CN120098076A - Polypeptide compound, polypeptide ligase mediated polypeptide cyclization method and application thereof - Google Patents

Abstract

The present invention provides a polypeptide compound and a polypeptide cyclization method and application thereof mediated by a polypeptide ligase, and relates to the field of chemoenzymatic cyclization modification of a gene-encoded peptide library. The present invention constructs a technical platform for preparing a macrocyclic peptide library using a polypeptide ligase catalytic system, generates a gene-encoded cyclic peptide library by chemo-enzymatic cyclization modification of a phage-displayed peptide library, and screens the macrocyclic peptide ligand using a target protein as bait. The polypeptide ligase-mediated polypeptide cyclization technology involved in the present invention has the advantages of a wide range of peptide substrate selection, mild reaction conditions, and a fast cyclization rate. The gene-encoded cyclic peptide library generated by it is conducive to discovering cyclic peptide ligands with unique structural characteristics, and is a powerful technology for in vitro screening of cyclic peptide molecules.

Description

Polypeptide compound, polypeptide ligase mediated polypeptide cyclization method and application thereof

Technical Field

The invention relates to the field of chemical enzymatic cyclization modification of gene coding peptide libraries, in particular to polypeptide compounds, and a polypeptide cyclization method and application thereof mediated by polypeptide ligase.

Background

Cyclic peptides are a very important framework in the development of polypeptide drugs, and approved peptide drugs, including desmopressin and cyclosporine, are cyclic peptides. Due to the rigidity of the structure, the cyclopeptide molecule can resist the degradation of proteolytic enzymes, has high specific target protein affinity, and targets the target protein in cells due in part to the permeability of cell membranes. The rapid discovery of highly active cyclopeptide active molecules is central to this field. The discovery of active cyclopeptide molecules in animals and plants is the most straightforward method for the discovery of cyclopeptide drug leads. However, the in vivo composition is complex and the identification of endogenous cyclopeptide active molecules is a time consuming and laborious process. In addition, the endogenous cyclic peptide is largely a cyclic peptide framework composed of disulfide bonds, is not tolerant to glutathione reducing conditions, and is susceptible to internal rearrangement of disulfide bonds. Therefore, in vitro construction of structurally stable libraries of cyclopeptides is an important core technology in the field of cyclopeptides drug discovery.

The gene coding cyclopeptide molecular technology is a powerful means for reconstructing cyclopeptide molecular library in vitro. In particular Winter and Heinis are equivalent to the 2009 two-ring peptide technology established by cross-linking three Cys residues of phage epitopes using tribromomethylbenzene (see Nat Chem Biol 2009,5,502-507) pushing the discovery of stable structured cyclic peptide drugs to a new height. The core idea of the technology is to realize the cyclized structural transformation of phage epitope linear peptide by using a chemical crosslinking reagent. Based on similar pathways, several subject groups developed different approaches to construct phage cyclic peptides, e.g., derda, etc., combining chemical crosslinking reagents with Knorr pyrazole synthesis reactions, exhibiting unnatural pharmacophores in phage cyclic peptides (see JAmChem Soc 2021,143,5497-5507); wu and Bernardes constructed specific monocyclic peptide phage libraries using bioorthogonal reactions of N-terminal Cys (JAm Chem Soc 2020,142,5097-5103;Nat Commun 2024,15,7308). Nevertheless, these methods based on chemical crosslinking reagents require the use of highly active electrophiles, suffer from the disadvantage of reacting with Cys inside the pIII of the phage, and affect the infectivity of the phage.

To solve the drawbacks of the chemical cross-linked phage strategy, we proposed a technique based on chemoenzymatic construction of phage display cyclic peptides in 2024 (Chem Sci 2024,15,9649-9656;Org Lett 2024,26,2601-2605). Unlike chemical cross-linking methods, the chemical enzymatic method uses low-activity electrophiles, which do not affect phage infectivity. The reaction condition of the chemical enzyme method modified phage is mild, high-efficiency cyclization modification of phage can be realized under low-concentration substrate, and a large-scale cyclopeptide molecular library is generated to screen cyclopeptide ligands targeting specific target proteins. In 2024 we have successfully established a phage cyclic peptide display platform for chemoenzymatic processes using SortaseA enzyme and asparagine endopeptidase (ASPARAGINYL ENDOPEPTIDASE, oaAEP 1). However, these two ligases have a significant disadvantage in practice in that the N-terminal amino acid of the SortaseA phage display peptide is glycine (patent application number: 202410093169. X) and the N-terminal amino acid of the asparagine endopeptidase requires glycine-leucine (patent application number: 202410092951. X). These constraints allow for several sites within the loop of the cyclic peptide library to be specific amino acids, which is detrimental to the diversity of the library.

Subtilisin is a serine protease secreted by bacillus subtilis and belongs to the proteolytic enzyme of the C13 peptidase family. Subtilisins have been successfully engineered into polypeptide ligase tools by directed evolution and mutation of amino acids, representative ligases include those wherein Subtiligase, peptiligase and Omniligase-1(PNAS2009,96,9497-9502;Adv Synth Catal 2016,358,4041-4048;Nat Methods2016,13,925-927;Nat Chem Biol 2018,14,50-57).Omniligase-1 are ligases with broad substrate selectivity, the types of ligation sites are numerous, and the N-terminal amino acid residues of substrate nucleopeptides are no longer limited to Gly or Gly-Leu. Omniligase-1, the catalytic peptide ligation reaction is efficient, the reaction condition is mild, and the influence on the infectivity of phage is small. Omniligase-1 is widely used in polypeptide ligation, but has not been used for construction of gene-encoded cyclopeptide libraries. Through deep excavation Omniligase-1 peptide connection reaction, a novel polypeptide peptide cyclization system based on subtilisin mediation is developed and used for cyclizing and modifying a phage surface display peptide library, and a more powerful chemical enzyme method gene coding macrocyclic peptide screening platform is established.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a polypeptide ligase mediated polypeptide cyclization method with mild reaction conditions, high-efficiency enzyme-linked cyclization and wide substrate compatibility, constructs a thioether-bonded cyclic peptide skeleton from side chain to side chain, realizes high-efficiency chemical enzymatic cyclization modification of phage display polypeptides, and successfully performs cyclic peptide ligand screening of targeted disease-related proteins.

In order to achieve the above purpose, the invention is realized by the following technical scheme:

A polypeptide compound which is recognized by a polypeptide ligase containing electrophilic reactive groups, and has the following structural general formula:

Wherein X _a is any one of hydrogen, acetyl and oligopeptide group composed of natural or unnatural amino acid except cysteine, X _b is any one of electrophilic group and oligopeptide group composed of natural or unnatural amino acid containing electrophilic group, X _c is any one of oxygen (oxygen ester bond) and sulfur (thioester bond), X _d is any one of amino and oligopeptide sequence composed of natural or unnatural amino acid except cysteine, and n is any number between 1 and 8.

Preferably, the electrophilic group is any one of chloroacetamido, 4-chloroacetamido-benzamide, 3, 5-bis [ (2-chloroacetyl) amino ] benzamide, 3, 5-bis (chloromethyl) phenylthio, 2- (chloromethyl) phenylthio, 3- (chloromethyl) phenylthio, 4- (chloromethyl) biphenylmethylthio, 2,3,4,5, 6-pentafluorophenylthio, 4- (2 ',3',4',5',6' -pentafluorophenyl) -2,3,5, 6-tetrafluorophenylthio.

The method for polypeptide cyclisation mediated by a polypeptide ligase comprises the steps of:

S1, carrying out polypeptide enzyme ligation reaction and intramolecular polypeptide cyclization reaction on the polypeptide compound in any one of claims 1-2 and a cysteine-containing polypeptide template in a buffer salt solution in the presence of polypeptide ligase generated by modifying subtilisin to generate a cyclopeptide molecule;

the cysteine-containing polypeptide template is as follows:

Template a is X-B- (X) m-C, template B is X-B- (X) m-C- (X) n-C;

The template a is used for constructing single-ring peptide, the template B is used for constructing double-ring peptide, B represents any one of L-leucine, L-isoleucine, L-valine, L-methionine, L-tyrosine, L-tryptophan, L-phenylalanine and L-histidine, X represents any one natural L-amino acid, C represents L-cysteine, the positions of the C and the C can be changed according to requirements, and m and n represent the number of amino acids between 3 and 20;

S2, selecting a polypeptide template containing cysteine in S1, fusion-expressing the polypeptide template at the N end of phage pIII protein through gene coding, constructing a phage display cyclopeptide library through S1 step operation, and screening a macrocyclic peptide ligand aiming at target protein.

Preferably, the polypeptide ligase generated by the subtilisin modification is any one of Subtiligase, peptiligase, omniligase-1.

Preferably, the concentration range of the polypeptide compound in the step S1 is 0.01 mu M-1.0 mM, the concentration range of the polypeptide ligase is 0.01 mu M-10.0 mM, the buffer salt solution is any one of PBS, HEPES, naOAc and Tris, the TCEP is 0.0 mu M-10.0 mM, and the pH range is 7.0-10.0.

Preferably, the time of the polypeptide enzyme ligation reaction and the intramolecular polypeptide cyclization reaction in the step S1 is 1min-6h, and the reaction temperature is 0-45 ℃.

Preferably, the phage in S2 is a phage system consisting of pCANTAB 5E phagemid and helper phage M13KO7 or M13KE phage system.

Preferably, the screening of the macrocyclic peptide ligand against the target protein in step S2 comprises the steps of:

S2-1, constructing a phage display single-ring peptide or double-ring peptide library by using a polypeptide ligase-mediated polypeptide cyclization method;

s2-2, target proteins are biotinylated and fixed on magnetic beads, wherein a single-ring peptide or double-ring peptide library displayed by phage in S2-1 and the immobilized target proteins are incubated together, and after 2-6 rounds of biopanning, sequencing phage particles after the biopanning;

s2-3, synthesizing the enriched target cyclopeptide according to a sequencing result, and evaluating the binding force and the biological activity of the target cyclopeptide with the target protein.

The polypeptide cyclization is applied to the construction of gene coding cyclic peptide libraries, and comprises the steps of polypeptide connection and intramolecular polypeptide cyclization of phage display, mRNA display, DNA display, yeast display, ribosome display or bacterial display polypeptide libraries to construct single-ring and double-ring peptide libraries.

And the cyclic peptide ligand obtained by cyclizing the polypeptide is applied to development of medicines, detection kits or other biomedical and biological materials.

The invention provides a polypeptide compound, and a polypeptide cyclizing method and application thereof mediated by polypeptide ligase, which have the advantages compared with the prior art that:

(1) Compared with the existing method for connecting polypeptides mediated by subtilisin, the method for preparing cyclic peptides from side chains by using the polypeptide ligase generated by subtilisin transformation is realized for the first time, and the method generates a connecting intermediate through enzyme ligation reaction and generates cyclic peptides by using intramolecular polypeptide cyclization reaction of the connecting intermediate, wherein the intramolecular polypeptide cyclization reaction is cyclization reaction between electrophilic groups and cysteine residues in the connecting intermediate.

(2) Compared with the existing technology for cyclizing and modifying phage polypeptides by using chemical crosslinking reagents, the invention adopts mild reaction conditions, and does not influence phage infectivity.

(3) Compared with the technology developed before by the inventor based on SortaseA and OaAEP1 for cyclizing and modifying phage by using a chemical enzyme method, the polypeptide ligase generated by modifying the subtilisin adopted by the application has wider substrate types and has less limitation on the types of N-terminal amino acids of a phage peptide library.

(4) Compared with the codon expansion or Flexizyme technology, the invention does not involve codon transformation and ribosome embedding of unnatural amino acid, thus greatly reducing the construction difficulty and cost of the cyclic peptide library.

Drawings

FIG. 1 shows the double cyclization of a polypeptide with 3, 5-bis [ (2-chloroacetyl) amino ] benzoyl-containing polypeptide oxyester 11 catalyzed by Omniligase-1 enzyme to produce a phage bicyclic peptide library;

FIG. 2 is a structural formula of a chloroacetyl-containing polypeptide oxygen ester 10;

FIG. 3 is a structural formula of 3, 5-bis [ (2-chloroacetyl) amino ] benzoyl-containing polypeptide oxygen ester 11;

FIG. 4 is a diagram of Omniligase-1 catalytic 10-polypeptide ligation and cyclization reaction chromatography with polypeptide template 1;

FIG. 5 is a Omniligase-1 chromatogram of catalytic 11 and polypeptide template 2 series polypeptide ligation and cyclization reactions;

FIG. 6 is a diagram of Omniligase-1 catalytic 11-polypeptide ligation and cyclization reaction chromatograms of the polypeptide template 3 series;

FIG. 7 is a Omniligase-1 chromatogram of catalytic 11 and polypeptide template 4 series polypeptide ligation and cyclization reactions;

FIG. 8 is a Omniligase-1 chromatogram of catalytic 11 and polypeptide template 5 series polypeptide ligation and cyclization reactions;

FIG. 9 is a diagram of Omniligase-1 catalytic 11-polypeptide ligation and cyclization reaction chromatograms of the polypeptide template 6 series;

FIG. 10 is a diagram of Omniligase-1 catalytic 11-polypeptide ligation and cyclization reaction chromatograms of the 7 series of polypeptide templates;

FIG. 11 is a Omniligase-1 chromatogram of catalytic 11 and polypeptide template 8 series polypeptide ligation and cyclization reactions;

FIG. 12 is a Omniligase-1 series of polypeptide ligation and cyclization chromatograms of catalysis 11 and polypeptide template 9;

FIG. 13 is a graphical representation of the results of a functional bicyclic peptide 12 binding assay to the target protein TEAD 4.

Detailed Description

In order to more clearly illustrate the invention, it will be further illustrated by the following examples and figures.

(1) Two cysteine-containing polypeptide templates having the following characteristics:

template a, X-B- (X) _m -C

Template B, X-B- (X) _m-C-(X)_n -C;

The template a is used for constructing single-ring peptide, the template B is used for constructing double-ring peptide, B represents any one of L-leucine, L-isoleucine, L-valine, L-methionine, L-tyrosine, L-tryptophan, L-phenylalanine and L-histidine, X represents any one natural L-amino acid, C represents L-cysteine, the positions of the C and the C can be changed according to requirements, and m and n represent the number of amino acids between 3 and 20.

Based on the above template characteristics, 9 polypeptide template series were selected, H-FIEWLCK-NH ₂ (polypeptide template 1, N-amino with L-phenylalanine at the N-terminus), H-XLHGCRPYCK-NH ₂ (polypeptide template 2 series, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, or G), H-XIHGCRPYCK-NH ₂ (polypeptide template 3 series, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, or E), H-XVHGCRPYCK-NH ₂ (polypeptide template 4 series, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, or E);

H-XMHGCRPYCK-NH ₂ (polypeptide template 5 series, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, or G), H-XYHGCRPYCK-NH ₂ (polypeptide template 6 series, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, or E), H-XWHGCRPYCK-NH ₂ (polypeptide template 7 series, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, E, or L), H-XFHGCRPYCK-NH ₂ (polypeptide template 8 series, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, E, or L), H-XHHGCRPYCK-NH ₂ (polypeptide template 9, X=Q, A, S, V, M, W).

The polypeptide templates are composed of L-type amino acids, the N end of the polypeptide templates is alpha-amino of an X residue, and the C end of the polypeptide templates is amide of lysine. The polypeptides provided herein are merely illustrative of technical details and embodiments of the present invention and are not intended to be a complete disclosure of the present patent. When the cyclic peptide library is constructed, the position of the cysteine residue in the template can be changed according to specific requirements, the number of amino acids in the template can be reduced or increased according to the requirements, and the changed polypeptide template still belongs to the scope of the patent protection. Therefore, the type of the polypeptide skeleton is changed and modified on the basis of the patent, and the polypeptide skeleton is still in the protection scope of the patent.

(2) A chemically synthesized polypeptide compound having the following characteristics:

Wherein X _a is any one of hydrogen, acetyl, oligopeptide group composed of natural or non-natural amino acid except cysteine, X _b is any one of electrophilic group and oligopeptide group composed of natural or non-natural amino acid containing electrophilic group, wherein the electrophilic group is any one of chloroacetamido, 4-chloroacetamido benzamido, 3, 5-di [ (2-chloroacetyl) amino ] benzamido, 3, 5-di (chloromethyl) benzamido, 2- (chloromethyl) benzamido, 3- (chloromethyl) benzamido, 4- (chloromethyl) biphenylmethylthio, 2,3,4,5, 6-pentafluorophenylthio and 4- (2 ',3',4',5',6' -pentafluorophenyl) -2,3,5, 6-tetrafluorothiophenyl, xc is any one of oxygen (oxy) and sulfur (thio) and X79 is any one of oxygen (thio) and X is any one of 3-amino acid ester bonds and 37 n is an amino ester bond of the polypeptide of the patent, and any one of the amino acid and the amino ester bonds of the polypeptide of the peptide and the polypeptide are modified on any one of the amino ester bonds are still 37 or 37 amino bonds of the amino acid of the peptide.

(3) In the presence of polypeptide ligase generated by modifying with subtilisin, the chemically synthesized polypeptide compound and the polypeptide template containing cysteine in the sequence generate polypeptide ligation and intramolecular polypeptide cyclization reaction in buffer salt solution to generate the cyclopeptide molecule.

Wherein the concentration range of the polypeptide compound is Subtiligase, peptiligase or Omniligase-1, the concentration range of the polypeptide compound is 0.01 mu M-1.0 mM, the concentration range of the polypeptide compound is 0.01 mu M-10.0 mM, the buffer salt solution is any one of PBS (phosphate), HEPES (4-hydroxyethyl piperazine ethane sulfonic acid), naOAc (sodium acetate) and Tris (Tris-hydroxymethyl amino methane), the buffer salt solution contains TCEP (Tris (2-carboxyethyl) phosphine) with the concentration range of 0.0 mu M-10.0 mM, the pH range of the buffer salt solution is 7.0-10.0, the enzyme-linked reaction time is 1 minute-6 hours, the reaction temperature is 0-45 ℃, and all simple changes to the conditions based on the patent are still within the protection range of the patent.

(4) Construction and application of phage display cyclic peptide library:

characteristics of the sequences of the library of bicyclic polypeptides displayed on the phage surface:

XBXXXXCXXXXXXCGGSG (from N to C terminal, X is any of the natural L-amino acids, B represents any of L-leucine, L-isoleucine, L-valine, L-methionine, L-tyrosine, L-tryptophan, L-phenylalanine, L-histidine), by NNK coding, a random amino acid mutation at position 11 of the sequence, wherein GGSG is a flexible amino acid linker arm and is located between the bicyclic peptide library and the phage surface pIII protein).

Two DNA sequences are designed and synthesized according to the sequence characteristics of the polypeptide:

Primer A5'-TTGGTCTCGGTGCGCCGGTGCCGTATCCGGATCCGCTG-3', primer B:5'-TTTGGTCTCAGCACCGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNNANMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3'

Primer(s) C:5'-TTTGGTCTCAGCACCGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNATAMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3'

Primer(s) D:5'-TTTGGTCTCAGCACCGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNCCAMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3'

(Template strand of library, where N is A/T/C/G, M is C/A, K is G/T, and the underlined base is BsaI cleavage site).

The above primer A was matched with primer B, primer C or primer D, and was subjected to whole plasmid PCR using pCANTAB 5E mutant vector (without BsaI cleavage site) as a template, using high fidelity polymerase such as KeyPo enzyme, followed by treatment with BsaI and DpnI and subsequent ligation and electrotransformation of competent TG1 cells with T4 ligase, the number of library transformations was determined to be 2.0X10 ¹⁰, and then packaged with the super helper phage M13KO7 as phage peptide library.

The phage peptide library is mixed with the polypeptide compound containing 3, 5-di [ (2-chloroacetyl) amino ] benzoyl group, a double-ring peptide phage library is generated under Omniligase-1 mediation, then 5 rounds of screening are carried out on the double-ring peptide phage library and a target protein TEAD4, phage clone sequencing is randomly selected, double-ring peptides corresponding to the enriched polypeptide sequence are chemically synthesized, polarized fluorescence of the target protein is measured, and the technical effect is evaluated.

(5) The polypeptide templates with different characteristics can be cyclized in Omniligase-1 mediated molecules to generate cyclic polypeptides with different characteristics, and the cyclic polypeptides can be used for preparing a gene-coded cyclic peptide library and discovering cyclic peptide ligands aiming at target proteins.

The polypeptide template containing two cysteines displayed on the surface of phage, namely X-B- (X) _m-C-(X)_n -C as described in step (1), is incubated with a polypeptide compound containing 3, 5-di [ (2-chloroacetyl) amino ] benzoyl, polypeptide ligation and intramolecular polypeptide dicycloization reaction occur under the mediation of Omniligase-1, a phage dicyclo peptide library is generated (shown in figure 1), and dicyclo peptide ligand screening is performed for specific target proteins.

A polypeptide template characterized by X-B- (X) _m-C-(X)_n -C is fused and expressed at the N terminal of phage pIII, and then the fusion expression is carried out with a polypeptide compound containing 3, 5-di [ (2-chloroacetyl) amino ] benzoyl group under the mediation of Omniligase-1 to generate a double-ring peptide library with the library capacity of 2.0x10 ¹⁰. By taking TEAD4 fixed on streptavidin magnetic beads as a target point, through 5 rounds of phage screening and phage clone sequencing, 1 highly enriched bicyclic peptide is found, and the affinity of polarized fluorescence measurement to the TEAD4 is in the range of 1.5 mu M, so that the effect of the technology in constructing a gene coding cyclopeptide library and finding functional cyclopeptide ligands is demonstrated.

Example 1:

Synthesis of chloracetyl polypeptide oxyesters 10 according to the above:

300.0. Mu. Mol RINKAMIDE resin (535.0 mg,0.56 mmol/g) was weighed and added to a 5.0mL solid phase synthesizer and 3.0mL DMF was added to swell for 20 minutes at room temperature. 2.0mL of 20% piperidine was added shake for 6 minutes at room temperature. The resin was washed with DMF and 2.0mL of an amino acid condensing reagent was added containing 4.5 equivalents of Fmoc-Ala-OH (557.0 mg), 4.5 equivalents of oxyma (127.0 mg) and 4.5 equivalents of N, N' -diisopropylcarbodiimide (139.0. Mu.L). Shake for 40 min at 55 ℃. Washing the resin with DMF, and condensing Ser, val, arg, ala, leu and glycolic acid. The resin was washed by treatment with 10% hydrazine hydrate for 30 minutes. 5.0 equivalents of Fmoc-Lys (Boc) -OH (596.0 mg), 3.0 equivalents of DMAP (73.2 mg), 3.0 equivalents of N, N' -diisopropylcarbodiimide (141.0. Mu.L) were dissolved in a mixed solution of 8: 8mLDCM/DMF (1:1, volume ratio), the resin was added and transferred together into a 15-mL centrifuge tube, and reacted at 25℃for 12h. The resin was washed with DMF and 2.0mL of 20% Fmoc protecting groups were added to remove the amino groups of Lys. Condensation of Pro, leu, ala amino acids was continued according to the SPPS synthesis procedure. After removal of the N-terminal Fmoc protecting group of the polypeptide by 20% piperidine, treatment with acetic anhydride blocking reagent (DMF: acetic anhydride: 2, 6-lutidine=89:5:6, volume ratio) was carried out for 2 min. The resin was dried at normal temperature and added with freshly prepared trifluoroacetic acid cleavage solution, wherein the volume ratio of TFA, m-cresol, water and triisopropylsilane was 88:5:5:2. The trifluoroacetic acid lysate containing the polypeptide was collected and 9 volumes of pre-ice-cooled diethyl ether were added to give a white powdered crude peptide.

1.0 Equivalent (75.6 mg,94.5 g/mol) of chloroacetic acid and 2.0 equivalents (184 mg,115 g/mol) of HOSu were added to a 5mL EP tube, 3mL of DMF was added for dissolution, and 2.0 equivalents of N, N' -diisopropylcarbodiimide (249. Mu.L) was added thereto, and the mixture was allowed to stand for 1 hour at room temperature under shaking. 3.3mg of crude peptide was reacted with 10.0 equivalents (113.4. Mu.L) of chloroacetic acid activated ester, and 500. Mu.L of DMF was added with 10.0 equivalents of DIEA (5. Mu.L). After 30min the chromatography was water quenched, chromatographed, freeze dried to give 10 (7.0 mg, sequence AcNH-Ala-Leu-Pro- ^ClAcLys-Ogly-Leu-Ala-Arg-Val-Ser-Ala-NH₂, lys side chain amino modified with chloroacetyl, ogly: glycolic acid, FIG. 2), which was detected as ESI-MS (m/z): 1199.18,calculated for C ₅₂H₉₀ClN₁₅O₁₅: 1199.64.

Synthetic 10 is useful for enzymatic monocyclization of polypeptides, enzymatic monocyclization of phage display polypeptide libraries, and screening for functional monocyclic peptide ligands.

Example 2:

Synthesis of 3, 5-bis [ (2-chloroacetyl) amino ] benzoyl-containing polypeptide oxygen ester 11

300.0. Mu. Mol RINKAMIDE resin (535.0 mg,0.56 mmol/g) was weighed and added to a 5.0mL solid phase synthesizer and 3.0mL DMF was added to swell for 20 minutes at room temperature. 2.0mL of 20% piperidine was added shake for 6 minutes at room temperature. The resin was washed with DMF and 2.0mL of an amino acid condensing reagent was added containing 4.5 equivalents of Fmoc-Ala-OH (557.0 mg), 4.5 equivalents of oxyma (127.0 mg) and 4.5 equivalents of N, N' -diisopropylcarbodiimide (139.0. Mu.L). Shake for 40 min at 55 ℃. Washing the resin with DMF, and condensing Ser, val, arg, ala, leu and glycolic acid. The resin was washed by treatment with 10% hydrazine hydrate for 30 minutes. 5.0 equivalents of Fmoc-Lys (Boc) -OH (596.0 mg), 3.0 equivalents of DMAP (73.2 mg), 3.0 equivalents of N, N' -diisopropylcarbodiimide (141.0. Mu.L, 3.0 equivalents) were dissolved in a mixed solution of 8.0: 8.0mLDCM/DMF (1:1, volume ratio), the resin was added and transferred together into a centrifuge tube of 15-mL gauge, and reacted at 25℃for 12h. The resin was washed with DMF and 2.0mL of 20% Fmoc protecting groups were added to remove the amino groups of Lys. Condensation of Pro, leu, ala amino acids was continued according to the SPPS synthesis procedure. After removal of the N-terminal Fmoc protecting group of the polypeptide by 20% piperidine, treatment with acetic anhydride blocking reagent (DMF: acetic anhydride: 2, 6-lutidine=89:5:6, volume ratio) was carried out for 2 min. The resin was dried at normal temperature and added with freshly prepared trifluoroacetic acid cleavage solution, wherein the volume ratio of TFA, m-cresol, water and triisopropylsilane was 88:5:5:2. The trifluoroacetic acid lysate containing the polypeptide was collected and 9 volumes of pre-ice-cooled diethyl ether were added to give a white powdered crude peptide.

3, 5-Bis [ (2-chloroacetyl) amino ] benzoic acid (15.2 mg) and N-hydroxysuccinimide (23.0 mg) were dissolved in 0.8mL of DMF, and N, N' -diisopropylcarbodiimide (31.2. Mu.L) was added thereto. The mixture is reacted for 60 minutes at normal temperature, 3.0mL of chromatographic water phase/chromatographic organic phase (1:1, volume ratio) is added for quenching reaction, and the activated ester of 3, 5-di [ (2-chloracetyl) amino ] benzoic acid is obtained through liquid chromatography purification.

The activated ester of 3, 5-bis [ (2-chloroacetyl) amino ] benzoic acid (8.0 mg) was dissolved in 0.2mL of LDMF, and crude peptide (16.0 mg, sequence AcNH-Ala-Leu-Pro-Lys-Ogly-Leu-Ala-Arg-Val-Ser-Ala-NH ₂, ogly: glycolic acid) and N, N-diisopropylethylamine (4.0. Mu.L) were added sequentially. After 60 minutes of reaction at normal temperature, 3.0mL of chromatographic aqueous phase is added for quenching reaction, and the 3, 5-di [ (2-chloroacetyl) amino ] benzoyl-containing polypeptide oxygen ester 11 (5.9 mg, the sequence of which is AcNH-Ala-Leu-Pro- ^CabLys-Ogly-Leu-Ala-Arg-Val-Ser-Ala-NH₂,^Cab Lys: lys is modified by 3, 5-di [ (2-chloroacetyl) amino ] benzoyl, ogly: glycolic acid structure, shown in figure 3) is obtained after high performance liquid chromatography purification and freeze drying, and is detected as ESI-MS (m/z): 1409.82,calculatedfor C ₆₁H₉₇Cl₂N₁₇O₁₇:1409.66.

Synthetic 11 is useful for enzymatic double cyclization of polypeptides and enzymatic double cyclization of phage display polypeptide libraries and screening for functional bicyclic peptide ligands.

Example 3:

omniligase-1 biological expression

Omniligase-1 was custom synthesized from general company. The synthesized plasmid was treated with XhoI and Ndel endonucleases, inserted into pET22b plasmid vector, and transformed into Top10 cells. Top10 cells were expanded and plasmids containing Omniligase-1 were collected using the kit. Omniligase-1 has the gene sequence:

ATGAAATGTGTCAGTTACGGCGTCGCGCAGATCAAGGCACCGGCGCTGCACAGCCAGGGTTATACCGGCTCCAACGTTAAGGTGGCGGTCCTCGATAGCGGCATCGATAGCTCCCATCCCGACCTCAATGTTGCCGGCGGCGCTTCTTTTGTGCCAAGCGAAACTAATCCTTTTCAGGATAATAATAGTCACGGGACGCATGTAGCAGGTACAGTCCTGGCGGTTGCGCCGAGCGCGTCACTCTACGCCGTGAAAGTGCTGGGCGCGGACGGCAGCGGACAATATAGTTGGGTAATTAATGGCATCGAGTGGGCCATCGCGAACAATATGGATGTGATCAATATGAGCCTGGGCGGCCCAAGCGGCAGTGCTGCCTTAAAAGCGGCGGTGGATAAAGCTGTGGCAAGTGGGGTCGTCGTGGTGGCAGCGGCGGGCAATAGTGGCACGAGTGGCTCTTCTTCGACTGTCTCTTACCCCGCGAAATACCCGTCGGTCATCGCGGTTGGGGCGGTTGATAGCTCTAACCAACGTGCCCCCTGGAGCAGTGTAGGCCCAGAATTAGATGTGATGGCGCCAGGTGTGTCTATCTGTAGCACACTCCCGGGCGGCAAATATGGTGCGCATAGTGGCACATGTCCAGCCAGTAACCACGTTGCCGGGGCGGCGGCCCTGATCTTAAGTAAACATCCAAACTGGACCAACACCCAGGTGCGTAGCAGTTTGGAAAACACCGCGACGAAACTGGGTGATTCTTTTTATTACGGGAAAGGTCTCATCAATGTTGAGGCGGCCGCCCAA

plasmids containing Omniligase-1 were transformed into chemically competent cells BL21 (DE 3) and grown overnight at 37℃in LB plates (ampicillin-containing). The strain with good growth is selected and inoculated in 500mLLB culture medium (containing ampicillin) for culture. IPTG (0.1 mM) induced expression of the target protein, and after culturing at 16℃for 20 hours, the strain was collected. Cells were resuspended in Tris lysis buffer (20.0mM Tris,500.0mM NaCl,5%glycerol,pH 7.5), sonicated, cell supernatants were collected, passed through a Ni-NTA purification column, and the polypeptide ligase of interest Omniligase-1 was eluted with 400.0mM imidazole solution. Omniligase-1 was dissolved in lysis buffer (20.0mM Tris,500.0mM NaCl,5%glycerol,pH 7.5) at a quantitative concentration of 1.7mg/mL, sub-packaged at-80 ℃ for enzyme-catalyzed double cyclization of polypeptides, enzyme-catalyzed double cyclization of phage display polypeptide libraries and screening for functional bicyclic peptide ligands.

Example 4:

Ligation and monocyclization of enzyme-catalyzed polypeptides

200.0. Mu.L of an enzyme-linked buffer (0.76M Na ₂HPO₄, 1mM TCEP, pH=8.0) was added to 2.0. Mu.L of the chloroacetyl-containing polypeptide oxygen ester 10 (200.0. Mu.M final concentration), followed by addition of the polypeptide template 1 (sequence H-FIEWLCK-NH ₂, 200.0. Mu.M final concentration) and Omniligase-1 (54.0. Mu.g, 10. Mu.M final concentration). And (5) oscillating at normal temperature for 2 hours, and then analyzing by liquid chromatography. As shown in FIG. 4, the polypeptide oxyester 10 is enzymatically linked to the polypeptide template 1 in the presence of Omniligase-1 to produce the desired monocyclic peptide product (molecular formula: C ₇₀H₁₀₅N₁₅O₁₅ S; theoretical molecular weight: 1427.76; observed molecular weight: 1427.98).

Example 5:

ligation and bicycloization of enzyme-catalyzed polypeptides

200.0. Mu.L of an enzyme-linked buffer (0.76M Na ₂HPO₄, 1mM TCEP, pH=8.0) was added to 2.0. Mu.L of 3, 5-bis [ (2-chloroacetyl) amino ] benzoyl polypeptide oxygen ester 11 (final concentration 10.0. Mu.M), followed by the polypeptide template 2 series (H-XLHGCRPYCK-NH ₂, where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, or G, final concentration 3.0. Mu.M) and Omniligase-1 (27.0. Mu.g, final concentration 5. Mu.M) were added. After incubation of the reaction solution at 4 ℃ for 30 minutes, liquid chromatography was performed. As shown in FIG. 5, 11 and 15 polypeptide templates 2 in the presence of Omniligase-1 undergo enzymatic ligation to produce the target bicyclic peptide product. Bicyclo- [ SL ] formula C ₈₂H₁₂₂N₂₄O₂₀S₂, observed molecular weight 1826.67, theoretical molecular weight 1826.84; bicyclo- [ TL ] molecular formula C ₈₃H₁₂₄N₂₄O₂₀S₂, observed molecular weight 1840.77, theoretical molecular weight 1840.86; bicyclo- [ NL ] molecular formula C ₈₃H₁₂₃N₂₅O₂₀S₂, observed molecular weight 1853.67, theoretical molecular weight 1853.85; the method comprises the steps of observing a molecular formula C ₈₂H₁₂₂N₂₄O₁₉S₂ of bicyclo- [ AL ], observing a molecular weight ₈₂H₁₂₂N₂₄O₁₉S₂ of theory, observing a molecular weight ₈₂H₁₂₂N₂₄O₁₉S₂ of bicyclo- [ YL ], observing a molecular weight of C ₈₂H₁₂₂N₂₄O₁₉S₂, observing a theoretical molecular weight of ₈₂H₁₂₂N₂₄O₁₉S₂, observing a molecular weight of C ₈₂H₁₂₂N₂₄O₁₉S₂ of bicyclo- [ KL ], observing a molecular weight of ₈₂H₁₂₂N₂₄O₁₉S₂, observing a theoretical molecular weight of ₈₂H₁₂₂N₂₄O₁₉S₂ of bicyclo- [ AL ], observing a molecular weight of C ₈₂H₁₂₂N₂₄O₁₉S₂ of the bicycle- [ IL ], observing a molecular weight of ₈₂H₁₂₂N₂₄O₁₉S₂ of the bicycle- [ VL ], observing a molecular weight of C ₈₂H₁₂₂N₂₄O₁₉S₂ of the bicycle- [ VL ], observing a molecular weight of ₈₂H₁₂₂N₂₄O₁₉S₂ of the bicycle- [ FL ], observing a molecular weight of C ₈₂H₁₂₂N₂₄O₁₉S₂ of the bicycle- [ WL ], observing a molecular weight of C ₈₂H₁₂₂N₂₄O₁₉S₂ of the bicycle- [ KL ], observing a molecular weight of C ₈₂H₁₂₂N₂₄O₁₉S₂ of the bicycle- [ ₈₂H₁₂₂N₂₄O₁₉S₂, observing a theoretical molecular weight of the bicycle- [ ML ], observing a molecular weight of C ₈₂H₁₂₂N₂₄O₁₉S₂ of the bicycle- [ HL ], a molecular weight of the bicycle- [ FL ], a molecular weight of the bicycle [ ₈₂H₁₂₂N₂₄O₁₉S₂, and a theoretical molecular weight of the bicycle [ ₈₂H₁₂₂N₂₄O₁₉S₂ ] of the bicycle [ ML ₈₂H₁₂₂N₂₄O₁₉S₂.

According to a similar procedure, 11 and 17 polypeptide templates 3 series (H-XIHGCRPYCK-NH ₂, where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, or E, final concentration of 3.0. Mu.M) undergo enzymatic cyclization to produce the target bicyclic peptide product as shown in FIG. 6. Bicyclo- [ SI ] molecular formula C, observing molecular weight, theoretical molecular weight; bicyclo- [ TI ] molecular formula C, observing molecular weight, theoretical molecular weight; the molecular weight of the molecular formula C is observed by the molecular formula C of the dicyclo- [ NI ], the theoretical molecular weight is observed by the molecular formula C of the dicyclo- [ AI ], the theoretical molecular weight is observed by the molecular formula C of the dicyclo- [ YI ], the theoretical molecular weight is observed by the molecular formula C of the dicyclo- [ RI ], the theoretical molecular weight is observed by the molecular weight C of the dicyclo- [ II ], the molecular weight is observed by the molecular formula C of the dicyclo- [ II ], the theoretical molecular weight is observed by the molecular formula C of the dicyclo- [ VI ], the molecular weight is observed by the molecular weight C of the dicyclo- [ FI ], the molecular weight is observed by the molecular weight C of the dicyclo- [ GI ], the molecular weight is observed by the molecular weight is detected by the molecular weight C of the dicyclo- [ YI ], the molecular weight is observed by the molecular weight C of the dicyclo- [ MI ], the molecular weight is observed by the molecular weight, the molecular weight is observed by the molecular weight is detected by the molecular weight, the molecular weight is detected by the molecular weight.

According to a similar procedure, 11 and 16 polypeptide templates 4 series (H-XVHGCRPYCK-NH ₂, where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, or E, at a final concentration of 3.0. Mu.M) undergo enzymatic ligation to produce the target bicyclic peptide product as shown in FIG. 7. Bicyclo- [ SV ] molecular formula C ₈₁H₁₂₀N₂₄O₂₀S₂, observed molecular weight 1813.35, theoretical molecular weight 1812.81; bicyclo- [ TV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂, observed molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂; the formula of the polymer is selected from the group consisting of a bicyclo [ NV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂, an observed molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a bicyclo [ AV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂, an observed molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a bicyclo [ YV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂, an observed molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a bicyclo [ RV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂, an observed molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a bicyclo [ IV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂, an observed molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a bicyclo [ VV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂, an observed molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a bicyclo [ FV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂, an observed molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, an observed molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a bicyclo [ WV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a bicyclo [ MV ] molecular weight C ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a bicyclo [ EV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a bicyclo [ ₈₂H₁₂₂N₂₄O₂₀S₂, a GV ] molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, a theoretical molecular weight ₈₂H₁₂₂N₂₄O₂₀S₂, and a bicyclo [ HV ] molecular formula C ₈₂H₁₂₂N₂₄O₂₀S₂.

According to a similar procedure, 11 and 15 polypeptide templates 5 series (H-XMHGCRPYCK-NH ₂, where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, or G, at a final concentration of 3.0. Mu.M) undergo enzymatic cyclization to produce the target bicyclic peptide product as shown in FIG. 8. Bicyclo- [ SM ] molecular formula C, observed molecular weight, theoretical molecular weight; bicyclo- [ TM ] molecular formula C, observed molecular weight, theoretical molecular weight; bicyclo- [ NM ] molecular formula C, observed molecular weight, theoretical molecular weight; the molecular weight of the molecular formula C is observed by the molecular formula C of the dicyclo- [ AM ], the theoretical molecular weight, the molecular formula C of the dicyclo- [ YM ], the theoretical molecular weight, the molecular formula C of the dicyclo- [ KM ], the observed molecular weight, the theoretical molecular weight, the molecular formula C of the dicyclo- [ IM ], the observed molecular weight, the theoretical molecular weight, the molecular formula C of the dicyclo- [ VM ], the molecular formula C of the observed molecular weight, the theoretical molecular weight, the molecular formula C of the dicyclo- [ FM ], the molecular formula C of the observed molecular weight, the molecular formula C of the dicyclo- [ GM ], the molecular formula C of the observed molecular weight, the theoretical molecular weight, the molecular formula C of the dicyclo- [ HM ], the molecular weight of the observed molecular weight, the molecular formula C of the dicyclo- [ QM ], the molecular weight of the observed molecular weight and the theoretical molecular weight.

According to a similar procedure, 11 and 17 polypeptide templates 6 series (H-XYHGCRPYCK-NH ₂, where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, or E, final concentration of 3.0. Mu.M) were subjected to enzymatic cyclization to produce the target bicyclic peptide product as shown in FIG. 9. The molecular formula C of the double ring- [ SY ] is observed, and the molecular weight is observed and the theoretical molecular weight is observed; bicyclo- [ TY ] molecular formula C, observed molecular weight, theoretical molecular weight; bicyclo- [ NY ] molecular formula C, observed molecular weight, theoretical molecular weight; the molecular weight of the molecular formula C is observed, the molecular weight of the molecular formula C is theoretical, the molecular weight of the molecular formula C is observed, the molecular weight of the molecular formula C is observed, and the molecular weight of the molecular formula C is observed.

According to a similar procedure, 11 and 18 polypeptide templates 7 series (H-XWHGCRPYCK-NH ₂, where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, E, or L, final concentration of 3.0. Mu.M) undergo enzymatic cyclization to produce the target bicyclic peptide product as shown in FIG. 10. Bicyclo- [ SW ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ TW ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ NW ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ AW ] molecular formula (C, observed molecular weight, theoretical molecular weight, bicyclo- [ YW ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ KW ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ RW ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ IW ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ FW ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ WW ] molecular formula C, observed molecular weight, bicyclo- [ GW ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ YW ] molecular weight, observed molecular weight, bicyclo- [ HW ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ MW ] molecular weight, observed molecular weight, and DW molecular weight, theoretical molecular weight, theoretical molecular weight 1941.90, bicyclo- [ LW ] molecular formula C ₉₀H₁₂₇N₂₅O₁₉S₂, observed molecular weight 1926.30, theoretical molecular weight 1925.94.

According to a similar procedure, 11 and 18 polypeptide templates 8 series (H-XFHGCRPYCK-NH ₂, where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, E, or L, final concentration of 3.0. Mu.M) undergo an enzymatic cyclization to produce the target bicyclic peptide product as shown in FIG. 11. Bicyclo- [ SF ] molecular formula C, observing molecular weight, theoretical molecular weight; bicyclo- [ TF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ NF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ AF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ YF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ KF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ RF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ IF ] molecular formula C, observed molecular weight, bicyclo- [ VF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ FF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ WF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ GF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ MF ] molecular formula C, observed molecular weight, theoretical molecular weight, bicyclo- [ HF ] molecular formula C, observed molecular weight, bicyclo- [ QF ] molecular formula C, observed molecular weight, bicyclo- [ DF ] molecular weight, theoretical molecular weight, bicyclo- [ FF ] molecular weight, theoretical molecular weight, and theoretical molecular weight, molecular weight 1886.40 was observed and theoretical molecular weight 1886.86.

According to a similar procedure, 11 and 8 polypeptide templates 9 series (H-XHHGCRPYCK-NH ₂, where X is Q, A, S, V, I, M, W, or F, final concentration of 3.0. Mu.M) undergo enzymatic cyclization to produce the target bicyclic peptide product as shown in FIG. 12. Bicyclo- [ SH ] molecular formula C ₈₂H₁₁₈N₂₆O₂₀S₂, observed molecular weight 1851.24, theoretical molecular weight 1850.85, bicyclo- [ AH ] molecular formula C ₈₂H₁₁₈N₂₆O₁₉S₂, observed molecular weight 1834.35, theoretical molecular weight 1834.86, bicyclo- [ IH ] molecular formula C ₈₅H₁₂₄N₂₆O₁₉S₂, observed molecular weight 1876.86, theoretical molecular weight 1876.90, bicyclo- [ VH ] molecular formula C ₈₄H₁₂₂N₂₆O₁₉S₂, observed molecular weight 1863.36, theoretical molecular weight 1862.89, bicyclo- [ FH ] molecular formula C ₈₈H₁₂₂N₂₆O₁₉S₂, observed molecular weight 1911.21, theoretical molecular weight 1910.89, bicyclo- [ WH ] molecular formula C ₉₀H₁₂₃N₂₇O₁₉S₂, observed molecular weight 1949.34, theoretical molecular weight 1949.90, bicyclo- [ MH ] molecular formula C ₈₄H₁₂₂N₂₆O₁₉S₃, observed molecular weight 1895.34, theoretical molecular weight 1894.86, bicyclo- [ QH ] molecular formula C ₈₄H₁₂₁N₂₇O₂₀S₂, observed molecular weight 1892.34, theoretical molecular weight 1891.88.

In FIGS. 5 to 12, 0 min is a chromatogram of 11 (10. Mu.M) with a series of nucleophilic polypeptides (3. Mu.M) in aqueous solution without polypeptide ligase and pH3, 30 min is a chromatogram of 11 (10. Mu.M) after reaction with a series of nucleophilic polypeptides (3. Mu.M) in aqueous solution of Omniligase-1 (5. Mu.M) and pH8 for 30 min, ". Times". And ". Times" refer to polypeptides containing glycolic acid and polypeptides containing 3, 5-bis [ (2-chloroacetyl) amino ] benzoyl groups, respectively, produced by hydrolysis of 11 at Omniligase-1 catalyzed by the oxygen ester linkage, and since Omniligase-1 catalyzed enzymatic cyclization reactions were performed at 4 ℃ (30 min) without optimization, optimizing temperature, pH, solution buffer salt composition, reaction time and reaction substrate, increased the efficiency of enzymatic cyclization reactions in this test.

Example 6:

modification of phage by Omniligase-1 catalytic reaction

Commercial M13KE phage plasmid was transformed into ER2738 cells and the original M13KE plasmid was amplified and extracted.

The four primer sequences were customized as follows:

primer 1:5'-TTTGGTCTC AGA GTG AGAATA GAAAGG TAC CACTAAAGG-3';

Primer(s) 2：5'-TTGGTCTC CAC TCT NNKNTN CAT CTTAATATT TGCGGT AAT CAT ACT ATG CAG TGC GGC GGC TCT GGC GGC TCTGGC GGC TCG GCC GAAACT GTT GAAAGT TGT TTA-3';

Primer(s) 3：5'-TTGGTCTC CAC TCT NNK TAT CAT CTTAATATT TGCGGT AAT CAT ACT ATG CAG TGC GGC GGC TCT GGC GGC TCTGGC GGC TCG GCC GAAACT GTT GAAAGT TGT TTA-3';

Primer(s) 4:5'-TTGGTCTC CAC TCT NNK TGG CAT CTT AATATT TGCGGT AAT CAT ACT ATG CAG TGC GGC GGC TCT GGC GGC TCTGGC GGC TCG GCC GAAACT GTT GAAAGT TGT TTA-3'

Primer 1 and primer 2, primer 3 or primer 4 are matched in parallel to carry out full plasmid PCR respectively. After mixing the reaction solutions, the kit recovered DNA and subjected to BsaI and DpnI treatments. After overnight enzymatic ligation of DNA by T4 DNA ligase, the DNA was electrotransformed into RE2738 cells, phages were grown in an amplified culture, and M13KE-XB phage library (X is any one of natural amino acids and B is any one of F, M, V, I, L, Y or W) was collected. 10 ¹¹ phages were dissolved in 100.0. Mu. LPBS buffer (0.76M Na ₂HPO₄, 1.0mM TCEP, pH 8.0), and Biotin-11 (sequence Biotin-. Beta.Ala-Ala-Leu-Pro- ^CabLys-Ogly-Leu-Ala-Arg-Val-Ser-Ala-NH₂, final concentration 10.0. Mu.M) and Omniligase-1 (final concentration 5.0. Mu.M) were added. After incubation of the reaction solution at 4℃for 30 minutes (250 rpm), 3.5. Mu.L of HCl solution (6.0M HCl) was added to adjust the pH to 5.0. Then, 25.0. Mu.L of PEG solution (20%PEG8000,0.5M NaCl) was added to precipitate phage particles, and resuspended in TBS, and diluted in a gradient to 10 ⁵ pfu/mL phage solution. 3 clean 2.0 mL-sized centrifuge tubes were taken and designated Aa, ab and B tubes, respectively. Into Aa tube, 20.0. Mu.L of phage solution (10 ⁵ pfu/mL) and 50.0. Mu. LBinding buffer and 50.0. Mu.L of Blocking buffer were added. To the washed streptavidin magnetic beads (20.0. Mu.L) were added 50.0. Mu. LBinding buffer (10.0 mM Tris-Cl, 150.0mM NaCl, 10.0mM MgCl ₂、1.0mM CaCl₂, pH 7.4) and 50.0. Mu. LBlocking buffer (10.0 mM Tris-Cl, 150.0mM NaCl, 10.0mM MgCl ₂、1.0mM CaCl₂, 0.3% Tween-20,3% (w/v) BSA) in the Ab tube. In the B tube, 20.0. Mu.L phage solution (10 ⁵ pfu/mL) and 50.0. Mu. LBinding buffer and 50.0. Mu.L Blocking buffer were added. After 1h at 25℃for each group, the Aa and Ab tubes were mixed (designated A tube), and 50.0. Mu. LBinding buffer and 50.0. Mu. LBlocking buffer were added to the B tube. Tubes a and B were incubated at 25 ℃ for 30 minutes. Magnetic beads were captured on a magnetic rack set a and the supernatant transferred to a clean centrifuge tube. After washing the beads 2 times with 200.0. Mu.L of washing buffer (10.0 mM Tris-Cl, 150.0mM NaCl, 10.0mM MgCl ₂、1.0mM CaCl₂, pH 7.4,0.1% Tween-20), the solution was transferred together to a centrifuge tube containing the phage supernatant of tube A. Tube B was added 400.0. Mu.L of wash buffer. The phage in the supernatant of tube A and tube B captured by the magnetic beads were measured by gradient. The efficiency calculation method of Omniligase-1 modified phage comprises that the modified phage proportion (%) = [ (B titer-A titer)/B titer ]. Times.100%. Phage capture experiments were repeated 3 times. Titer tests determined that 80% of phage particles were modified by Biotin-11.

Example 7:

phage bicyclic peptide library construction and bicyclic peptide ligand screening

The recognition site of BsaI of the phagemid vector is subjected to point mutation by using the pCANTAB5E phagemid vector as a template through a homologous recombination method to obtain pCANTAB5E ' (5'-GAGCGTGGGTCTCGCGGTATCATTGCAGCAC-3' is mutated into 5'-GAGCGTGGGTCGCGCGGTATCATTGCAGCAC-3'). 4 DNA primers were customized as follows (M is C or A; N is A or C or T or G):

primer 5:

5’-TTGGTCTCGGTGCGCCGGTGCCGTATCCGGATCCGCTG-3’;

primer 6:

5'-TTTGGTCTCAGCACCGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNNANMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3';

primer 7:

5'-TTTGGTCTCAGCACCGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNATAMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3';

primer 8:

5'-TTTGGTCTCAGCACCGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNCCAMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3';

Primer 5 and primer 6, primer 7 or primer 8 are matched in parallel to carry out PCR of the whole plasmid template pCANTAB 5E'. After mixing the reaction solutions, the kit recovered DNA and subjected to BsaI and DpnI treatments. After overnight enzymatic ligation of DNA by T4 DNA ligase, the DNA was electrotransformed into TG1 cells (electrotransformed diversity was determined to be 2X 10 ¹⁰ pfu). The TG1 containing library is taken for amplification culture, and super auxiliary phage infection package is adopted, and M13KE-XBX4CX6C phage library (X is any natural amino acid, B is any one of F, M, V, I, L, Y or W) is collected. Phage library (2×10 ¹² pfu) was dissolved in 100.0 μl of enzyme ligation buffer (0.76M Na ₂HPO₄, 1mm tcep, ph=8.0) followed by 11 (final concentration 5.0 μΜ). The reaction system was immediately incubated at 4 ℃ for 30 minutes. The pH was adjusted to 5.0 by adding 3.5. Mu.L of hydrochloric acid (6.0M HCl) followed by precipitation of the phage particles of interest in PEG8000 solution. phage particles were resuspended in 1.5mL bindingbuffer and 750.0. Mu.L blockingbuffer and incubated for 30min at room temperature. Meanwhile, 50.0. Mu.L of streptomycin-coated magnetic beads (Dynabeads M-280) were washed and resuspended in 300.0. Mu.L of binding buffer and 150.0. Mu.L of blocking buffer, and incubated at room temperature for 30 minutes. The supernatant of the beads was removed from the magnetic rack and the beads were resuspended in 100.0. Mu.L bindingbuffer/blocking buffer (2:1). 50.0. Mu.L of magnetic beads were added to the phage solution, and after incubation at room temperature for 30 minutes, phage supernatant was collected and the beads were removed. Phage were again treated with 50.0 μl of magnetic beads for 30 minutes. Phage were transferred to 20.0. Mu.L TEAD 4-coated magnetic beads previously treated with binding buffer/blocking buffer and incubated for 30 min at room temperature. After washing the beads 10 times elutionbuffer at pH2.2 was added. A small amount of the neutralized phage was measured for titer, the remaining infected TG1 cells, plated overnight for growth, and phage were packaged. The screening of rounds 2 and 3 was performed according to the procedure above. In the screening of the 4 th and 5 th rounds, phage were previously treated with the empty bead button background 9 times, and the other operation modes were similar. After round 5 screening, 30 clones were randomly selected, sequenced, and 5 bicyclic peptides were synthesized and evaluated for their ability to bind TEAD4 by meta-fluorescence. One of the bicyclic peptides 12 binds to 1.5. Mu.M (as shown in FIG. 13, where 12-L is a linear form of 12, i.e., the acyclic cross-linking arm within the sequence of 12 has only side-chain unmodified Lys and Cys residues). The binding force of the polypeptide is 100 times higher than that of the corresponding linear peptide, which indicates the effectiveness of the platform technology.

The foregoing embodiments are merely for illustrating the technical solution of the present invention, but not for limiting the same, and although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those skilled in the art that modifications may be made to the technical solution described in the foregoing embodiments or equivalents may be substituted for parts of the technical features thereof, and that such modifications or substitutions do not depart from the spirit and scope of the technical solution of the embodiments of the present invention in essence.

Claims (10)

1. A polypeptide compound, wherein the polypeptide compound is a polypeptide compound recognized by a polypeptide ligase that contains electrophilic reactive groups, and the compound has the following structural general formula:

Wherein X _a is any one of hydrogen, acetyl and oligopeptide group composed of natural or unnatural amino acid except cysteine, X _b is any one of electrophilic group and oligopeptide group composed of natural or unnatural amino acid containing electrophilic group, X _c is any one of oxygen (oxygen ester bond) and sulfur (thioester bond), X _d is any one of amino and oligopeptide sequence composed of natural or unnatural amino acid except cysteine, and n is any number between 1 and 8.

2. The polypeptide compound of claim 1, wherein the electrophilic group is any one of chloroacetamido, 4-chloroacetamido-benzamide, 3, 5-bis [ (2-chloroacetyl) amino ] benzamide, 3, 5-bis (chloromethyl) phenylthio, 2- (chloromethyl) phenylthio, 3- (chloromethyl) phenylthio, 4- (chloromethyl) biphenylphenylmethylthio, 2,3,4,5, 6-pentafluorophenylthio, 4- (2 ',3',4',5',6' -pentafluorophenyl) -2,3,5, 6-tetrafluorophenylthio.

3. A method of polypeptide ligase mediated polypeptide cyclization, comprising the steps of:

S1, carrying out polypeptide enzyme ligation reaction and intramolecular polypeptide cyclization reaction on the polypeptide compound in any one of claims 1-2 and a cysteine-containing polypeptide template in a buffer salt solution in the presence of polypeptide ligase generated by modifying subtilisin to generate a cyclopeptide molecule;

the cysteine-containing polypeptide template is as follows:

Template a is X-B- (X) m-C, template B is X-B- (X) m-C- (X) n-C;

The template a is used for constructing single-ring peptide, the template B is used for constructing double-ring peptide, B represents any one of L-leucine, L-isoleucine, L-valine, L-methionine, L-tyrosine, L-tryptophan, L-phenylalanine and L-histidine, X represents any one natural L-amino acid, C represents L-cysteine, the positions of the C and the C can be changed according to requirements, and m and n represent the number of amino acids between 3 and 20;

S2, selecting a polypeptide template containing cysteine in S1, fusion-expressing the polypeptide template at the N end of phage pIII protein through gene coding, constructing a phage display cyclopeptide library through S1 step operation, and screening a macrocyclic peptide ligand aiming at target protein.

4. The method of cyclizing a polypeptide according to claim 3, wherein the polypeptide ligase produced by the modification of subtilisin is any one of Subtiligase, peptiligase, omniligase-1.

5. The method for cyclizing a polypeptide according to claim 3, wherein the concentration of the polypeptide compound in the step S1 is in the range of 0.01. Mu.M to 1.0mM, the concentration of the polypeptide ligase is in the range of 0.01. Mu.M to 10.0mM, the buffer salt solution is any one of PBS, HEPES, naOAc and Tris, and the buffer salt solution contains TCEP in the range of 0.0. Mu.M to 10.0mM and has a pH in the range of 7.0 to 10.0.

6. The method of cyclizing a polypeptide according to claim 3, wherein the time for the ligation reaction of the polypeptide enzyme and the cyclization reaction of the intramolecular polypeptide in step S1 is 1min to 6h, and the reaction temperature is 0 to 45 ℃.

7. The method of cyclizing a polypeptide as set forth in claim 3, wherein the phage in S2 is a phage system consisting of pCANTAB 5E phagemid and helper phage M13KO7 or M13KE phage system.

8. The method of cyclizing a polypeptide according to claim 3, wherein the step of screening the target protein for a macrocyclic peptide ligand in step S2 comprises the steps of:

S2-1, constructing a phage display single-ring peptide or double-ring peptide library by using a polypeptide ligase-mediated polypeptide cyclization method;

s2-2, target proteins are biotinylated and fixed on magnetic beads, wherein a single-ring peptide or double-ring peptide library displayed by phage in S2-1 and the immobilized target proteins are incubated together, and after 2-6 rounds of biopanning, sequencing phage particles after the biopanning;

s2-3, synthesizing the enriched target cyclopeptide according to a sequencing result, and evaluating the binding force and the biological activity of the target cyclopeptide with the target protein.

9. Use of a polypeptide-ligase mediated polypeptide-cyclization process according to any one of claims 3 to 8 for the construction of gene-encoded cyclic peptide libraries.

10. Use of a cyclic peptide ligand obtainable by a polypeptide cyclisation process as defined in any one of claims 3 to 8 in the development of a medicament, a test kit or other biomedical and biological materials.