic reaction again in 37 ℃, the standard buffer system of pH4.5 after the dilution.The result shows that in the scope of pH2～9, phytase has good ph stability.

Get the phytase albumen behind the quantitative purifying, carry out enzyme assay, the specific activity that calculates enzyme is 3.2 * 10 ⁶U/mg.

APPB behind the purifying is used for carrying out the mensuration of antipepsin and trypsinase ability.Contain 10 μ g phytases, adding the stomach en-(pH2.0, concentration 80u/ml) of 0.5mL 0.1mg/mL and trypsin pH7.0, the trypsinase concentration of 0.5mL 0.1mg/mL respectively is 150U/mL), mix the back in 37 ℃ of processing different times, survey enzymic activity with ordinary method again after the dilution.Result's (as shown in Figure 1) finds that stomach en-and trypsin acting are after 2 hours, and the enzymic activity of phytase all still maintains more than 90%, has good protease inhibitor activity.

Above result shows that phytase APPB has high specific acitivity, has good antipepsin and tryptic activity simultaneously.

4, from intestinal bacteria, obtain phytase APPB

Bacterial strain 37 ℃ of shaking tables in the LB substratum are cultivated 24h, get 5mL medium centrifugal precipitation thalline, and precipitation is resuspended among the NaCl of 25mL 1.0mol/L, 4 ℃ of following thermal agitation 1h, centrifuged deposit TES damping fluid (0.01mol/L Tris, the pH8.0 of 25mL precooling; 0.025mol/LEDTA; 0.15mol/L NaCl) wash once, the precipitation resuspending is in 5mL TE damping fluid (TES that does not contain NaCl), the N,O-Diacetylmuramidase that adds 0.5mL 2mg/mL, 37 ℃ of insulation 15min, sarcosyl-the protein enzyme solution (proteolytic enzyme of 10% sarcosyl and 5mg/mL is dissolved among the TE) that adds 0.6mL again, 37 ℃ of insulation 1h, cell pyrolysis liquid are with phenol, phenol-chloroform, chloroform extracting successively, are dissolved among the TE of pH8.0 standby behind the alcohol precipitation DNA.

Derive from colibacillary phytase gene sequence (Rodriguez, Biochem Biophys Res Commun, 257:117-123,1999) to what reported, required PCR primer P1 and the P2 of design synthetic clone phytase gene:

P1：5’TC GAATTCATGAAAGCGATCTTAATCCCA 3’

P2：5’CT GAATTCTTACAAACTGCACGCCGG 3’

These two sections primer sequences all design at phytase structural gene sequence two ends, and the restriction enzyme site that designs on the primer is EcoRI.Genomic dna with intestinal bacteria CGMCC1.1541 is that template is carried out pcr amplification, the dna segment of the about 1.3kb that amplifies, cut the back with the EcoRI enzyme and reclaim purifying, be connected in 15 ℃ with the carrier pUC18 that cuts through the EcoRI enzyme and spend the night transformed into escherichia coli E.coli DH by agarose gel electrophoresis _5a, select positive recombinant behind the coated plate on the LB substratum, the extraction plasmid carries out enzyme and cuts evaluation, obtains recombinant plasmid pRTF-1.

By the DNA complete sequence analysis, measured the global DNA sequence of phytase gene.1299 Nucleotide of appB structure gene total length, 432 amino acid of encoding, 22 amino acid of N end are signal peptide.The theoretical molecular of inferring from amino acid is about 45kDa.This gene is compared with the phytase gene that derives from fungi, and homology is very low, and derives from colibacillary appA (Dassa, Mol Gen Gent, 200:68-73,1985; Greiner, Arch Biochem Biophys, 303:107-113,1993) and appA2 (Rodriguez, Biochem Biophys Res Commun, 257:117-123,1999) gene has higher homology, and amino acid sequence homology reaches 97.9% and 96.7% respectively, and 9 and 15 amino acid whose differences are arranged respectively, there were significant differences protease inhibitor ability and report these two kinds for comprehensive its codase albumen, illustrates that the appB gene that we are cloned into is a new gene.

5, the transformation of phytase gene APPB

For make appB can be in yeast heterogenous expression smoothly, signal coding sequence among the appB has been removed in this research, concrete grammar is the synthetic oligonucleotide segment P3 (5 ' GC of the nucleotide sequence after the contrast signal peptide-coding sequence GAATTCCAGAGTGAGCCGGAGCTGAAG 3 ') as the PCR primer, another primer is the P2 in the experiment four.Is exactly the complete phytase structural gene coding sequence of removing signal coding sequence with this to the appB gene that the method for primer by PCR increases.The dna segment that amplifies is inserted on the EcoRI site of carrier pUC18 after cutting with the EcoRI enzyme that designs on the primer, screens positive recombinant behind the transformed into escherichia coli.So just the appB gene clone of no signal peptide encoding sequence has been arrived on the pUC18, obtained recombinant plasmid pRPF-2, confirmed the exactness of its sequence by sequencing.

6, the construction procedures of phytase APPB on Yeast expression carrier

The plasmid that is used to make up Yeast expression carrier is pFY01 (having α-factor secretion signal).At first phytase gene is inserted into the downstream of the signal peptide sequence of above-mentioned expression vector, form correct reading frame with signal peptide, make the goal gene stable integration to yeast chromosomal by the homologous recombination incident between carrier and the yeast P.pastoris chromogene group then.Concrete process is: after the phytase gene appB that will remove signal coding sequence goes up enzyme and downcuts from plasmid pRPF-2 with EcoRI, electrophoresis reclaims the dna fragmentation of about 1.3Kb, again they are inserted into the EcoRI site on the carrier pFY01, have obtained being used for the recombinant expression vector-pFY02 (Fig. 3) of yeast conversion.The phytase gene that so just will have α-factor secretion signal has been cloned into AOX1 promotor downstream.

7, the program of yeast conversion and screening recombination yeast strain system

The DNA of plasmid pFY02 shocks by electricity after the DraI enzyme is cut behind the transformed yeast cell, and by recombinating in the body, goal gene will be incorporated in the acceptor yeast genes group.Under the condition that exogenous induction material methyl alcohol exists, the AOX1 promotor can start the expression of its downstream gene, and signal peptide can instruct expression product to enter the zymic Secretory Pathway, and through the effect of signal peptidase, sophisticated foreign protein product is finally secreted to born of the same parents.Foreign protein can carry out posttranslational modification through such pathways metabolism, for example glycosylation etc., thus obtain the protein product of biologically active.

At first use the DNA of 2～3 times of excessive restriction endonuclease DraI digested plasmid pFY02, make it linearizing, whether the electrophoresis detection enzyme is cut complete.Use the phenol extracting, ethanol sedimentation, 70% ethanol washes twice, lyophilize, sterilized water dissolving is got 1～5 μ g DNA and is transformed the pichia spp cell, coated plate on the RDB solid medium, every plate is coated with 0.1mL, culture dish is inverted under 30 ℃ to be cultured to transformant and to occur.

Screening is at the clone's (his normal but that some growth is arranged on the MM flat board or do not grow fully that grows on the MD flat board ⁺Mut ^-) be positive colony.

In order to screen the restructuring yeast strains that obtains high expression level, directly detect the expression of phytase in the inducing culture.With his ⁺Mut ^-Transformant is at first cultivated in the BMGY substratum, treats that it grows to state of saturation, and the centrifugal BMGY that abandons changes to inducing culture BMMY, gets supernatant liquor and carry out the phytase activity analysis behind inducing culture 36h.By the enzyme assay of Expressing Recombinant Phytase, preliminary screening is to the recon of 42 strain Expressing Recombinant Phytase from 200 strain recombination yeasts, and wherein 4 the highest strain recons of expression amount are named the pFY02-3 into P.pastoris respectively, 33,96,164.

8, the recombination yeast fermentation process of recombination yeast after the program optimization of 5 liters of fermentor tank middle-high density fermentative production phytases is as follows:

5% inoculation Basal Salts substratum

C source: 4% glucose The thalli growth stage

N source: ammoniacal liquor

Inorganic salt

↓24h

Stream adds 25% glucose

Flow: 36mL/h/L Carbon source is fed the stage

↓4h

Methanol induction

(keeping final concentration is about 0.3%) The abduction delivering stage

Fermenting process is divided into three phases.Specific as follows: 1) the strain culturing stage.Adding 28% ammoniacal liquor before fermention medium 10 * Basal Salts inoculation earlier makes the pH of substratum reach 5.0, add 4.37mL PTM1 by every liter of substratum again, 5-10% inoculates seed liquor, 18～24h is cultivated in aeration-agitation, in culturing process along with the growth of bacterial strain, dissolved oxygen amount in the substratum reduces gradually by 100%, and dissolved oxygen amount will be increased to more than 80% once again after carbon source runs out of, and this moment, the thalline weight in wet base reached 90～110g/L.2) carbon source is fed the stage.Stream adds 25% glucose (containing 12mL PTM1 in every liter), and the stream dosage is 28mL/h/L, cultivates 4h.Adjusting air flow makes dissolved oxygen amount all the time greater than 20%.The thalline weight in wet base reaches 180～220g/L during this EOS.3) the abduction delivering stage.Add inductor methyl alcohol (containing 12mL PTM1 in every liter), make the methyl alcohol final concentration maintain 0.3%, dissolved oxygen amount is all the time greater than 20%.The SDS-PAGE that every 12h takes a sample and once measures the accumulation volume of the phytase of expressing and carry out expressing protein in inducing process.

Fig. 5 is seen in the SDS-PAGE analysis that increases the phytase of expressing accumulation in the fermented liquid with induction time.The result shows that the phytase of expression accumulates with the increase of induction time, peaks when inducing 106 hours, and expression amount at this moment reaches the 4mg/mL fermented liquid, and enzymic activity reaches 4 * 10 ⁶The U/mL fermented liquid.The zymoprotein molecular weight size of expressing is about 50kD, and about the big 5kDa of theoretical molecular than phytase, this may be because carried out modification-glycosylation behind the protein translation.Above result proves that phytase gene has not only obtained expression, effectively secretion, and the phytase of expressing has normal biologic activity.

After a fermentation period of reorganization P.pastoris growth, abduction delivering finishes, directly get this bacterium liquid behind abduction delivering carries out next round as seed liquor (inoculum size is 1%) fermenting process, add up to carry out 5 altogether and take turns, all biomass and the phytase expression amount to strain growth measured in every the wheel.In addition, get every thalline shop perfect medium flat board that has fermented of taking turns, 10 single bacterium colonies of picking extract the PCR detection that genomic dna carries out appB.The result shows (table 1), and the expression amount of the biomass of strain growth, speed and phytase is kept stable in each is taken turns.The result of PCR proves that also through 5 cultured continuously of taking turns, still stable integration is in the P.pastoris genome for appB, and these results prove that reorganization P.pastoris not only has good genetic stability but also has the stability that good phytase is expressed.

The genetic stability of table 1. recombinant yeast pichia pastoris (P.pastoris pPFY02-33) and the stability of phytase gene expression

The algebraically of propagating	The PCR positive	The biomass (thalline weight in wet base g/L) of growth 24h	Induce 120h phytase expression amount (mg/mL)
				1 2 3 4 5	100％ 100％ 100％ 100％ 100％	98.2 110.1 107.5 104.0 115.3	4.1 4.0 3.8 4.2 4.1

Sequence table

(1) general information

1, applicant: Fujian Fudabaite Sci-Tech Devpt Co., Ltd..

2, denomination of invention: the DNA of phytase APPB and this phytase of encoding

3, sequence quantity: 2

4, contact address: country origin: China

Province: Fujian

City: Fuzhou City

Address: No. 6, energy lane, Gutian road

Postcode: 350005

5, proxy's information: name: Lin Tiankai

Act on behalf of the testimony of a witness number: 35201003

6, telecom information: phone: 0591-3364424

Fax: 0591-3358803

(2) information of APPB ID NO:1

1, sequence signature:

(1) length: 432 amino acid

(2) type: amino acid

(3) topology: linearity

2, molecule type: protein

3, the false plan:

4, primary source:

(1) organism: intestinal bacteria

(2) bacterial strain: E.coli DH5a

5, sequence description: APPB ID NO:1

1 M K A I L I P F L S L L I P L T P Q S A F A Q S E P E L K L

31 E S V V I V S R H G V R A P T K A T Q L L Q N V T P D A W P

61 T W P V K L G W L T P R G G E L I A Y L G H Y Q R Q R L V A

91 D G L L A K K G C P K S G Q V A I I A D V D E R T R K T G E

121 A F A A G L A P D C A I T V H T Q A D T S S P D P L F N P L

151 E T G V C Q L D N A N V T D A I L S R A G G S I A D F T G H

181 R Q T A F R E L E R V L N F P Q S N L C D K R E K Q D E S C

211 S L T Q A L P S E L K V S A D N V S L T G A V S L A S M L T

241 E I F L L Q Q A Q G L M E P G W G R I T D S H Q W N T L L S

271 L H N A Q F Y L L Q R T P E V A R S R A T P L L D L I K T A

301 P P P H P P Q K Q A Y G V T L P T S V L F I A G H D T N L A

331 N L G G A L E L N W T L P G Q P D N T P P G G E L V F E R W

361 R R L S D N S Q W I Q V S L V F Q T L Q Q M R D K T P L S L

391 N T P P G E V K L T L A G C E E R N A Q G M C S L A G F T Q

421 V N E A R I P A C S L

(3) information of APPB ID NO:2

1, sequence signature:

(1) length: 1299 base pairs

(2) type: nucleic acid

(3) topology: strand

2, molecule type: DNA (genomic)

3, the false plan: do not have

4, primary source:

(1) organism: intestinal bacteria

(2) bacterial strain: E.coli DH5a

Sequence description: APPB ID NO:2

1 ATGAAAGCGA TCTTAATCCC ATTTTTATCT CTTCTGATTC CGTTAACCCC GCAATCTGCA

61 TTCGCTCAGA GTGAGCCGGA GCTGAAGCTG GAAAGTGTGG TGATTGTCAG TCGTCATGGT

121 GTGCGTGCTC CAACCAAGGC CACGCAACTG TTGCAGAATG TCACCCCAGA CGCATGGCCA

181 ACCTGGCCGG TAAAACTGGG TTGGCTGACA CCGCGAGGTG GTGAGCTAAT CGCCTATCTC

241 GGACATTACC AACGCCAGCG TCTGGTAGCC GACGGATTGC TGGCGAAAAA GGGCTGCCCG

301 AAGTCTGGTC AGGTCGCGAT TATTGCTGAT GTCGACGAGC GTACCCGTAA AACAGGCGAA

361 GCCTTCGCCG CCGGGCTGGC ACCTGACTGT GCAATAACCG TACATACCCA GGCAGATACG

421 TCCAGTCCCG ATCCGTTATT TAATCCTCTA GAAACTGGCG TTTGCCAACT GGATAACGCG

481 AACGTGACTG ACGCGATCCT CAGCAGGGCA GGAGGGTCAA TTGCTGACTT TACCGGGCAT

541 CGGCAAACGG CGTTTCGCGA ACTGGAACGG GTGCTTAATT TTCCGCAATC AAACTTGTGC

601 GATAAACGTG AGAAACAGGA CGAAAGCTGT TCATTAACGC AGGCATTACC ATCGGAACTC

661 AAGGTGAGCG CCGACAATGT CTCATTAACC GGTGCGGTAA GCCTCGCATC AATGCTGACG

721 GAGATATTTC TCCTGCAACA AGCACAGGGA CTGATGGAGC CGGGGTGGGG AAGGATCACC

781 GATTCACACC AGTGGAACAC CTTGCTAAGT TTGCATAACG CGCAATTTTA TTTGCTACAA

841 CGCACGCCAG AGGTTGCCCG CAGCCGCGCC ACCCCGTTAT TAGATTTGAT CAAGACAGCG

901 CCGCCGCCCC ATCCACCGCA AAAACAGGCG TATGGTGTGA CATTACCCAC TTCAGTGCTG

961 TTTATCGCCG GACACGATAC TAATCTGGCA AATCTCGGCG GCGCACTGGA GCTCAACTGG

1021 ACGCTTCCCG GTCAGCCGGA TAACACGCCG CCAGGTGGTG AACTGGTGTT TGAACGCTGG

1081 CGTCGGCTAA GCGATAACAG CCAGTGGATT CAGGTTTCGC TGGTCTTCCA GACTTTACAG

1141 CAGATGCGTG ATAAAACGCC GCTGTCATTA AATACGCCGC CCGGAGAGGT GAAACTGACC

1201 CTGGCAGGAT GTGAAGAGCG AAATGCGCAG GGCATGTGTT CGTTGGCAGG TTTTACGCAA

1261 ATCGTGAATG AAGCACGCAT ACCGGCGTGC AGTTTGTAA

Claims (8)

1, phytase APPB is characterized in that, it is the phytase of the purifying of the aminoacid sequence shown in a kind of APPB of having ID NO:1.

2, the DNA of coding phytase APPB is characterized in that, the phytase of the purifying of the aminoacid sequence of its coding shown in APPB ID NO:1.

3, the DNA of coding phytase APPB according to claim 2 is characterized in that, it has the nucleotide sequence shown in the APPB ID NO:2.

4, a kind of duplicating and expression vector is characterized in that, it contains the DNA of phytase of the purifying of the aminoacid sequence of coding shown in APPB ID NO:1.

5, a kind of duplicating and expression vector according to claim 4 is characterized in that, it has the nucleotide sequence shown in the APPB ID NO:2.

6, a kind of host cell is characterized in that, it is duplicated and expression vector transforms or transfection by a kind of, and this carrier contains the DNA of phytase of the purifying of the aminoacid sequence of coding shown in APPB ID NO:1.

7, a kind of host cell according to claim 6 is characterized in that, this DNA has the nucleotide sequence shown in the APPB ID NO:2.

8, a kind of animal-derived food product is characterized in that, it contains the phytase just like aminoacid sequence shown in the APPB ID NO:1.