CN1189563C - Cloning-free linear expression vector constituting method - Google Patents
Cloning-free linear expression vector constituting method Download PDFInfo
- Publication number
- CN1189563C CN1189563C CNB021234604A CN02123460A CN1189563C CN 1189563 C CN1189563 C CN 1189563C CN B021234604 A CNB021234604 A CN B021234604A CN 02123460 A CN02123460 A CN 02123460A CN 1189563 C CN1189563 C CN 1189563C
- Authority
- CN
- China
- Prior art keywords
- primer
- dna
- expression vector
- linear expression
- segment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a construction method for a linear expression vector, particularly to a cloning-free construction method for a linear expression vector. In the construction method, a recognition sequence of nickase in primer design is led in, DNA segments are cut in an enzyme way by the nickase and are degraded by exonuclease after being enlarged, segments which have protrusion ends and need connecting are formed, and all the segments are connected with each other to obtain the linear expression vector. The method can greatly reduce the construction cost of the linear expression vector, so the construction method of the vector can be widely used in scientific research and production, and the method provides a technology platform for gene expression realization, protein function research, etc.
Description
Technical field
The present invention relates to a kind of construction process of expression vector, particularly a kind of structure linear expression vector's of cloning-free method.
Technical background
Usually the protein expression method is that goal gene to be cloned is connected with carrier, and this recon is transformed in the recipient bacterium, and the clone that Screening and Identification is correct increases, and it is changed in the host cell express again.This is the maximum method of utilization in the present protein expression research.But the step that this method relates to is many, and loaded down with trivial details time-consuming.The cutting and the linkage function that also have a kind of DNA of utilization topoisomerase I at present, structure linear expression vector's method, this carrier comprises promotor, goal gene and terminator fragment (Invitrogen company's T OPO Tools product introduction).The recognition site of DNA topoisomerase I is CCCTT ' site.In the design of primers, the recognition site that in the two ends primer of the reverse primer of promoter fragment, goal gene and the segmental forward primer sequence of terminator, adds this enzyme respectively, after each dna fragmentation amplification, cut through DNA topoisomerase I enzyme, the promoter fragment of formation is:-----CCCTT
-----GGGAAGCCTTG, the intermediary target gene fragment is: CGGAAAGGG-------CCCTT
TTCCC-------GGGAACTGAGT, terminal terminator fragment is: GACTCAAAGGG----
TTCCC-----。The DNA topoisomerase I also has the function of ligase enzyme simultaneously, this three fragment can be connected.Then, utilize promotor forward primer and terminator reverse primer, pcr amplification obtains a large amount of carrier segments, and its transfection recipient cell can directly be expressed target protein, does not need through clone's evaluation and these trivial step of amplification of transformant.But because DNA topoisomerase I price height, make that the application with this method structure linear expression vector's test kit has been subjected to certain restriction.
Summary of the invention
The purpose of this invention is to provide the existing enzyme cheaply of a kind of utilization, make up the linear expression vector, make up the defective that linear expression vector's method exists to overcome above-mentioned DNA topoisomerase I.This method is made test kit, will make things convenient for the user greatly, for realizing genetic expression, protein function research etc. provides technology platform.
Technical scheme of the present invention is as follows:
The invention provides a kind of linear expression vector's of structure method, its step comprises:
1. design primer
1) adjacent dna fragmentation pending connection position, the a pair of primer that design is made of primer 1 and primer 2, primer 1 and primer 2 comprise the dna sequence dna with fragment complementation to be connected, and the DNA that comprises nickase N.Bpu10I recognition sequence of one section 10-25 length of nucleotides, and comprise the dna sequence dna complementation of nickase N.Bpu10I in two primers.
2) promotor forward primer and terminator reverse primer only comprise and amplified fragments complementary dna sequence dna;
2. be template with the corresponding DNA fragments respectively, carry out pcr amplification, obtain amplified production with above-mentioned primer;
3. the amplified production that obtains of purification step 2 respectively, and cut the formation otch with nickase N.Bpu10I enzyme on the chain of DNA;
4. cut the strand of back dna double chain otch 3 ' → 5 ' with exonuclease ExoIII degraded N.Bpu10I enzyme, forming strand is the fragment to be connected of overhang;
5. the fragment to be connected after the enzymic digestion is mixed, add annealing buffer, connect each fragment, obtain containing the linear expression vector of goal gene;
Structure provided by the invention linear expression vector's method after the step 4, also comprises the fragment purification to be connected after enzyme cut; In step 5, also can add dna ligase and connect, used dna ligase is preferably the T4 dna ligase; After the ligase enzyme connection, also comprise the gained linear expression vector is carried out pcr amplification.
Sequence GCTCAGG in the DNA nickase N.Bpu10I identification double-stranded DNA that uses in present method ↓, cut otch of formation at this place's enzyme; Otch in the exonuclease ExoIII identification double-stranded DNA, and from incision with 3 ' → 5 ' direction degradation of dna fragment, the DNA after degraded is the fragment to be connected that has overhang.Because in design of primers, two primer lengths of adjacent segment junction are got 10-25 Nucleotide, comprising 7 Nucleotide of nickase N.Bpu10I identification, the length that increases primer mainly is in order effectively to connect between adjacent dna fragmentation, to avoid non-adjacent intersegmental incorrect link simultaneously.In the step 5, fragment to be connected is under the annealing buffer environment, exist even without ligase enzyme, rely on the reactive force between dna fragmentation also can realize the connection that sheet is intersegmental, have breach among the linear expression vector of formation, change this linear expression vector over to cell, can utilize the repair of cell paste endoenzyme, repair the otch in the two strands, make the linear expression vector finish expression (Nature Biotechnology 17,355-359,1999).
The enzyme that the present invention uses is cheap, greatly reduces use cost, if adopt present method to make up the linear expression vector, carry out the reagent that a reaction consumed and be approximately 30-50 yuan, and only be the 15%-20% of TOPO Tools test kit expense.This shows that this method can be used more widely in research and production.
Description of drawings
Fig. 1 makes up linear expression vector's synoptic diagram for using method of the present invention
Structure linear expression vector's synoptic diagram when Fig. 2 does not have ligase enzyme for using method of the present invention
Wherein: A is a target gene fragment for promoter fragment B
C is that terminator fragment D and D ' are linear expression vector's fragment
1 is that the reverse primer 2 of promoter fragment is the forward primer of goal gene
1 ' is that the reverse primer 2 ' of goal gene is the segmental forward primer of terminator
3 is that the forward primer 4 of promoter fragment is the segmental reverse primer of terminator
A ' is the amplified production of A
Wherein box indicating comprises the fragment of enzyme N.Bpu10I recognition sequence
B ' is the amplified production of the amplified production C ' of B for C
A " be the fragment of A ' after the N.Bpu10I enzyme is cut
B " be the fragment of B ' after the N.Bpu10I enzyme is cut
C " be the fragment of C ' after the N.Bpu10I enzyme is cut
A is A " fragment after the ExoIII enzyme is cut
B is B " fragment after the ExoIII enzyme is cut
C is C " fragment after the ExoIII enzyme is cut
Embodiment
Pfu archaeal dna polymerase wherein, the Taq archaeal dna polymerase is available from Shanghai Bo Ya biotech company, plasmid pCMV/myc/cyto/GFP is available from Invitrogen company (U.S.), T4 dna ligase (3unit/ μ l), PCR purification kit are available from Promega company (U.S.), N.Bpu10I, ExoIII enzyme are available from MBI company (Lithuania), and primer is synthetic by Shanghai Bo Ya biotech company.
Structure contains CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and the linear expression vector of BGHpA (polyadenylic acid) fragment (comprising terminator) C:
With plasmid pCMV/myc/cyto/GFP is template, amplification obtains CMV (cytomegalovirus) promoter fragment A respectively, GFP (green fluorescent protein) fragment B, BGHpA (polyadenylic acid) fragment (comprising terminator) C, the digestion back connects, obtain containing above-mentioned segmental linear expression vector D, its building process as shown in Figure 1.
(1) design primer
Design a pair of primer 1 and 2 in the junction of Segment A and B: primer 1 is the segmental reverse primer of promotor CMV, and primer 2 is the forward primer of target gene fragment GFP.Primer 1 and primer 2 comprise the dna fragmentation (shown in square frame among the figure) that dna sequence dna and a section with fragment complementation to be connected comprise enzyme N.Bpu10I recognition sequence, and primer 1 and primer 2 complementation.
Design a pair of primer 1 ' and 2 ' in the junction of fragment B and C: primer 1 ' is a target gene fragment GFP reverse primer, primer 2 ' be the forward primer of terminator BGHpA.Primer 1 ' and primer 2 ' comprise the dna fragmentation (shown in square frame among the figure) that dna sequence dna and a section with fragment complementation to be connected comprise enzyme N.Bpu10I recognition sequence, and primer 1 ' and primer 2 ' complementation.
The forward primer 3 of design promotor CMV and the reverse primer 4 of terminator.Primer sequence such as following table.
Table 1: primer
Primer | Sequence |
CMV forward primer (3) | 5’gtaccgaattcacattgattattg3’ |
CMV reverse primer (1) | 5’gcacccgctcGCTCAGGgccagtaagcagtgggttct3’ |
GFP forward primer (2) | 5’gcgagcgggtGCTCAGGatggctagcaaaggagaagaact3’ |
GFP reverse primer (1 ') | 5’gcctggttccaGCTCAGGctatttgtagagctcatccatgc3’ |
BGH forward primer (2 ') | 5’gctggaaccagGCTCAGGctcgctgatcagcctcgact3’ |
BGH reverse primer (4) | 5’atagagcccgggccatccc3’ |
CMV reverse primer (1), GFP forward primer (2), in GFP reverse primer (1 ') and the BGH forward primer (2 '), the sequence of 3 ' end lowercase is and amplified fragments complementary sequence; It is the primer sequence that comprises restriction enzyme site that 5 ' end has the sequence of underscore, and wherein capitalization is represented the recognition sequence of enzyme N.Bpu10I.
(2) three dna fragmentations of pcr amplification
Carry out three segmental pcr amplifications respectively by following condition:
Plasmid template (22.5ng/ μ l) 1 μ l
10X PCR damping fluid 5 μ l
10mM dNTP 1μl
Forward primer (100ng/ μ l) 1 μ l
Reverse primer (100ng/ μ l) 1 μ l
Pfu archaeal dna polymerase (3unit/ μ l) 1 μ l
Sterilized water 40 μ l
Cumulative volume 50 μ l
PCR damping fluid wherein: 100mM KCl, 160mM (NH
4)
2SO
4, 20mM MgSO4,200mM Tris-HCL, PH8.8,1%Trition X-100 and 1mg/ml BSA.Above mixture is with 94 ℃ of initial sex change 5 minutes, subsequently with 94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ were carried out 30 circulations in 1 minute, last 72 ℃ were extended 10 minutes, and obtained promotor amplified production A, target gene fragment amplified production B and terminator amplified production C.
(3) the nickase enzyme is cut the PCR product
Pcr amplification product is used the DNA purification kit respectively, and (Promega, American) purifying are surveyed its OD260 with ultraviolet spectrophotometer.With nickase N.Bpu10I digestion PCR product.Reaction conditions is as follows:
Reaction one:
CMV 7μg
10X damping fluid Y
+/ TANGO 5 μ l
N.Bpu 10I(5units/μl) 0.6μl
Sterilized water 50-X
Cumulative volume 50 μ l
37 ℃ were reacted 1 hour.
10X damping fluid Y
+/ TANGO is the general damping fluid of enzyme (a MBI company), and its component is a 33mMTris-acetate, 10mM magnesium acetate, 66mM Potassium ethanoate, 0.1mg/ml BSA (37 ℃ of pH7.9 at).X represents other liquor capacity sum except sterilized water, down together.
Reaction two:
GFP 7μg
10X damping fluid Y
+/ TANGO 5 μ l
N.Bpu 10I(5units/μl) 0.6μl
Sterilized water 50-X
Cumulative volume 50 μ l
37 ℃ were reacted 1 hour.
Reaction three:
BGH 2μg
10X damping fluid Y
+/ TANGO 5 μ l
N.Bpu10I(5units/μl) 0.6μl
Sterilized water 50-X
Cumulative volume 50 μ l
37 ℃ were reacted 1 hour.
(4) enzyme of exonuclease digestion nickase is cut product
Add exonuclease ExoIII 200unit in each reaction product of step (3), 37 ℃ were reacted 10 minutes.Obtain the fragment a to be connected of promotor, the fragment b to be connected of goal gene and the fragment c to be connected of terminator after the digestion.
(5) purifying of product
Product a, b, c use the PCR purification kit respectively, and (the operation by specification carries out for Promega, American) purifying.Survey its OD260 with ultraviolet spectrophotometer.
(6) ligation obtains (CMV+GFP+BGHpA)
Product a 100ng, b 115.5ng, c 39.11ng (being mol ratio 1: 1: 1) mix, and add T4DNA ligase enzyme 1 μ l (3unit/ μ l), anneal 15 minutes, and obtain connecting product linear expression vector D for 37 ℃.
(7) be that template is carried out secondary PCR to connect product
10X PCR damping fluid 5 μ l
25mM Mgcl
2 3μl
10mM dNTP 1μl
CMV forward primer (100ng/ μ l) 1 μ l
BGH reverse primer (100ng/ μ l) 1 μ l
Taq enzyme (3unit/ μ l) 1 μ l
Sterilized water 37 μ l
Cumulative volume 50 μ l
The PCR damping fluid: 500mM KCl, 10mM Tris-HCl, (PH9.0)
Above mixture is with 94 ℃ of initial sex change 5 minutes, subsequently with 94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ were carried out 30 circulations in 2 minutes, last 72 ℃ were extended the linear expression vector after promptly obtaining increasing 10 minutes.
In this embodiment, it is optional that enzyme is cut the purification step (5) of product, but remove the impurity component in the reaction system behind the purifying, makes that ligation is easier to carry out.
Embodiment 2:
Do not need ligase enzyme, structure contains CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and the linear expression vector of BGHpA (polyadenylic acid) fragment (comprising terminator) C:
With plasmid pCMV/myc/cyto/GFP is template, amplification obtains CMV (cytomegalovirus) promoter fragment A respectively, GFP (green fluorescent protein) fragment B, BGHpA (polyadenylic acid) fragment (comprising terminator) C, the digestion back connects, obtain containing above-mentioned segmental linear expression vector D ', its building process as shown in Figure 2.
(1) design primer
See Table 2:
Primer | Sequence |
CMV forward primer (3) | 5’gtaccgaattcacattgattattg3’ |
CMV reverse primer (1) | 5’ctcGCTCAGGgccagtaagcagtgggttct3’ |
GFP forward primer (2) | 5’ggtGCTCAGGatggctagcaaaggagaagaact3’ |
GFP reverse primer (1 ') | 5’ccaGCTCAGGctatttgtagagctcatccatgc3’ |
BGH forward primer (2 ') | 5’cagGCTCAGGctcgctgatcagcctcgact 3’ |
BGH reverse primer (4) | 5’atagagcccgggccatccc3’ |
CMV reverse primer (1), GFP forward primer (2), in GFP reverse primer (1 ') and the BGH forward primer (2 '), the sequence of 3 ' end small letter is and amplified fragments complementary sequence; It is the primer sequence that comprises restriction enzyme site that 5 ' end has the sequence of underscore, and wherein capitalization is represented the recognition sequence of enzyme NBpu10I.
(2) three dna fragmentations of pcr amplification
Method is with embodiment 1
(3) the nickase enzyme is cut the PCR product
Method is with embodiment 1
(4) enzyme of exonuclease digestion nickase is cut product
Method is with embodiment 1
(4) purifying of product
Method is with embodiment 1
(5) do not need ligase enzyme to carry out ligation and obtain expression vector
CMV purified product 500ng, GFP purified product 578.75ng and BGH purified product 117ng add annealing buffer 1.5ul, and 37 ℃ were reacted 15 minutes, and the linear expression vector D ' that obtains can be directly used in transfection.
Annealing buffer is: 100mM Nacl, 10mM Tris-HCl, pH7.4,1mMEDTA.Na
2
Structure contains CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, and the linear expression vector of BGHpA (polyadenylic acid) fragment (comprising terminator) C:
With plasmid pCMV/myc/cyto/GFP is template, amplification obtains CMV (cytomegalovirus) promoter fragment A, GFP (green fluorescent protein) fragment B, BGHpA (polyadenylic acid) fragment (comprising terminator) C respectively, the digestion back connects, and obtains containing above-mentioned segmental linear expression vector D.
(1) design primer
Table 3: primer
Primer | Sequence |
CMV forward primer (3) | 5’gtaccgaattcacattgattattg3’ |
CMV reverse primer (1) | 5’cagttgctgactaaggcaGCTCAGGgccagtaagcagtgggttct3’ |
GFP forward primer (2) | 5’gtccgactgcgagcgggtGCTCAGGatggctagcaaaggagaagaact3’ |
GFP reverse primer (1 ') | 5’ttcagacgcctggttccaGCTCAGGctatttgtagagctcatccatgc3’ |
BGH forward primer (2 ') | 5’ctagttcgctggaaccagGCTCAGGctcgctgatcagcctcgact 3’ |
BGH reverse primer (4) | 5’atagagcccgggccatccc3’ |
CMV reverse primer (1), GFP forward primer (2), in GFP reverse primer (1 ') and the BGH forward primer (2 '), the sequence of 3 ' end small letter is and amplified fragments complementary sequence; It is the primer sequence that comprises restriction enzyme site that 5 ' end has the sequence of underscore, and wherein capitalization is represented the recognition sequence of enzyme N.Bpu10I.
(2) three dna fragmentations of pcr amplification
Method is with embodiment 1
(3) the nickase enzyme is cut the PCR product
Method is with embodiment 1
(4) enzyme of exonuclease digestion nickase is cut product
Method is with embodiment 1
(4) purifying of product
Method is with embodiment 1
(5) carry out ligation with ligase enzyme and obtain expression vector D
A ' 500ng, B ' 500ng C ' 117ng, (being mol ratio 1: 1: 1) are mixed, and add ligase enzyme damping fluid 1.5 μ l, and T4 dna ligase 1.5 μ l (3unit/ μ l) annealed 15 minutes, and obtained connecting product linear expression vector D for 37 ℃.
Claims (5)
1, a kind of linear expression vector constituting method, its step comprises:
1) design primer:
A. adjacent dna segment pending connection position, the a pair of primer that design is made of primer 1 and primer 2, primer 1 and primer 2 comprise and segment complementary dna sequence dna to be connected, and the DNA that comprises nickase N.Bpu101 recognition sequence of one section 10-25 length of nucleotides, and two primers and the dna sequence dna complementation that comprises nickase N.Bpu101;
B. promotor forward primer and terminator reverse primer only comprise and the segment complementary dna sequence dna that increases;
2) be template with corresponding dna segment respectively, carry out pcr amplification, obtain amplified production with above-mentioned primer;
3) amplified production that obtains purification step 2 respectively), and on the chain of DNA, form otch with nickase N.Bpu101;
4) cut the strand of back dna double chain incision 3 ' → 5 ' with exonuclease ExoIII degraded N.Bpu101 enzyme, forming strand is the segment to be connected of overhang;
5) segment to be connected after the enzymic digestion is mixed, add the annealing buffer agent, connect each segment, obtain containing the linear expression vector of goal gene.
2, by the described linear expression vector constituting method of claim 1, it is characterized in that after the step 4), also comprise the segment purifying to be connected after enzyme cut.
3, by the described linear expression vector constituting method of claim 1, it is characterized in that to add in the step 5) dna ligase and connect.
4, by the described linear expression vector constituting method of claim 3, it is characterized in that dna ligase used in the step 5) is the T4 dna ligase.
5, by claim 3 or 4 described linear expression vector constituting methods, it is characterized in that after the step 5), also comprise the gained linear expression vector is carried out pcr amplification.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB021234604A CN1189563C (en) | 2002-06-28 | 2002-06-28 | Cloning-free linear expression vector constituting method |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB021234604A CN1189563C (en) | 2002-06-28 | 2002-06-28 | Cloning-free linear expression vector constituting method |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1403575A CN1403575A (en) | 2003-03-19 |
CN1189563C true CN1189563C (en) | 2005-02-16 |
Family
ID=4745137
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB021234604A Expired - Fee Related CN1189563C (en) | 2002-06-28 | 2002-06-28 | Cloning-free linear expression vector constituting method |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1189563C (en) |
-
2002
- 2002-06-28 CN CNB021234604A patent/CN1189563C/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN1403575A (en) | 2003-03-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1263860C (en) | Construction method of multigene carrier and its application | |
CN1276082C (en) | Method for synthesizing C DNA | |
CN1249784A (en) | In vitro method for construction of DNA library | |
CN1367840A (en) | Mutant TN5 transposase enzymes and method for their use | |
EP2826862A1 (en) | Gene synthesis process, gene chip and kit | |
CN1056188C (en) | Synthetic tRNAs | |
CN1189563C (en) | Cloning-free linear expression vector constituting method | |
CN1590549A (en) | Method of constructing T carrier | |
CN1908016A (en) | Fusion protein with protein transduction structure field TAT-PTD and application thereof | |
CN101050472A (en) | Method of increasing specificity of nucleic acid hybridization using zwitterionic compound | |
CN1740322A (en) | Para-gene sequence for exogenous insertion vector of corn strain MON863 | |
CN1151262C (en) | Method for expression of foreign genes and vectors therefor | |
CN1289669C (en) | Design process for compound amplifying primer | |
CN1810971A (en) | Antibacterial peptide gene of Chinese prawn containing single whey acidic protein structure domain and its coded antibacterial peptide and application | |
CN1414098A (en) | Linear expression carrier construction method need no clone | |
CN1233827C (en) | Method of point mutation without need of chain reaction of polymerase and the kit | |
CN1702173A (en) | Coded high temperature acid alpha-amylase gene and its synthesis method, cloning and expression | |
CN1414099A (en) | Linear expression carrier construction method need no clone | |
CN1802436A (en) | Plasmid having a function of T-vector and expression vector, and expression of the target gene using the same | |
CN1438328A (en) | Quantitative detection method for transgenic farm product and food mixture | |
CN1759191A (en) | DNA amplification method and kit therefor | |
CN1641040A (en) | Method for configuring CDMA library and its special primer | |
CN1274389A (en) | Methods for DNA amplification and kits therefor | |
CN1198926C (en) | Nucleic acid fragments, recombinant vector containing the same and method for promoting expression of structural gene by using the same | |
CN1630727A (en) | Nucleic acid for a cloning vector |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C19 | Lapse of patent right due to non-payment of the annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |