CN118460605B

CN118460605B - Application of GhMYB102 gene in improving verticillium resistance of plants

Info

Publication number: CN118460605B
Application number: CN202410939797.5A
Authority: CN
Inventors: 苗雨晨; 李坤; 贾昆鹏; 郭敬功; 郭玉涛; 曹佳丹; 李海鹏
Original assignee: Sanya Research Institute Of Henan University; Henan University
Current assignee: Sanya Research Institute Of Henan University; Henan University
Priority date: 2024-07-15
Filing date: 2024-07-15
Publication date: 2024-09-06
Anticipated expiration: 2044-07-15
Also published as: CN118460605A

Abstract

The invention discloses application of a GhMYB102 gene in improving plant verticillium wilt resistance, wherein the nucleotide sequence of the GhMYB102 gene is shown as SEQ ID NO. 1. According to the invention, the GhMYB102 silenced plant is obtained in a gene silencing mode, and the result shows that the gene silenced plant has serious leaf wilting and serious leaf falling under the infection of the verticillium dahliae V991, and the gene silenced plant is more sensitive to the verticillium dahliae V991. Then constructing an overexpression vector p35S-GhMYB102-GFP of GhMYB102, transforming wild type Arabidopsis thaliana (Clo-0, WT) by using an agrobacterium inflorescence infection method to obtain an overexpression plant, and analyzing results show that under the stress of Verticillium dahliae, compared with the wild type, the GhMYB102 gene can enhance the resistance of Arabidopsis thaliana seedlings to verticillium wilt, thereby providing gene resources for crop disease resistance molecular breeding.

Description

Application of GhMYB102 gene in improving verticillium resistance of plants

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of a GhMYB102 gene in improving verticillium wilt resistance of plants.

Background

Verticillium wilt is one of the most prominent diseases in cotton planting and is called "cancer" of cotton. First found in the united states in 1914, then spread to other major cotton producing countries and first appeared in china in 1935. Verticillium wilt is a serious plant disease, and its hazard is mainly manifested in the following aspects: firstly, the verticillium wilt has a wide spread range, not only affects cotton planting, but also can harm more than 200 plants, including various commercial crops such as potatoes, tomatoes, lettuce, potatoes and the like, and the wide invasion range causes the verticillium wilt to cause great threat to agricultural production. Secondly, verticillium wilt has a serious effect on yield. Worldwide, verticillium wilt results in yield losses of about 10% -35%. The research shows that verticillium dahliae is the main pathogenic bacteria of cotton verticillium in China. The verticillium dahliae can survive in the soil for up to 14 years, once the verticillium dahliae is transmitted, the verticillium dahliae is difficult to eradicate, and is one of the most destructive of 10 verticillium, and no effective bactericide exists in the production at present. It relies on its dormant structure of the resulting microsclerotia to diffuse and destroy plant tissue in the plant, resulting in leaf wilting, yellowing and vascular bundle browning. The infection process of the verticillium dahliae comprises biological nutrition and necrosis nutrition stages. In the biological nutrition phase, verticillium dahliae is rapidly propagated by using the nutrition of host plants, generating conidia and systemic transmission. A large number of hyphae and conidia colonize the xylem, resulting in wilting, yellowing and even death of the leaf surfaces of the host plants. With the rapid expansion of pathogenic bacteria gradually exceeding the host defenses, the host plant eventually dies, and the verticillium dahliae enters the necrotic stage, eventually forming microsclerotia to ensure long-term survival.

In summary, the damage of verticillium to agricultural production is versatile, including a broad spread, serious yield loss, and persistence and destructive power of pathogenic bacteria. In order to effectively control the transmission and hazard of verticillium wilt, the infection mechanism and pathogenic mechanism of verticillium wilt need to be studied deeply, disease-resistant genes are utilized, and disease-resistant varieties are cultivated, so that the stable development of agricultural production is ensured.

Disclosure of Invention

The invention aims to provide an application of GhMYB102 gene in improving verticillium resistance of plants.

In order to achieve the above purpose, the technical scheme adopted by the invention is summarized as follows:

The Sequence number (Sequence ID) of the GhMYB102 gene adopted by the invention in CottonFGD is Ghir _ D04G015810.1 (the download address is https:// cottonfgd.net/profiles/trans/Ghir _ D04G015810.1 /), the length of the messenger RNA (mRNA) Sequence of the GhMYB102 gene is 1016 bp, the length of the coding Sequence of the GhMYB102 gene is 504 bp, the nucleotide Sequence is shown as SEQ ID NO.1 and comprises 167 amino acids; the amino acid sequence is shown as SEQ ID NO. 2.

The invention also constructs a series of plant expression vectors, recombinant vectors or transgenic plants containing the genes, and the functions of host cells containing the vectors in improving the verticillium wilt resistance of plants also fall into the protection scope of the invention.

The functions of the genes protected by the invention not only comprise the GhMYB102 genes, but also comprise the functions of homologous genes with higher homology (such as homology higher than 80%) with the GhMYB102 genes in terms of verticillium wilt resistance.

The invention discloses a biological function of GhMYB102 gene in verticillium resistance of plants, which is specifically expressed in the following steps: under the infection of verticillium dahliae, the leaf yellowing degree, wilting degree, leaf shedding degree and stem blackening degree of the GhMYB102 gene silencing strain are all higher than those of the wild type, and the disease index and the disease grade (from low to high, respectively grade 0, grade 1, grade 2, grade 3 and grade 4) of the GhMYB102 overexpression strain are lower than those of the wild type.

According to the functions, a plant resistant to verticillium wilt can be obtained in a transgenic mode, specifically, the GhMYB102 gene can be specifically introduced into the target plant through the recombinant expression vector to obtain a transgenic plant, and the resistance of the plant to verticillium wilt is higher than that of the target plant. In the method, the recombinant expression vector may be used to transform plant cells or tissues by using conventional biological methods such as Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, electric conduction, agrobacterium mediation, etc., and the transformed plant tissues are cultivated into plants.

In order to improve the excellent properties of plants, the invention also provides a novel plant breeding method for obtaining plants with higher or/and lower resistance to verticillium wilt than the target plants by regulating the expression of the GhMYB102 gene in the target plants.

The mode of regulating the expression of GhMYB102 gene in the target plant is over-expression and silencing of GhMYB102 gene.

Wherein the target plant is cotton or Arabidopsis thaliana.

Regulating the gene expression level comprises regulating the GhMYB102 expression by utilizing a DNA homologous recombination technology, a virus-mediated gene silencing technology and an agrobacterium-mediated transformation system to obtain a transgenic plant line.

In the present invention, the plant suitable for the present invention is not particularly limited as long as it is suitable for performing a gene transformation operation such as various crops, flower plants, forestry plants, or the like. The plant may be, for example (without limitation): dicotyledonous, monocotyledonous or gymnosperm plants.

As a preferred mode, the "plant" includes, but is not limited to: cotton, arabidopsis, and especially upland cotton (Gossypiumhirsutum), all genes having this gene or being homologous thereto are suitable.

As used herein, the term "plant" includes whole plants, parent and progeny plants thereof, and various parts of plants, including seeds, fruits, shoots, stems, leaves, roots (including tubers), flowers, tissues and organs, in which the gene or nucleic acid of interest is found. Reference herein to "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the foregoing comprises the gene/nucleic acid of interest.

The present invention includes any plant cell, or any plant obtained or obtainable by a method therein, as well as all plant parts and propagules thereof. The present patent also encompasses transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods. The only requirement is that the sub-representations exhibit the same genotypic or phenotypic characteristics, and that the progeny obtained using the methods of this patent have the same characteristics.

The invention also extends to harvestable parts of a plant as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. And further to other derivatives of the plants after harvest, such as dry granules or powders, oils, fats and fatty acids, starches or proteins. The invention also relates to a food or food additive obtained from the relevant plant.

The invention has the advantages that:

(1) The invention adopts a transcriptomics method to creatively clone R2R3-MYB genes which respond to adversity stress and participate in verticillium wilt resistance in upland cotton (Gossypiumhirsutum). Constructing a yeast expression vector pGBKT7-GhMYB102, and transforming the recombinant vector into an escherichia coli expression competent cell DH5 alpha, wherein the result shows that the GhMYB102 has transcriptional activation activity. Further constructing a GhMYB102 gene silencing vector pTRV2-GhMYB102, injecting agrobacterium containing pTRV2-GhMYB102 into cotton leaves by using an agrobacterium injection cotton cotyledon method to obtain GhMYB102 silencing plants, and the result shows that the gene silencing plants have serious leaf yellowing and serious wilting under the infection of the verticillium dahliae, and are more sensitive to the infection of the verticillium dahliae. Then constructing an overexpression vector p35S-GhMYB102-GFP of GhMYB102, transforming wild type Arabidopsis thaliana (Clo-0, WT) by using an agrobacterium inflorescence infection method to obtain an overexpression plant, and analyzing results show that under the infection of the Verticillium dahliae, compared with the wild type, the resistance of the Arabidopsis thaliana seedling to the Verticillium dahliae can be improved by the overexpression of the GhMYB 102.

(2) The verticillium wilt-resistant plant can be obtained by a transgenic mode, specifically, the transgenic plant can be obtained by introducing GhMYB102 gene into a target plant, the verticillium wilt resistance of the plant is higher than that of a control plant, and a new way is provided for plant disease resistance breeding.

Drawings

FIG. 1 is a transcriptional activation assay of GhMYB 102.

FIG. 2 is an analysis of GhMYB102 gene expression levels in Verticillium dahliae infection; in FIG. 2, A represents the response of the upland cotton PR10-11 gene (gene specifically induced by pathogenic bacteria) at 0 h, 3h, 6 h, 12 h, 24 h, 48 h,14 d under infection of Verticillium dahliae V991, with the result that it is significantly induced at 14 d; b represents the response of the GhMYB102 gene at 0 h, 3h, 6 h, 12 h, 24 h, 48 h,14 d under infection of Verticillium dahliae V991, with the result that significant induction was achieved at 48 h and 14 d.

FIG. 3 is a graph showing analysis of GhMYB102 expression levels in GhMYB102 gene-silenced plants and statistics of phenotype and morbidity after infection with verticillium; in fig. 3, a is a positive control of the silenced plant; b is the silencing efficiency detection of a silencing plant, and GhMYB102 gene expression is silenced and down-regulated, so that the material is proved to be successfully created; c is the phenotype of the silencing material after infecting the verticillium dahliae V991, and compared with a control (TRV: 00), the leaf wilt of the gene silencing plant is serious; d is the disease index statistics of the diseased plants, and the disease index of the GhMYB102 silent plants (TRV: ghMYB 102) is obviously higher than that of the normal plants (TRV: 00); e is the plant proportion statistics of different morbidity grades of GhMYB102 silent plants (TRV: ghMYB 102) and control (TRV: 00), and the plant proportion of the higher morbidity grade of the GhMYB102 silent plants is obviously higher than that of the control group.

FIG. 4 is an analysis of colony amounts in plants 14 days after infection of cotton GhMYB102 silencing plants (TRV: ghMYB 102) and normal plants (TRV: 00) with Verticillium dahliae; in FIG. 4, A is the longitudinal section of stem of GhMYB102 silenced plant (TRV: ghMYB 102) and control (TRV: 00) plants after 14 days of infection of Verticillium dahliae, and the silenced plants are more brown than the control group; b is a colony recovery experiment of stems; c is a quantification of the colony amount of B in FIG. 4, and the result shows that the colony amount of GhMYB102 silencing plants (TRV: ghMYB 102) is higher than that of control plants (TRV: 00).

FIG. 5 shows the measurement of the expression level of genes involved in the lignin synthesis pathway in GhMYB 102-silenced plants (TRV: ghMYB 102).

FIG. 6 is analysis of GhMYB102 transgenic Arabidopsis expression level and statistics of disease occurrence, in FIG. 6, A is phenotype of Arabidopsis over-expression material OE-4, 5, 8 and WT plants after 991 day of infection with Verticillium dahliae V; b is the disease index statistics, and the disease index of the over-expression material is lower than that of the wild type WT; and C is statistics of the number proportion of plants with different disease grades, and the plants with high disease grades of the over-expression material are less than wild WT.

Detailed Description

The present invention will be described in detail with reference to specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated. The test methods in the following examples are conventional methods unless otherwise specified. The reagents and materials employed, unless otherwise indicated, are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the present invention. The preferred methods and materials described herein are presented for illustrative purposes only.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botanicals, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics, which will be apparent to one of skill in the art. These techniques are fully explained in the published literature, and the methods of DNA extraction, yeast transformation, construction of an overexpression vector, transgenic plant acquisition, and the like used in the present invention can be realized by the methods disclosed in the prior art except for the methods used in the examples described below.

The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-or double-stranded structures. Such nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. "Gene" or "gene sequence" is used broadly to refer to a functional DNA nucleic acid sequence. Thus, a gene may include introns and exons in genomic sequences, and/or coding sequences in cDNA, and/or cDNA and regulatory sequences thereof. In particular embodiments, for example in relation to isolated nucleic acid sequences, it is preferred that they are cDNA.

Biological material

Cotton TM-1 seeds were stored for laboratory; the arabidopsis Col-0 seeds are preserved in a laboratory;

a yeast expression vector pGBKT7; the gene silencing vector empty vector and the positive control vector TRV GhCLA are stored in a laboratory; the overexpression vector pSuper-1300-GFP is stored in a laboratory;

coli DH 5. Alpha. And Agrobacterium GV3101 were kept in the laboratory;

verticillium dahliae (VerticilliumdahliaeKleb) strain V991, a commonly used research strain, available from public sources;

Primer synthesis and sequencing were performed by zheng state qing department of biology.

The cotton cultivation mode comprises the following cultivation conditions: after germination of cotton seeds in a 28 ℃ incubator for 2 days in the absence of light, the germinated seeds were cultivated in a greenhouse (28 ℃ C., 16 h light/8 h dark) using soil cultivation (nutrient soil: vermiculite=2:1).

Arabidopsis thaliana (Arabidopsis thaliana) Col-0 ecotype, a common model plant research material, cultivation conditions are: the temperature is 22+/-1 ℃, the light-dark period is 16 h/8 h, and the illumination intensity is 50 mu mol.m ^-2•s^-1.

Grade of onset: verticillium wilt refers to the severity of a plant verticillium wilt disorder, which is classified into 5 grades (0-4 grades): grade 0 represents no obvious wilting or yellowing symptoms; grade 1 represents 0-25% (25% inclusive) of true leaf withering, yellowing or abscission; grade 2 represents that there is 25-50% (50%) of true leaf withering, yellowing or abscission; grade 3 represents that there is 50-75% (75% inclusive) of true leaf withering, yellowing or abscission; grade 4 represents 75-100% (100% inclusive) of true leaf withering, yellowing or shedding.

The disease index is calculated as follows:

Disease index = [0 xn ₀ (number of plants at grade 0) +1 xn ₁ (number of plants at grade 1) +2 xn ₂ (number of plants at grade 2) +3 xn ₃ (number of plants at grade 3) +4 xn ₄ (number of plants at grade 4) ] [4 xn _{Total (S)} (total number of all plants at grade 0-4) ].

Experimental reagent

RNA extraction kits, reverse transcription kits, and fluorescent quantification kits were purchased from nuuzan biotechnology limited;

common reagents such as PDB medium (medium for culturing Verticillium dahliae V991) were purchased from Soy Barbao;

hygromycin is purchased from soribao biosystems;

MS media was purchased from beijing cool pacing technologies limited;

Various endonucleases were purchased from monate biotechnology limited;

one-step cloning enzyme was purchased from nuuzan biotechnology limited;

Plasmid miniprep and gel recovery kits were purchased from beijing tiangen biotechnology limited.

Experimental equipment

PCR apparatus was purchased from Bio-rad company;

the refrigerated centrifuge is purchased from Eppendorf corporation;

Quantitative PCR instrument was purchased from Bio-rad company;

confocal laser microscopy was purchased from zeiss corporation;

the autoclave MLS-3750 was purchased from Sanyang, japan;

Nucleic acid detector Nanodrop 2000C was purchased from Thermo Scientific company;

Normal temperature centrifuge and microplate reader SpectraMax iD5 were purchased from Thermo Scientific.

EXAMPLE 1 cloning of GhMYB102 Gene and amino acid sequence analysis thereof

RNA of upland cotton TM-1 grown for 15 days is extracted, cDNA obtained by reverse transcription reaction is used as a template, gene sequences obtained from CottonFGD (https:// cottonfgd.net/profiles/transitiont/Ghir _ D04G015810.1 /) databases are subjected to PCR reaction by PRIMER PREMIER.0 design specific primers, coding sequences of GhMYB102 genes are cloned respectively, and the nucleic acid sequences are converted into protein sequences by a trans (https:// www.expasy.org/resources/on-line tool).

EXAMPLE 2 construction of Yeast expression vector pGBKT7

In order to explore the characteristics of GhMYB102 transcription factor, the inventors constructed a yeast expression vector pGBKT7, and the specific procedures are briefly described below.

First, primers with restriction enzyme EcoRI and BamHI cleavage sites were designed, the sequences were as follows:

F：5'-GCCATGGAGGCCAGTGAATTCATGGGGAGAACACCT-3'；

R：5'-CAGCTCGAGCTCGATGGATCCACGTGGGAGTTTGAA-3'；

then, PCR amplification was performed using the cDNA sample prepared in example 1 as a template, and the amplified product was purified and recovered;

thirdly, carrying out double digestion on the pGBKT7 vector by adopting EcoRI and BamHI, and purifying digestion products;

fourthly, carrying out homologous recombination connection on the PCR amplification product and the digested vector to construct a yeast expression vector pGBKT7-GhMYB102 vector;

Fifthly, converting the connection product into escherichia coli DH5 alpha by adopting a heat shock conversion method, performing (ampicillin, 50 mug/mL) resistance screening, selecting positive colonies for PCR detection, and carrying out sequencing on the correct colonies identified by the PCR detection, and extracting plasmids from bacterial liquid with correct sequencing for later use;

Sixth, the extracted plasmid was transformed into yeast expression competent cell Y ₂ H Gold while co-transferring the defect medium SD-Trp with pGADT7 vector, spotting on the yeast defect medium SD-Trp-Leu-His and SD-Trp-Leu-His+x- α -gal, each combining point 5. Mu.l of bacterial liquid on the medium (FIG. 1).

Example 3 silencing of the GhMYB102 Gene to verify its function in verticillium resistance

To analyze whether GhMYB102 is involved in the infection of cotton in response to verticillium dahliae, first, the expression pattern of GhMYB102 under verticillium dahliae infection conditions was analyzed. Roots 3 min of wild cotton plants TM-1 grown for 14 days were soaked in 1.0X10 ⁷ CFU/mL Verticillium dahliae suspension, cotton true leaves were sampled after 0h,3 h,6 h,12 h,24 h, 48h and 14 d, respectively, and the expression level of GhMYB102 was detected by real-time fluorescent quantitative PCR (qRT-PCR).

As a result, the expression level of the specific gene GhPR-11 expressed by disease resistance induction is increased to more than 40 times after 14: 14 d of Verticillium dahliae treatment (A in figure 2), which shows that cotton seedlings are truly infected by the Verticillium dahliae; after the invasive bacteria treatment 48 h and 14 d, the expression level of GhMYB102 was increased to 2-200 times (B in FIG. 2). This result suggests that GhMYB102 may be involved in regulating the process of cotton infestation by verticillium dahliae.

In order to deeply study the function of GhMYB102 in the infection of upland cotton to verticillium dahliae, the inventor constructs a gene silencing vector pTRV 2-GhMYB 102 of GhMYB102 by utilizing a virus-induced GENE SILENCING (VIGS) system aiming at a conserved region of GhMYB102, and obtains a cotton plant silenced by GhMYB 102. The specific procedure is briefly described as follows.

First, a primer with restriction enzyme EcoRI and BamHI cleavage sites was designed, the sequence being as follows:

F：5'- GTGAGTAAGGTTACCGAATTCGTCCGCCATTGCTTGTCG-3'；

R：5'- CGTGAGCTCGGTACCGGATCCAAGATATTTAGTAGTAGTA-3'；

Secondly, performing PCR amplification by using the cDNA sample prepared in the example 1 as a template, and purifying and recovering an amplification product;

Thirdly, carrying out double digestion on the recovered PCR amplification product and a vector pTRV2 vector by adopting EcoRI and BamH I respectively, carrying out agarose gel electrophoresis of 1.0% on the digested products, and recovering enzyme sections for purification;

Fourthly, carrying out homologous recombination connection on the PCR amplification product and the enzyme-digested vector to construct a pTRV2-GhMYB102 expression vector, and connecting the recovered enzyme-digested fragments by using Solution I ligase to construct a transient silencing pTRV2-GhMYB102 vector;

Fifthly, converting the connection product into escherichia coli DH5 alpha by adopting a heat shock conversion method, carrying out K ⁺ (kanamycin, 50 mug/mL) resistance screening, selecting positive colonies for PCR detection, carrying out sequencing on correct colonies identified by the PCR detection, and extracting plasmids from bacterial liquid with correct sequencing for later use;

sixthly, the extracted plasmid is transformed into an agrobacterium competent cell GV3101, and the plasmid is preserved at the temperature of minus 80 ℃ for standby;

seventh, the agrobacterium suspension containing pTRV 2-GhMYB 102, pTRV2, pTRV-CLA, pTRV1 is injected into cotton cotyledon by agrobacterium injection method to obtain GhMYB102 silenced plant and control plant.

The results showed that the transformed TRV GhCLA plants, which were the positive control group, exhibited a leaf albino phenotype after 7 days of Agrobacterium infection, indicating that the gene silencing system was functional (FIG. 3A), and the negative control group was TRV 00. The qRT-PCR experiment is used for detecting the expression level of GhMYB102 GhMYB102 in different plants with GhMYB102 silencing by the VIGS system, and the results show that the expression level of GhMYB102 in 6 detected cotton seedlings is 1/5 (B in figure 3) of a control group, and the results show that GhMYB102 silencing plants are successfully created.

Based on the analysis of the results described above, gene-silenced plants TRV: ghMYB102 and TRV:00 were treated with a Verticillium dahliae suspension containing 1.0X10 ⁷ CFU/mL, and after 14 days of treatment, the leaves of TRV:00 plants remained partially green, while the leaf wilting of TRV: ghMYB102 plants was severe (C in FIG. 3). This result indicates that interference down-regulates the GhMYB102 gene reduces cotton tolerance to Verticillium dahliae.

Further statistics of disease indexes and plant ratios of different disease grades are carried out on TRV:00 and TRV: ghMYB102, the disease indexes of the TRV: ghMYB102 are found to be higher than those of a control group TRV:00 (D in fig. 3), and the statistics of the plant ratios of the disease grades indicate that interference down-regulates the GhMYB102 gene, the sensitivity to verticillium wilt is increased, a large number of yellowing and wilting of leaves occur, and the phenomenon of leaf falling occurs seriously (E in fig. 3). This indicates that silencing of the GhMYB102 gene significantly reduces the ability of cotton to resist verticillium wilt.

In order to further analyze the infection condition of the interference plant verticillium dahliae, longitudinal cutting observation of stems is carried out, the stem blackening degree in the GhMYB102 downregulated material after the infection of the verticillium dahliae 14 d is serious (A in fig. 4), and colony quantification and colony recovery experiments show that the colony quantity of the GhMYB102 interference material is higher than that of a control group (B and C in fig. 4), and the plants with higher morbidity level occupy higher levels, thus indicating that the silent plants are more susceptible. Colony quantification was performed briefly as follows, with primers first designed:

Ve-ITS1-F：5'- AAAGTTTTAATGGTTCGCTAAGA-3'；

ST-VE1-R：5'- CTTGGTCATTTAGAGGAAGTAA-3'；

GhUBQ7-F：5'- GAAGGCATTCCACCTGACCAAC-3'；

GhUBQ7-R：5'- CTTGACCTTCTTCTTCTTGTGCTTG-3'；

Taking DNA of cotton stems as a template, carrying out qRT-PCR amplification by using a upland cotton reference gene UBQ7 of verticillium dahliae (Ve-ITS 1-F/ST-VE 1-R), and calculating a relative expression quantity of the obtained Ct value by using a delta Ct method, wherein the calculation formula is as follows: 2- Δct=2- (experimental Ct-control Ct).

Example 4 detection of expression level of GhMYB 102-silenced Cotton plants in lignin Synthesis pathway Gene

Further, we detected the expression level (qRT-PCR) of related genes in lignin synthesis pathways in cotton plants silenced with GhMYB102, and found that the expression levels of genes PAL1, C4H1 and CAD3 in lignin synthesis pathways were down-regulated, demonstrating that GhMYB102 may affect cotton resistance to verticillium dahliae by modulating the expression of lignin synthesis pathway genes (fig. 5).

Example 5 overexpression of Arabidopsis thaliana verifies the function of the GhMYB102 gene in Arabidopsis thaliana for verticillium resistance

To further analyze the function of GhMYB102, the inventors constructed an overexpression vector p35S-GhMYB102-GFP of GhMYB102, and obtained an overexpression Arabidopsis plant. The specific procedure is briefly described as follows.

First, primers with restriction enzyme XbaI and KpnI cleavage sites were designed, and the sequences were as follows:

F：5' - GGTCTAGAATGGGGAGAACACCT-3'；

R：5' - GGCGGTACCACGTGGGAGTTTG -3'；

Thirdly, double digestion is carried out on the p35S-1300-GFP vector by adopting XbaI and KpnI, and the digested products are purified;

fourthly, carrying out enzyme-linked connection on the PCR amplification product and the enzyme-cleaved vector to construct a p 35S-1300-GhMYB 102 overexpression vector;

Fifthly, converting the connection product into escherichia coli DH5 alpha by adopting a heat shock conversion method, carrying out K+ (kanamycin, 50 mug/mL) resistance screening, selecting positive colonies for PCR detection, carrying out sequencing on correct colonies identified by the PCR detection, and extracting plasmids from bacterial liquid with correct sequencing for later use;

Seventh, wild type Arabidopsis thaliana (Clo-0, WT) is transformed by means of Agrobacterium inflorescence infection, the harvested seeds are screened on MS medium containing hygromycin, the seeds are harvested for individual plants of the potential transgenic plants, and the seeds are screened again on medium containing hygromycin until T3 generation screening to obtain the potential homozygous transgenic plants.

To further analyze whether GhMYB102 is involved in regulating the process of combating verticillium wilt, we infected WT, root of arabidopsis thaliana seedlings overexpressing GhMYB102, respectively, with verticillium dahliae suspension (1.0 x 10 ⁷ CFU/mL) 5 min, then transplanted in a nutrition pot, placed in a 12h light/12 h dark greenhouse (21 ℃) and photographed after the onset of arabidopsis thaliana and counted the disease index and the extent of onset (fig. 6 a).

The results show that the disease grade (from low to high, respectively grade 0, grade 1, grade 2, grade 3, grade 4) and disease index of the over-expressed arabidopsis seedlings after infection with verticillium dahliae 21 d are obviously lower than that of WT, the disease indexes are respectively 20%,30% and 35%, and the disease index of WT is more than 50% (B in fig. 6); in the different disease level statistics, the over-expressed 3 lines were found to have higher disease level plants than the wild type control group WT, and the low disease level plants were found to have higher disease level than the wild type control group WT (C in fig. 6).

In conclusion, after the GhMYB102 gene is silenced, the verticillium resistance of the cotton is reduced, which indicates that the GhMYB102 gene positively regulates the resistance of the cotton to verticillium; and after the arabidopsis is over-expressed, the verticillium wilt tolerance of the arabidopsis is improved, and the application also shows that the GhMYB102 gene positively regulates the verticillium wilt resistance of the arabidopsis. The expression level of lignin synthesis pathway gene GhMYB102 silencing material is reduced. Therefore, the GhMYB102 gene plays an important role in regulating and controlling plant verticillium wilt resistance in a lignin synthesis way, and has important significance for cultivating cotton varieties resistant to verticillium wilt.

The above-mentioned embodiments are merely preferred embodiments of the present invention, which are not intended to limit the scope of the present invention, and other embodiments can be easily made by those skilled in the art through substitution or modification according to the technical disclosure in the present specification, so that all changes and modifications made in the principle of the present invention shall be included in the scope of the present invention.

Claims

The application of the GhMYB102 gene in improving the verticillium wilt resistance of plants is characterized in that a transgenic plant with enhanced verticillium wilt resistance is obtained by constructing an overexpression vector of the GhMYB102 gene, the nucleotide sequence of the GhMYB102 gene is shown as SEQ ID NO.1, the plant is cotton or Arabidopsis thaliana, and the verticillium dahliae is a pathogenic bacterium of verticillium dahliae.
2. The use according to claim 1, characterized in that the verticillium resistance is expressed as: under the invasion of verticillium dahliae, the disease index and the disease grade of the GhMYB102 gene overexpression strain are lower than those of a wild type strain.
The application of the GhMYB102 gene in improving the resistance of plants to verticillium dahliae is characterized in that a transgenic plant with enhanced resistance to verticillium dahliae is obtained by constructing an overexpression vector of the GhMYB102 gene, the nucleotide sequence of the GhMYB102 gene is shown as SEQ ID NO.1, and the plant is cotton or Arabidopsis thaliana.
4. A plant breeding method, characterized in that the method is to obtain a plant with verticillium resistance or verticillium dahliae resistance higher than that of a target plant by over-expressing GhMYB102 gene in the target plant; the nucleotide sequence of the GhMYB102 gene is shown as SEQ ID NO.1, and the target plant is cotton or Arabidopsis thaliana.