CN1184156A - Phytase and the clone and expression of its gene - Google Patents

Abstract

The present invention provides one kind of high specific activity phytase and the aspergillus niger strain CGMCC0332 to express the phytase. Through the clone and gene reformation to its code gene, expression carrier is constituted, receptor strain is converted, and the method of producing large amount of phytase through high-density fermentation of recombined yeast is set up. Inside recombined yeast, the expression amount of phytase may reach 500,000 u each ml of fermentation liquid. The recombined yeast capable of high-effectively expressing phytase is used in producing food phytase in large industrial scale, and the thallus after fermentation is used as excellent single cell food protein.

Description

The clone of phytase and gene thereof and expression

The present invention relates to the clone of a kind of phytase and gene thereof and the method for expression.The present invention also relates to produce the bacterial strain of this phytase.

Phosphorus is the important minerals that a kind of all growth of animal all need.Phosphorus account for animal body mineral substance total amount 1/4th more than, wherein 80% phosphorus is present in the skeleton with the form of hydroxylapatite.Bone is not only as the skeleton of health, and is the depots of calcium, phosphorus and other mineral substance, and they can be mobilized in other tissue when needs.20% phosphorus in addition is present in muscle, blood and other cartilaginous tissue.They are as the moiety of many organic compound, participate in the body the almost required biochemical reactions of each life.Because phosphorus has so important biological function, is very important so competent phosphorus is provided in the animal daily ration.Otherwise the growth of tissue is suppressed, the bone deliquescing becomes fragile, long-term phosphorus shortage can cause the growing rickets of animal and the osteoporosis of adult animals, thus influence the growth of animal.

At present be that interpolation inorganic phosphorus such as secondary calcium phosphate satisfy the demand of animal to phosphorus in feeds such as monogastric animal such as chicken, pig.But in mainly based on the animal daily ration of plant feed, itself just contain abundant phosphorus, only because they mainly exist with the form of the unavailable phytate phosphorus of animal.

Phytate phosphorus is a cereal, the basic storage form of phosphorus and inositol in the crop grain such as beans and oil plant, content is up to 1-5% (Lolas M.Et al.Food Sci.42:1094-1097,1977). it accounts for 60-80% (the Nelson T.S.Poultry Sci.47:862-871 of total phosphorus in the plant, 1967). but but be difficult to be utilized (Cromwell G.L.Biotechnology in the Feed Industry with the phosphorus that the phytate phosphorus form exists because of lacking the enzyme that can decompose phytic acid in the monogastric animal body, Lyons T.P.ed.Alltech Technical Publication, Nicholasville, KY, 133-145), its utilization ratio is only at 0-40%.

Phytate phosphorus can not effectively be utilized by the simple stomach animal, thereby has caused many problems in the process of feeding, and first, cause phosphorus source waste.Phosphorus source in the feed can not be utilized effectively on the one hand, in order to satisfy the demand of animal to phosphorus, must additionally add inorganic phosphorus in feed again on the other hand, has improved feed cost.In actual production, also often there are elements such as fluorine, heavy metal to cause animal to poison when adding inorganic phosphorus because of residual in the inorganic phosphorus.The second, form high phosphorus ight soil and contaminate environment.About 85% phytate phosphorus can directly be excreted by animal in the feed, and a large amount of phosphorus makes water and soil earth be subjected to severe contamination in the ight soil.Present many European countries such as Holland etc. therefore problem begin to limit the breed quantity of livestock and poultry.China is herding big producing country, and monogastric animal accounts for the ratio of livestock and poultry sum far above western countries, therefore, prevents that phosphorus from having more special meaning to the pollution of environment in China.Three, phytate phosphorus still is a kind of antinutritional factor, and it is in the meeting and multiple configuration metal ions Zn in the process of digesting and assimilating of animal intestine gastropore ²⁺, Ca ²⁺, Cu ²⁺, Fe ²⁺Deng and the protein chelating become corresponding insoluble mixture, thereby reduced the effective utilization (Sharma C.B.et al., and Phytochemistry.17:201-204,1978) of animal to these nutritive elements.

Phytase (EC.3.1.3.8) is a kind of enzyme of energy hydrolysis phytic acid.It can be degraded to phytate phosphorus inositol and phosphoric acid.Phytase extensively is present in the microorganism, as subtilis (Paver, V.K.J., Bacteriol.151:1102-1108,1982), false monospore bacillus (Cosgrove D.J., Austral.J.Biol.Sci.23:1207-1220,1970), lactobacillus (Shirai K., Letters Appl.Biol.Sci.19:366-369,1994), intestinal bacteria (Greiner R., Arch Biochem.Biophys.303:107-113,1993), yeast (Nayini N.R.et al.Lebensm Wiss.Technol.17:24-26,1984), aspergillus (Yamada K.et al.Agric.Biol.Chem.32:1275-1282,1986; Van Gorcom R.F.M.et al., US Patent No.5436156,1995).Wherein derive from phytase (the Van Gorcom R.F.M.et al. of A.ficuum NRRL3135 (A.niger var.awamori), US Patent No.5436156,1995) has better heat-resisting, higher enzymic activity is arranged under acidic conditions, be considered to have most at present the feeding phytase of application prospect.Its optimum pH is 2.5 and 5.5, and optimum temperuture is 55 ℃, and special is 100,000 U/mg zymoproteins than enzymic activity.

The feeding effect of phytase has worldwide obtained conclusive evidence (Ware J.H.et al., USPatent No.3297548,1967; Nelson T.S.et al., J.Nutrition101:1289-1294,1971; Nelson T.S.et al., Poult Sci.47:1842-1848,1968).It can make the utilization ratio of phosphorus in the plant feed improve 60%, and the phosphorus excretion reduces 40% in the ight soil, also can reduce the anti-oxidant action of phytate phosphorus.Therefore significant to improving the livestock industry productivity effect and reducing phytate phosphorus to the pollution of environment.

Though phytase has good feeding effect, but up to the present it also is not used widely on fodder industry, its basic reason is, the expression amount of phytase is too low in natural microbial, thereby be difficult to a large amount of cheap phytase products that obtain, can not satisfy requirement (the Han Y.W. of feed industrial development, Animal Feed Sci.Technol., 24:345-350,1989). along with biotechnology, development of high-tech such as genetically engineered, people recognize by engineered means, utilizing bio-reactor to efficiently express phytase gene is expected to reach and increases substantially phytase output, the purpose that reduces production costs (Conneely O.M., Biotechnology in the Feed Industry, T.P.Lyons (Ed), Alltech Technical Publications.Nicholasville, K Y.57-66,1992).

Several microbe-derived phytase genes have obtained separation, as yeast Saccaromycescerevisiae (Bajwa W., Nucleic Acids Res.12:7721-7739,1984), Aspergillus niger (MacRae W.D., Gene, 71:339-348,1988), A.terreus and Myceliophthora thermophila (van Loon, Patent NO.EP 0684313A2,1995), A.niger (ficuum) (van Hartimgsveldt et al., Gene, 127:87-94,1993; Ehrlich K.C., Biocem.Biophys.Res.Comm.195:53-57,1993), A.niger var.awamori (Piddington C.S.Gene, 133:55-62,1993) etc.

The research of phytase gene expression mainly concentrates on the phytase gene phyA and phyB that derives from A.niger (ficuum).Expressed the phytase gene phyA that comes from A.niger var.awamori as 1993 in A.niger ALK02268, its expression amount has improved several times than former bacterial strain, is about 329U/mL (Piddington C.S., Gene, 127:87-94,1993).The same year, the phy gene that derives from A.ficumm NRRL3135 is led back former bacterial strain, the copy number of phyA gene is increased to more than 15, thereby the expression amount that makes phytase is brought up to 7600U/mL (Van HartingsveldtW.et al., Gene, 127:87-94,1993:Van Gorcom R.F.M.et al, PantentNo.US 5436156,1995).Moore E. etc. express phytase gene that derives from yeast Saccharomyces cerevisiae and the phyB gene that derives from A.niger 762 in A.oryzae, its result makes expression amount bring up to 840U/mL and 750U/mL (Moore E.et al. respectively, J.Ind.Microbiol, 14:396-402,1995).In addition, also once the someone has attempted Expressing Recombinant Phytase gene phyA and phyB (Nevalainen H.K.M.et al. in Trichoderma, Pantent No.Wo 94/03612,1994) and attempted transforming phytase gene and make it have better temperature resistance and in aspergillus niger, express (Van Loon A.Patent No.EP0684313A2,1995) with engineered method.These above expression studies, in general, its expression level is also lower, is difficult to obtain large-tonnage product, and production cost is too high.

One of purpose of the present invention is a kind of natural bacterial strain that produces the high specific acitivity phytase of screening.Simultaneously, the phytase that is produced also has on physio-biochemical characteristics such as optimum pH, optimum temperuture and is suitable for using desired characteristic as additive in feed.

The present invention is (cosgrove according to a conventional method, D.J.et al.Aust.J.Biol.Sci.23:339-343,1970) the natural bacterial strain of aspergillus niger of screening secretion of phytase from soil, further institute's phytase generating is carried out Physiology and biochemistry property research (Vallah A.H.J.Prep.Biochem., 18:459-471,1988).The present invention has filtered out the phytase that has high reactivity and be suitable for using and has produced strains A .niger 963 in feed.

After testing, the ratio work of the phytase PHYA2 that this bacterial strain produced is 1,000 ten thousand U/mg zymoproteins, and the ratio work of the phytase PHYA of report is 100,000 U/mg (Van Gorcom R.F.M.et al., Patent No.US 5436156,1995) at present.One of fundamental characteristics that the phytase that is suitable for using in feed should possess is higher enzymic activity to be arranged, because the main effect place of phytase is in monogastric animal tart stomach (pH1.5-3.5) under acidic conditions.Phytase of the present invention has two pH values the suitableeest, be respectively between the 1.6-2.0 and between the 5.5-5.9, optimum point is about 1.8 and 5.7, and in the entire area of pH1.6 to 5.9, can keep higher enzymic activity, so just more help it and in the animal stomach, work, thereby possessed the good characteristic that in feed, uses.In addition, with reported and applied aspergillus niger phytase PHYA (Van Gorcom R.F.M.et al. has been arranged producing, Patent No.US 5436156,1995) compare, their first enzymes peak alive is respectively pH5.7 and 5.5, be more or less the same, but another optimal pH of PHYA2 is 1.8, and PHYA is 2.5, simultaneously it is 77% during at pH5.7 in the enzymic activity of pH1.8, minimum enzymic activity (at pH3.0) in the scope of pH1.8 to 5.7 also has nearly about 40% residual enzyme activity, and PHYA is respectively 50% and 25% (at pH3.0).From these data, PHYA2 has the characteristic that is more suitable in using in feed than PHYA.Table 1.A.niger 963 and A.niger var.awamori (A.ficuum NRRL3135)

(Van?Gorcom?R.F.M.et?al.，Patent?No.US?5436156，1995)

The similarities and differences enzyme characteristic A.niger 963 A.niger var.awamori of the phytase that is produced

(the present invention) (A.ficuum NRRL3135) specific enzyme activity 1,000 ten thousand U/mg protein 10s ten thousand U/mg protein matter molecular weight 85kD 85/100kD optimum pHs 1.8,5.7 2.5,5.5 optimum temperutures (℃) 55 50/58 potential glycosylation sites, 9 ten amino acid sequence homologies, 91.6% gene order homology 91.8%

The black mold bacterial strain that the present invention filters out (Aspergillus niger) on November 24th, 1997 at China Committee for Culture Collection of Microorganisms common micro-organisms center (No. 13, Zhongguancun N 1st Lane, Beijing City, postcode: 100080) carried out preservation.Preserving number is CGMCC 0332.

Two of purpose of the present invention is phytase encoding genes that this height ratio of separating clone is lived.From A.niger 963, extract genomic dna, by PCR method (Maniatis T., et al.Molecular cloning.New York:Cold Spring harbor laboratory, 1982) angle out phytase gene phyA2, be cloned into then on colibacillary plasmid cloning vector such as pPUC18, the pPGEM etc., and further this gene carried out complete sequence analysis.The DNA complete sequence analysis is the result show, 1506 Nucleotide of phyA2 structure gene total length, 102 nucleotide sequences wherein+46～+ 147 are typical fungi intron sequences, the feature conserved sequence of fungi intron are arranged: Donor sequence-GTATGC, Lariat sequence-GCTGAC and Acceptor sequence-CAG on it.467 amino acid of PhyA2 genes encoding, 19 amino acid of N end are signal peptide, the cleavage site of signal peptide is after+19 Gly.The phytase that derives from aspergillus niger is a glycosylated protein, on the phyA2 amino acid sequence coded, has found 9 potential N-glycosylation sites (Asn-X-Ser/Thr, X are arbitrary amino acid).The theoretical molecular of inferring from amino acid is about 52KD.Also found the avtive spot sequence (Active-site sequence) of phytase: CQVTFAQVLSRHGARYPTDSKGK from the aminoacid sequence, it be positioned at aminoacid sequence+52～+ 74.RHGERYPS is the most conservative sequence in the microbe-derived phytase activity site, and corresponding sequence is RHGARYPT on PHYA2.G+C content reaches 54.7% in the PhyA2 gene, and the G+C content of codon the 3rd bit base is more up to 68.8%, and high frequency use G and C base are one of features that the high expression level albumen coded sequence is had in the aspergillus on codon the 3rd bit base.PhyA2 and the phytase gene phyA that derives from Aspergillusniger (ficuum) var.awamori (the Van Gorcom R.F.M.etal. that has reported, Patent No.US 5436156,1995) compare, the difference of 123 Nucleotide is arranged on dna sequence dna, homology is 91.8%.39 amino acid differences are arranged on the amino acid sequence coded, and homology is 91.6%.On the PHYA albumen of phyA coding, 10 potential glycosylation sites are arranged, and on PHYA2, have 9, wherein 8 identical with the position on the PHYA.

The dna sequence dna of phyA2 structure gene and the aminoacid sequence of deriving are as shown in Figure 5.

Three of purpose of the present invention provides a kind of different characteristics at each expression system, and phytase gene is transformed so that the transformation body that it can efficiently express in specific expression system.

The transformation of gene can utilize that technology such as chemosynthesis realizes after known round pcr, site-directed mutagenesis technique, the gene design.In a preferred embodiment of the invention, we are except removing original signal peptide sequence of phytase gene phyA2 and intron, in addition also on molecular level the codon to gene transform.Specifically be the 85th, 146,159 and 466 s' Arg codon CGG and these two kinds codon AGA that few codon (Sharp, P.M.et al.Neucleic) point mutation of using become the yeast high frequency to use in yeast of CGA.Improved dna sequence dna as shown in Figure 8.

Similar thinking can be used to transform phytase gene too and makes its every expression in other expression system, as by the insect expression system of baculovirus, mould expression system, plant expression system etc.

In a solid yardage case of the present invention, improved phytase gene is inserted into (available from Invitrogen) on the Yeast expression carrier that has a-factor signal peptide sequence, behind transformed yeast cell, stable integration is to yeast chromosomal, this recombination yeast is after fermentation culture, and the phytase albumen of expression is secreted in the substratum under the guiding of signal peptide.

After measured, the phytase expression amount reaches 500000U/mL, its expression level is 3000 times of original strain A.niger 963, there has not been the raising of transforming than phyA2 gene 37 times, also up-to-date patent (Van Gorcom R.F.M.et al. than the world, Patent No.US 5436156,1995) expression level of being reported is high by 80%.

Four of purpose of the present invention provides a kind of recombinant expression system that contains improved phytase gene.

Select efficient expression system-P.pastoris as the bio-reactor of expressing phyA2.By reorganization in the body Yeast expression carrier that contains phyA2 is incorporated on the zymic genome, filters out positive recombinant, and on molecular level, verify (Southern blotting, Northernblotting and SDS-PAGE etc.).

The insect expression system of other eukaryotic expression system such as baculovirus, mould expression system, plant expression system etc. also adapt to efficiently expressing of phytase gene therewith.

The host bacterium mould that the patent (Patent No.US 5436156,1995) of the preferred pichia spp of the present invention (P.pastoris) expression system and Van Gorcom R.F.M. etc. is adopted is compared, and pichia spp has the advantage of a lot of aspects.First, the growth and breeding period ratio pichia spp of mould is long a lot, second, the the nourishing and growing of mould is what the elongation growth by the mycelium tip realized, and this growth characteristics especially are fit to solid culture, and and be not suitable for the liquid state fermentation that modern zymotechnique is used always, generally speaking the solid fermentation work efficiency is low, cycle is long, the cost height, and the liquid state fermentation that the cost that obtains the bulk fermentation product is compared will increase a lot.By contrast, pichia spp is by the fragmentation body that has additional nutrients, the very suitable liquid state fermentation of this reproductive characteristic; The 3rd, the mould nourishing body needs to provide enough complicated carbon nitrogen organic nutrients during growing, this also can increase fermentation costs, grow main utilize cheap simple nutrient such as methyl alcohol, glucose and the ammoniacal liquor etc. of pichia spp nourishing body, the nourishing body pichia spp that obtains isodose is wanted considerably cheaper than the nutrient that mould consumes.Zymic high-cell density, low-cost fermentation process are set up (Siegel R.S., Biotechnol.Bioeng, 34:403-404,1989), and employed carbon source, nitrogenous source, salt, trace element and vitamin H etc. are all very cheap in the fermention medium; The 4th, the distinctive musty of mould can reduce the palatability of livestock, and a kind of sauce fragrance that the pichia spp fermentation produces has good food calling effect; The 5th, pichia spp contains the organic compound of multiple a large amount of promotion growth, as oligose, Nucleotide, each seed amino acid, small peptide etc., these advantages all be mould less than or do not have; The 6th, in eukaryotic expression system, yeast comprises that pichia spp studies the most detailedly beyond doubt, and during the conducting molecule biologic operation, yeast is more easier than mould, convenient and effectively.Up to the present, the report that we yet there are no and utilize yeast expression, produce phytase, but yeast successfully efficiently expresses out the exogenous genes products of many biologically actives as a kind of good eukaryotic expression system.Seven, pichia spp itself has good security, the widespread use of Ceng Zuowei single cell protein, do not contain Toxic matter and pyrogen in the yeast culture base, so the phytase of expression of recombinant yeast just can directly add in the feed with the form of yeast culture without separation and purification, can reduce the production cost of phytase; Eight, the phytase of Biao Daing can be secreted under the guiding of signal peptide in the substratum, and this directly comes out phytase and need not broken yeast thalline, also may for the yeast culture that comprises phytase is directly provided as fodder additives; More than these advantages all be to utilize aspergillus niger as phytase expressed receptor (Van Gorcom R.F.M.et al., Patent No.US 5436156,1995) not available, it is laid a good foundation for utilizing recombination yeast large-scale industrialization, low-cost fermentative production phytase.

Five of purpose of the present invention provides a large amount of methods that produce of high density fermentation, phytase albumen of the phytase gene engineering strain of reorganization, for the production of phytase industrial fermentation lays the foundation.

The fermentation process that the present invention provides with reference to Introvigen company uses glucose to mix the sole carbon source in the stage of feeding as feed stage and carbon source-methanol of yeast culture stage, carbon source.Concrete grammar is:

A. inoculation is cultivated, be inoculated in by 5-10% then and comprise among the 3-5% glucose fermentation substratum 10Xbasal salts;

B. aeration-agitation is cultivated, and oxygen saturation is not less than 20% in whole culturing process;

C.18 hour after, according to 1 7-19ml/hr/L, preferred 18.15ml/hr/L, traffic flow add 23-25%, preferred 25%, glucose solution continue to cultivate more than 3 hours preferred 4 hours;

D. according to 4-6ml/hr/L, preferred 5ml/hr/L, traffic flow add 23-27%, preferred 25%, glucose: (3-5: 1-2), preferred (4: 1) continue to cultivate more than 3 hours preferred 5 hours to methanol mixed solution;

E. add inductor methyl alcohol, make the final concentration of methyl alcohol maintain 0.1-0.5%, preferred 0.3%, continue to cultivate more than 3 hours, preferably cultivated 108-132 hour.

With existing be fermentation process (the Van Gorcom R.F.M.et al. that produces bacterial strain with aspergillus, Patent No.US 5436156,1995) compare, on the amount of fermentation raw material, fermentation time and final tunning phytase all different (table 2), on the cost of fermentation raw material, the present invention is cheap industrial raw material entirely, and the aspergillus fermentation time also need have natural organic extractions such as sweet dew-dextran, yeast extract, caseinhydrolysate, thereby the raw materials cost of this project will ferment much lower than aspergillus; This project of fermentation time is 108-132 hour, and the aspergillus fermentation is 140-200 hour, and the present invention also has superiority in the energy consumption during the fermentation.And this project of phytase output (referring to phytase output in the unit volume fermented liquid) of fermentation will exceed about about one times.Add that phytase that the present invention produces need not purifying and can be directly with the situation of yeast culture as additive, thereby generally speaking, the present invention is than external genetically engineered aspergillus phytase generating in next life (the Van Gorcom R.F.M.et al. that uses, USPatent No.5436156,1995) more have superiority.The comparison of fermentative production phytase in table 2. fermentative production phytase of the present invention and the foreign patent

The external aspergillus fermentation of the present invention

(Patent No.US 5436156.1995) fermention medium

Carbon source glycerine or glucose 100g/L sweet dew-macrodex g/L

Methyl alcohol 15% yeast extract 12.5g/L

Nitrogenous source ammoniacal liquor 5% caseinhydrolysate 25g/L inorganic salt phosphoric acid 2% vitriolate of tartar 2.0g/L

Calcium sulfate 0.93g/L sal epsom 0.5g/L

Vitriolate of tartar 18.2g/L ferrous sulfate 0.5g/L

Sal epsom 14.9g/L potassium primary phosphate 2g/L fermentation time (hour) 108-132 140 above phytase productive rates (U/mL) 500,000 28 ten thousand

Those of ordinary skills can carry out various transformations to enzyme of the present invention, as modifying with various chemically modified groups, cut as glycosylation, phosphorylation, the amination of N end, protein endoenzyme etc.; Also can be the transhipment after improving it and expressing and add signal peptide and before or after phytase albumen, add fusogenic peptide etc., and do not change the basic function of enzyme of the present invention, as enzymic activity, substrate specificity etc.The functional deriv that these are commonly referred to as enzyme of the present invention includes within the scope of the invention.

Description of drawings

The transparent circle of clearing up that Fig. 1 Aspergillus niger 963 forms on the dull and stereotyped AS of the screening that contains phytic acid ca

The suitable property of the pH of the phytase PHYA2 that Fig. 2 Aspergillus niger 963 produces

The suitable property of the temperature of the phytase PHYA2 that Fig. 3 Aspergillus niger 963 produces

The clone of Fig. 4 phytase gene phyA2

Fig. 5 phyA2 structure gene dna sequence dna and the aminoacid sequence of deriving

The small letter English alphabet is represented intron sequences, and the sequence of underscore is represented intron donor, lariat and acceptor sequence successively in the intron sequences; Vertical arrows expression signal peptide cleavage site; Expression potential glycosylation site at the amino acid N underscore; The aminoacid sequence underscore is pointed out the phytase activity site sequence.

Removal process signal coding sequence and intron sequences among Fig. 6 phyA2

Codon optimized process is carried out in Fig. 7 phyA2 point mutation

The dna sequence dna of the improved phyA2 of Fig. 8

The physical map of Fig. 9 recombinant yeast expression vector pPIC9A

The Sourthern blotting of Figure 10 recombination yeast analyzes

1. acceptor yeast P.pastoris GS115

2,3,4. be respectively yeast recon P.pastoris

PPIC9A-6,7.9 (the EcoRI enzyme is cut)

5,6,7. be respectively yeast recon P.pastoris

PPIC9A-6,7.9 (BamH I enzyme is cut)

The Northern blotting of Figure 11 recombination yeast analyzes

1. acceptor yeast P.pastoris GS115

2,3. be respectively yeast recon P.pastoris

pPIC9B-12、pPIC9A-7

The SDS-PAGE of Figure 12 recombination yeast analyzes

1. acceptor yeast P.pastoris GS115

2,3. be respectively yeast recon P.pastoris pPIC9A-7,9

4,5. be respectively yeast recon P.pastoris pPIC9A-7,9, expression

Phytase albumen is handled through de-glycosylation

6. molecular weight of albumen Marker

The suitable property of the pH of the phytase that Figure 13 recombination yeast P.pastoris pPIC9A-7 expresses

The suitable property of the temperature of the phytase that Figure 14 recombination yeast P.pastoris pPIC9A-7 expresses

Figure 15 is recombination yeast phytase expression amount and inducing culture time relation on the shaking table level

●P.pastoris?pPIC9A-7；▲P.pastoris?pPIC9A-9

The accumulation of Figure 16 recombination yeast expression product phytase in different high cell density fermentation methods and the relation of induction time

■ is that carbon source, glycerine feeds with glycerine zero is that carbon source, glycerine-methanol mixed are fed with glycerine ● be that carbon source, glucose-methanol mixed are fed with glucose

Four, embodiment

1. bacterial strain and carrier coli strain E.coli DH _5a, plasmid pUC18 etc. is available from Promega company, yeast strain Pichia pastoris GS115 (His ^-Mut ⁺), plasmid pPIC9 is so kind as to give by Canadian Alberta doctor D.Luo of university.

2. enzyme and test kit restriction enzyme, ligase enzyme, Taq enzyme, Mung bean enzyme are Boehringer company product.T ₇DNA sequence kit purchases the company in Pharmacia.In vitromutagenesis systems Kit, random primer labelling Kit and PCR Kit all purchase the company in Promega.

3. biochemical reagents DNA synthetic agent is a Milipore company product.Primer is synthetic with the ABI Cyclone of company dna synthesizer.IPTG, X-Gal, SDS and sodium phytate are Sigma company product.TEMED, ammonium persulphate, acrylamide and methylene diacrylamide are Promega company product.

4. substratum aspergillus niger growth medium is PDA (20% potato, 2% sucrose, 2% agar); It is AS (0.1% phytic acid ca, 3% glucose, 0.5%NH that aspergillus niger produces the enzyme screening culture medium ₄NO ₃, 0.05%KCl, 0.05%MgSO ₄.7H ₂O, 0.03%MnSO ₄.4H ₂O, 0.03%FeSO ₄.7H ₂O, 1.5% agar, pH 5.7); It is AP (1.5% glucose, 0.3% peptone, 0.2% (NH that aspergillus niger produces the enzyme substratum ₄) ₂SO ₄, 0.05%MgSO ₄.7H ₂O, 0.05%KCl, 0.003%FeSO ₄.7H ₂O, 0.003%MnSO ₄.4H ₂O, pH5.7).The intestinal bacteria substratum be LB (1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0).The yeast perfect medium is YPD (1% yeast extract, 2% peptone, 2% glucose); The yeast conversion substratum is RDB[18.6% sorbyl alcohol, 2% glucose, 1.34%YeastNitrogen Base W/O amino acids (YNB), 0.00004%Biotin, 0.005% L-glutamic acid, 0.005% methionine(Met), 0.005% Methionin, 0.005% leucine, 0.005% Isoleucine, 2% agarose)]; It is MM (1.34%YNB, 0.00004%Biotin, 0.5% methyl alcohol, 1.5% agarose) and MD (1.34%YNB, 0.00004%Biotin, 2% glucose, 1.5% agarose) that yeast is selected substratum; Yeast inducing culture BMGY[1% yeast extract, 2% peptone, 1.34%YNB, 0.00004%Biotin, 1% glycerine (V/V)] and BMMY (replace glycerine divided by 0.5% methyl alcohol, all the other compositions are identical with BMGY).The recombination yeast fermention medium is 10 * Basal Salts (2.67% phosphoric acid, 0.093% calcium sulfate, 1.82% vitriolate of tartar, 1.49% sal epsom, 0.413% potassium hydroxide, 4% glycerine or a glucose); Used trace salt solution PTM1 (0.6% copper sulfate, 0.008% sodium iodide, 0.3% manganous sulfate, 0.02% Sodium orthomolybdate, 0.002% boric acid, 0.05% cobalt chloride, 2% zinc chloride, 6.5% ferrous sulfate, 0.025% vitamin H, 0.5% sulfuric acid) in the fermentation.

The screening that embodiment 1 produces the natural bacterial strain of phytase

Coat after soil sample is diluted routinely on the PDA flat board, cultivated 3-5 days for 28 ℃, treat that bacterium colony occurs after, picking colony is transferred on the dull and stereotyped AS of screening, cultivates 3 days for 28 ℃.The bacterial strain that can produce the justacrine phytase will decompose the insoluble phytic acid ca of screening in the flat board, forms the transparent circle of clearing up.Picking produces the transparent inoculation of clearing up circle and produces among the enzyme culture medium A P in 5mL liquid, and 28 ℃ of shakes were cultivated 2 days, is transferred in the 50mL product enzyme substratum by 1% inoculum size and continues to cultivate 3 days.Elimination thalline, supernatant liquor are used for carrying out enzyme activity determination.Measuring method is: the enzyme diluent of 0.2mL adds the sodium phytate of 0.8mL 1.25mmol/L, and 37 ℃ of insulation 30min add 1mL 10%TCA and stop enzyme reaction alive, add 2mL ferrous sulfate-ammonium molybdate colour developing liquid then, and 700nm measures content of inorganic phosphorus.Contrast makes enzyme-deactivating for add 1mTCA earlier in the enzyme diluent of 0.2mL, adds the substrate insulation with volume again.A unit of enzyme activity (U) is defined as: under certain condition, it is a unit of enzyme activity that per minute discharges the required enzyme amount of 1nmol inorganic phosphorus.Because the phytase that is suitable for using in feed must possess and have this characteristic of enzymatic activity high under acidic conditions, so at first under acidic conditions, measure bacterial strain excretory phytase activity, be the HCl-glycine buffer preparation of sodium phytate, enzymatic reaction is finished in the buffer system of pH2.5 with pH2.5.The enzymatic activity high that measures with this understanding is 70U/mL, and it produces bacterial strain through being accredited as aspergillus niger Aspergillus niger, names to be Aspergillus niger 963.The phytase PHYA2 that Aspergillus niger963 is produced further carries out the mensuration that pH fits property and the suitable property of temperature.The suitable property of pH be determined as the substrate sodium phytate with the damping fluid of a series of different pH values (pHl.4,1.8,2.4,3.0,3.4 HCl-Gly damping fluid; PH4.0,4.4,5.0,5.4,5.6,5.8,6.0 HAc-NaAc damping fluid; PH7.2,8.0,9.0 Tris-HCl damping fluid) preparation, measure enzymic activitys down for 37 ℃.Result (Fig. 2) shows that its optimal pH has two, is respectively 1.8 and 5.7.In the scope of pH1.8～5.7, phytase all has higher enzymic activity.Enzymatic reaction is incubated the phytase phyA2 that is measured under pH5.5, differing temps the suitable property (Fig. 3) of temperature shows that its optimum temperuture is 55 ℃.The phytase expression amount that measures under 37 ℃, the condition of pH5.7 is 100U/mL, and phytase absolute activity (specific activity) is 1,000 ten thousand U/mg albumen.Above result shows that phytase PHYA2 has enzymatic activity high under acidic conditions, has the good characteristic that is suitable for using in feed.

Embodiment 2 clone's phytase gene phyA2

Neutral cracking process is adopted in the extraction of strains A .niger 963 total DNA, and strain culturing was collected mycelia after 5 days, with the liquid nitrogen freezing mycelia and grind to form powdery, add 10mL SDS-TE damping fluid (4%SDS, 10mmol/LTris, 0.1mmol/LEDTA in the 10mg mycelia, pH8.0) cracking 5min at room temperature, with isopyknic phenol, phenol-chloroform, chloroform extracting successively, ethanol sedimentation.According to the different phytase gene sequences of having reported that derive from aspergillus niger, design synthetic pcr primer thing P1 and P2:P1:5 ' GCGAATTCTTTCTTCTCATAGGC 3 ' P2:5 ' CTGAATTCATCAAGGTAGTTCAG 3 ' these two sections primer sequences all design outside the phytase structural gene sequence, and the restriction enzyme site that designs on the primer is EcoRI.Genomic dna with Aspergillus niger 963 is that template is carried out pcr amplification, and reaction parameter is: 94 ℃ of sex change 1min, 55 ℃ of annealing 45sec, 72 ℃ of extension 1min; Back 72 ℃ of insulation 10min are taken turns in circulation 30.The dna segment of the about 1.5Kb that amplifies is cut the back with the EcoRI enzyme and is reclaimed the purpose segment by agarose gel electrophoresis, be connected in 15 ℃ with the carrier pUC18 that cuts through the EcoRI enzyme and spend the night, transformed into escherichia coli E.coliDH5a selects positive recombinant behind the coated plate, obtain recombinant plasmid pYY-1 (Fig. 4).By the DNA complete sequence analysis, measured the global DNA sequence (Fig. 5) of phytase gene.1506 Nucleotide of phyA2 structure gene total length, 102 nucleotide sequences wherein+46～+ 147 are typical fungi intron sequences, the feature conserved sequence of fungi intron are arranged: Donor sequence-GTATGC, Lariat sequence-GCTGAC and Acceptor sequence-CAG on it.467 amino acid of PhyA2 genes encoding infer that according to the tactical rule of signal peptide sequence 19 amino acid of N end are signal peptide, and the cleavage site of signal peptide is after+19 Gly.The phytase that derives from aspergillus niger is a glycosylated protein, on the phyA2 amino acid sequence coded, has found 9 potential N-glycosylation sites (Asn-X-Ser/Thr, X are arbitrary amino acid).The theoretical molecular of inferring from amino acid is about 52KD.Also found the avtive spot sequence (Active-site sequence) of phytase: CQVTFAQVLSRHGARYPTDSKGK from the aminoacid sequence, it be positioned at aminoacid sequence+52～+ 74.RHGERYPS is the most conservative sequence in the microbe-derived phytase activity site, and corresponding sequence is RHGARYPT on PHYA2.

G+C content reaches 54.7% in the PhyA2 gene, and the G+C content of codon the 3rd bit base is more up to 68.8%, and high frequency use G and C base are one of features that the high expression level albumen coded sequence is had in the aspergillus on codon the 3rd bit base.

The transformation of embodiment 3 phytase gene phyA2

For make phyA2 can be in yeast heterogenous expression smoothly, we have at first removed signal coding sequence and intron sequences among the phyA2, concrete grammar is, the oligonucleotide segment P3 (5 ' GCGAATTCATGCTGGCAGTCCC 3 ') of synthetic 22 bases of the nucleotide sequence after the contrast signal peptide-coding sequence is as the PCR primer, and another primer (5 ' TCGAATTCTAAGCAAAAC 3 ') is synthetic with reference to the 3 ' terminal sequence of phyA2.Because intron sequences is included among the signal coding sequence, so be exactly the complete phytase structural gene coding sequence of removing signal coding sequence and intron sequences to the phyA2 gene that the method for primer by PCR increases with this.The method of PCR reaction is with example 3.The dna segment that amplifies is inserted on the EcoRI site of carrier pUC18 after cutting with the EcoRI enzyme that designs on the primer, screens positive recombinant behind the transformed into escherichia coli.So just the phyA2 gene clone of no signal peptide encoding sequence and intron sequences has been arrived on the pUC18, obtained recombinant plasmid pYY-2 (Fig. 6).

For PhyA2 can be efficiently expressed in yeast, we further are optimized according to the codon that the selection of yeast codon is partial to phyA2.We find in the phyA2 sequence, the codon of the 85th and 446 Arg of encoding is CGG, the codon of the 146th and 159 Arg of encoding is CGA, these two kinds of codons frequency of utilization in the protein gene of yeast great expression is zero, in order to improve the expression level of phyA2 gene in yeast, we have been undertaken codon optimized by the method for point mutation, these two kinds of codon mutations are become the Arg codon AGA (frequency of utilization is 86.6%) of yeast high frequency use.Concrete grammar (Fig. 7) is, at first according to synthetic 4 sections corresponding mutant primers: the a1:5 ' GAGCGAGATATCC 3 ' in 4 sites of need sudden change; A2:5 ' ACCAGAGATACG 3 '; A3:5 ' TCATCAGATCCT 3 '; A4:5 ' GTACGAGAGATAG 3 '.The site design that suddenlys change needs the sequence of both sides, mutational site in full accord in the centre of primer in the sequence of both sides and the gene.(In vitromutagenesis systems Kit, the Promega) explanation in is carried out point mutation one by one with corresponding mutant primer according to point mutation Kit then.Confirmed that by sequential analysis this gene has obtained correct sudden change.The mutant plasmid that obtains is at last named and is pYY-6.

See Fig. 8 through above improved phyA2 sequence of two steps.

The structure of embodiment 4phyA2 on Yeast expression carrier

The plasmid that is used to make up Yeast expression carrier is pPIC9 (having α-factor secretion signal).At first phytase gene is inserted into the downstream of the signal peptide sequence of above-mentioned expression vector, form correct reading frame with signal peptide, make the goal gene stable integration to yeast chromosomal by the homologous recombination incident between carrier and the yeast P.pastoris chromogene group then.Concrete process is: will transform the back and after the phytase gene phyA2 that transforms without point mutation goes up enzyme and downcut from plasmid pYY-6 and pYY-2 respectively with EcoRI, electrophoresis reclaims the dna fragmentation of about 1.4Kb, again it is inserted into the EcoRI site on the carrier pPIC9 respectively, has obtained an expression vector-pPIC9A and a pPIC9B (Fig. 9) who is used for yeast conversion.The goal gene that so just will have secretion signal has been cloned into AOX promotor downstream.

Embodiment 5 yeast conversion and screening recombination yeast strain system

The DNA of plasmid pPIC9A and pPIC9B is behind the electric shock transformed yeast cell, and by recombinating in the body, goal gene can be incorporated in the acceptor yeast genes group.Under the condition that exogenous induction material methyl alcohol exists, the AOX1 promotor can start the expression of its downstream gene, and signal peptide can instruct expression product to enter the zymic Secretory Pathway, through cutting, the foreign protein product is finally secreted to born of the same parents, and phytase PHYA2 aminoacid sequence that is produced and naturally occurring ripe phytase are identical.Foreign protein can carry out posttranslational modification through such pathways metabolism, for example glycosylation, forms disulfide linkage etc., thereby obtains the protein product of biologically active.

At first with 2～3 times of excessive restriction endonuclease Bg1II difference digested plasmid pPIC9A and the DNA (through PEG method purifying) of pPIC9B, whether the electrophoresis detection enzyme is cut complete, makes it linearizing.Use the phenol extracting, ethanol sedimentation, 70% ethanol washes twice, lyophilize, the sterilized water dissolving ,-20 ℃ of preservations are standby.

Yeast strain GS115 is inoculated in 30 ℃ of overnight incubation among the 5mLYPD, gets 0.5mL and is inoculated in that 30 ℃ of cultivations make O.D. among the 500mLYPD ₆₀₀=1.3～1.5, centrifugal 5 minutes of 1500 * g, as above centrifugal with the sterilized water washing precipitation of 500mL ice precooling, as above centrifugal with the 1mol/l sorbyl alcohol of the 20mL ice precooling precipitation that suspends, with the 1mol/l sorbyl alcohol of the 0.5mL ice precooling precipitation that suspends.Get 40 μ l yeast cell liquid and add linearizing DNA1～5 μ g, transferred in the aseptic electric shock glass of ice precooling ice bath 5 minutes.The transformed yeast recipient bacterium hisGS115 that shocks by electricity on homemade electric shock instrument LN-101, shock parameters is 0.8kv, 11.5 μ F.The 1mol/l sorbyl alcohol that in the electric shock cup, adds the precooling of 0.5mL ice after the electric shock immediately, the solution that will shock by electricity then in the cup is transferred in the aseptic Eppendorf pipe coated plate on the RDB solid medium, every plate is coated with 0.1mL, culture dish is inverted 30 ℃ is cultured to the transformant appearance.Transformant can owing to do not have the yeast replicon in the carrier, could be expressed so the his4 gene must be integrated in the yeast genes group in minimum medium (not containing His) growth.In addition, because the AOX1 gene is damaged in the transformed yeast cells, so it just can not utilize methyl alcohol as carbon source again.Like this, with methyl alcohol as the substratum of sole carbon source on transformant just can not grow (perhaps growth is extremely slow), show as methyl alcohol and utilize defective type (Mut ^-).

Go up picking His with aseptic toothpick from transforming flat board ⁺Recon at first is inoculated on the MM solid medium, is being inoculated on the MD solid medium, so picking His ⁺Recon was cultivated 2 days for 30 ℃.Searching is at clone's normal but that some growth is arranged on the MM flat board or do not grow fully of growing on the MD flat board.

In order to screen the restructuring yeast strains that obtains high expression level, directly detect the expression of phytase in the inducing culture.With His ⁺Mut ^-Transformant is at first cultivated in BMGY substratum (is carbon source with glycerine), treats that it grows to state of saturation, removes BMGY, changes to inducing culture BMMY (with methyl alcohol as inductor), gets supernatant liquor after 36 hours at inducing culture and carries out the phytase activity analysis.By the enzyme assay of Expressing Recombinant Phytase, preliminary screening is named the pPIC9A-6 into P.Pastoris respectively, 7,9 to the recon of 3 plant height horizontal expression phytases from the recombination yeast that phyA2 obtains after sudden change is transformed.PhyA2 names respectively without three the highest strains of the resulting recon expression amount of transformation and is P.PastorispPIC9B-4,12,16.

Embodiment 6

Confirming the reorganization of phytase gene in yeast on the molecular level, transcribing and translate

The methyl alcohol of restructuring yeast strains utilizes defective type explanation foreign gene accurately to be incorporated into AOX1 gene locus in the yeast genes group, thereby has destroyed the function of this gene.Also confirmed this point by Molecular Detection.Method by enzymolysis is destroyed the zymic cell walls, just can obtain purer pastoris genomic dna through further purification process again thereby discharge chromosomal DNA with SDS destruction cytolemma again.Get that 5 μ g recombination yeast genomic dnas carry out EcoRI and the BamHI holoenzyme is separated, enzymolysis product carries out 0.8% agarose gel electrophoresis, the DNA in the gel is transferred to carry out Southrenblotting on the nylon membrane and analyze.Hybridize the phytase gene segment that be about 1.0Kb of used probe for downcutting from recombinant plasmid pYY-1 with BamHI.The probe enzyme is cut rear electrophoresis and is reclaimed, with random primer labelling Kit label probe.Result (Figure 10) shows, after different recon (P.pastoris pPIC9A-6,7,9) DNA cuts with the EcoRI enzyme at phyA2 gene two ends, the phyA2 gene specific hybridization band that one total length is arranged at the 1.4kb place, this proof phyA2 gene has been incorporated in the yeast genes group.After cutting with the intragenic BamH1 enzyme of phyA2, exogenous origin gene integrator different hybrid belts can occur to the different loci in the yeast genes group, and the result shows, recombination yeast P.pastoris pPIC9A-6, in 7,9, the copy number of phytase gene is respectively 1,2,1.

Broken yeast cell extracts yeast mRNA, gets 5 μ g zymic mRNA and carries out the denaturing formaldehyde gel electrophoresis, the mRNA on the gel is inhaled to print to carry out Northern blotting analysis on the nylon membrane.Used probe is identical with the probe that Southren blotting analyzes use.Result (Figure 11) shows no matter whether phyA2 is through transforming, and the phytase gene in the recombination yeast has obtained transcribing normally.

The inducing culture liquid of getting 3 μ L and do not have thalline carries out SDS-PAGE and analyzes (acrylamide: methylene diacrylamide is 29: 1).Used resolving gel concentration is 8%, and concentrated gum concentration is 5%.Electrophoresis finishes the back gel with Coomassie brilliant blue R250 dyeing 30 minutes, follows the glacial acetic acid decolouring with 10%.Result (Figure 12) shows, the phytase molecule amount size of expressing is about 85kD, after handling with EndoH (Endo-β-N-acetylglycosaminidase H) desugar base, molecular weight is reduced to about 64kD, this proof phytase gene has not only obtained expression, effectively secretion, and expression product can also carry out modification-glycosylation behind the protein translation, and glycosylation modified also to be that phytase possesses the normal enzyme activity necessary.

The property analysis of the phytase of embodiment 7 expression of recombinant yeast

30 ℃ of of inducing culture of recombination yeast are after 36 hours, 37 ℃ of under, the condition of pH5.5, the nutrient solution that contains expression product is carried out phytase activity mensuration, result's (table 2) shows, 1) the expressed enzyme amount of different transformant difference to some extent, three recon P.pastoris pPIC9A-6,7,9 are respectively 13488U/mL, 15656U/mL, 14656U/mL, the copy number A.niger 963 100 1Host P.Pastoris that phytase expression recon phytase activity (U/mL) is integrated in the higher 37 times without what transform than phytase gene.This has proved that fully we are successful to the transformation of phytase gene. table 2. yeast recons--P.pastoris pPIC9A-6 13488 1P.pastoris pPICgA-7 15656 2P.pastoris pPIC9A-9 14636 1P.pastoris pPIC9B-4 372 2P.pastoris pPIC9B-12 420 1P.pastoris pPIC9B-16 351 1

Enzyme assay result (Figure 13) to the phytase of expressing under 37 ℃, different pH value shows, the optimum pH of the phytase of expressing has two, be respectively 1.8 and 5.7, in the pH of pH1.8～5.7 scope, the phytase of expression all can be kept higher enzymic activity.Enzyme assay result (Figure 14) under pH5.5, differing temps shows that the optimum temperuture of phytase is 55 ℃.The optimal pH of Expressing Recombinant Phytase is compared not significant difference with optimum temperuture with the phytase that former strains A .niger 963 is produced.

For expression amount and the inducing culture time relation of studying the recombination yeast phytase, yeast recon P.pastoris pPIC9A-7 and 9 got the 1mL nutrient solution every 12 hours and is used to measure phytase activity behind inducing culture, studies show that (Figure 15), within inducing culture 36 hours, the phytase of expressing increases with the prolongation of induction time, peak during by 36 hours, increase the abduction delivering time again, the expression amount of phytase only slowly increases.

Embodiment 8 recombination yeasts are at 5 liters of fermentor tank middle-high density fermentative production phytases

Recombination yeast 30 ℃ of shaking tables in the BMGY substratum were cultivated 24 hours, were inoculated in by 5-10% then to begin fermentation in the fermention medium.The present invention has explored three kinds of fermentation process, and first kind is to be the fermentation process that carbon source, glycerine are fed and cultivated with glycerine, specific as follows: 1) the strain culturing stage.Adding earlier before the fermention medium inoculation as 28% ammoniacal liquor makes the pH of substratum reach 5.0 (ammoniacal liquor is simultaneously also as the nitrogenous source of strain growth), add 4.37mL PTM1 by every liter of substratum again, 5-10% inoculates seed liquor, aeration-agitation was cultivated 18-24 hour, in culturing process along with the growth of bacterial strain, dissolved oxygen amount in the substratum will reduce gradually by 100%, and dissolved oxygen amount will be increased to more than 80% once again after carbon source runs out of, and the thalline weight in wet base will reach 110g/L this moment.2) carbon source is fed the stage.Stream adds 50% glycerine (comprising 12mL/L PTM1), and the stream dosage is 18.15/hr/L, cultivates 4 hours.Adjusting air flow makes dissolved oxygen amount all the time greater than 20%.The thalline weight in wet base will reach 220g/L this moment.3) the abduction delivering stage.Add as methyl alcohol (containing 12mL/L PTM1), make the methyl alcohol final concentration maintain 0.3%, dissolved oxygen amount is all the time greater than 20%.The accumulation volume of the phytase of expressing is once measured in sampling in per 12 hours in inducing process.Second method is for glycerine being the method that carbon source, carbon source-methanol mixing are fed.Be specially after second step of first method is to finish in the carbon source stage of feeding, increase carbon source-methanol and mix and feed the stage, promptly stream adds 50% glycerine: methyl alcohol (4: 1) was cultivated 4 hours, and the stream dosage is 5mL/hr/L, controlled dissolved oxygen amount all the time greater than 20%.Then enter the methanol induction stage again.The third method is for glucose being the method that carbon source, carbon source-methanol mixing are fed.Except carbon source glycerine is changed into the glucose, all the other and second method are identical.These three kinds of methods are seen Figure 16 to the influence of the expression of phytase.The expression amount of three kinds of method phytases is for all reaching 500,000 U/mL fermented liquids, but first kind of fermentation inducement time needs 200 hours, second and third kind method can make the inducing culture time shorten to 108-120 hour, like this, the meeting of shortening significantly of fermentation time reduces the fermentation energy consumption greatly, reduces production costs.The third method will further reduce the production cost of phytase because of using price much cheap that glucose is carbon source than glycerine.

Claims (16)

1. a phytase is characterized in that its avtive spot sequence is RHGARYPT.

2. according to the described phytase of claim 1, it is characterized in that its optimum pH is pH1.6-2.0 and pH5.5-5.9.

3. according to the described phytase of claim 2, it is characterized in that its optimum pH is about pH1.8 and pH5.7.

4. according to the described phytase of claim 1, it is characterized in that its maximum activity is 1,000 ten thousand U/mg, the enzymic activity when pH1.8 is 77% a residual enzyme activity when pH5.7, and the minimum enzymic activity in the scope of pH1.8 to 5.7 is 40% residual enzyme activity.

5. according to the described phytase of claim 1, it results from Aspergillus niger strain CGMCC 0332.

6.1,：M G V S A V L L P L Y L L S G V T S 18G L A V P A S R N Q S T C D T V D Q 36G Y Q C F S E T S H L W G Q Y A P F 54F S L A N K S A I S P D V P A G C Q 72V T F A Q V L S R H G A R Y P T D S 90K G K K Y S A L I E E I Q Q N A T T 108F K E K Y A F L K T Y N Y S L G A D 126D L T P F G E Q E L V N S G V K F Y 144Q R Y E S L T R N I V P F I R S S G 162S S R V I A S G N K F I E G Y Q S T 180K L K D P R A Q P G H S S P K I D V 198V I S E A S T S N N T L D P G T C T 216V S E D N E L A D D F E A N F T A T 234F V P S I R Q S L E N N L S G V A L 252T D T E V T Y L M D L C S F D T I S 270T S T V D T K L S P F C D L F T H E 288K W I N Y D Y L Q S L N K Y Y G H G 306A G N P L G P T Q G V C Y A N E L I 324S R L T H S P V H D Y T S S N H I L 342D S S Q D T F P L N S T L Y A D F S 360L N N G I I S I L F A W G L N K G T 378K P L S S T T A E N I T Q T D G F S 396S A W T V P F A S R M Y V E M M Q C 414Q S E Q E P L V R V L V N D R V V P 432L H G C P V D A L G R C T R D S F V 450K G L S F A R S G G D W A E C F A-467

7. the dna sequence dna of any described phytase among the coding claim 1-6.

8. according to the described dna sequence dna of claim 7, the codon of the Ar9 that it is characterized in that encoding is AGA.

9. according to the described dna sequence dna of claim 7, its nucleotide sequence is as follows:

5＇ 1?ATGCTGGCAG?TCCCCGCCTC?GAGAAATCAG?TCCACTTGCG?ATACGGTCGA?TCAGGGGTAT 61?CAATGCTTCT?CGGAGACTTC?GCATCTTTGG?GGCCAATACG?CGCCGTTCTT?TTCTCTGGCA?121?AACAAATCGG?CCATCTCCCC?TGATGTTCCC?GCCGGATGCC?AAGTCACTTT?CGCTCAGGTT?181?CTCTCCCGCC?ATGGAGCGAG?ATATCCGACC?GACTCCAAGG?GCAAGAAATA?CTCCGCTCTC?241?ATCGAGGAGA?TCCAGCAGAA?CGCGACTACC?TTCAAGGAGA?AATATGCCTT?CCTGAAGACA?301?TACAACTACA?GCCTGGGCGC?GGATGACCTG?ACTCCCTTTG?GAGAGCAGGA?GCTGGTCAAC?361?TCCGGCGTCA?AGTTCTACCA?GAGATACGAG?TCGCTCACAA?GAAACATTGT?TCCGTTCATC?421?AGATCCTCAG?GCTCCAGCCG?CGTGATTGCC?TCTGGCAATA?AATTCATCGA?AGGCTACCAG?481?AGCACTAAGC?TGAAGGATCC?TCGTGCTCAG?CCCGGCCATT?CGTCGCCCAA?GATCGACGTG?541?GTCATTTCAG?AGGCCAGCAC?ATCCAACAAC?ACTCTCGATC?CGGGCACCTG?CACCGTTTCC?601?GAAGATAACG?AATTGGCCGA?TGACTTCGAA?GCCAATTTCA?CCGCCACGTT?CGTCCCTTCC?661?ATTCGTCAAA?GTCTGGAGAA?CAACTTGTCT?GGCGTGGCTC?TCACGGACAC?AGAAGTGACC?721?TACCTCATGG?ACTTGTGCTC?CTTCGACACG?ATCTCCACCA?GCACAGTCGA?CACCAAGCTG?781?TCCCCCTTCT?GTGACCTGTT?CACCCATGAA?AAATGGATCA?ACTACGACTA?CCTCCAGTCC?841?CTGAACAAGT?ACTACGGCCA?TGGCGCAGGT?AACCCGCTCG?GCCCGACCCA?GGGCGTCTGC?901?TACGCGAACG?AGCTCATCTC?CCGTCTCACC?CATTCGCCTG?TCCACGATTA?CACCAGCTCC?961?AACCACATAT?TGGACTCGAG?CCAGGATACT?TTCCCGCTCA?ACTCCACTCT?CTATGCGGAC1021?TTTTCGCTTA?ATAACGGCAT?CATCTCTATC?CTCTTTGCTT?GGGGTCTGAA?CAAGGGCACC1081?AAGCCGCTGT?CTTCCACGAC?CGCGGAGAAT?ATCACCCAGA?CCGATGGGTT?CTCATCTGCC1141?TGGACGGTTC?CTTTCGCGTC?GCGCATGTAC?GTCGAGATGA?TGCAATGCCA?GTCTGAGCAG1201?GAGCCTTTGG?TCCGTGTCTT?GGTTAATGAT?CGCGTTGTTC?CGCTGCATGG?CTGTCCGGTT1261?GATGCTTTGG?GGAGATGTAC?GAGAGATAGC?TTCGTGAAGG?GTTTGAGCTT?TGCCAGATCT1321?GGCGGTGATT?GGGCGGAGTG?TTTTGCTTAG?3＇

10. black-koji mould, preserving number is CGMCC 0332, it is characterized in that the phytase of encoding.

11. a recombinant expression vector is characterized in that it contains the described dna sequence dna of claim 7.

12. according to the described expression vector of claim 11, it is a Yeast expression carrier.

13. contain the transformed yeast cells of the described expression vector of claim 11.

14. the method for a fermentative production phytase comprises:

A. inoculation is cultivated, be inoculated in by 5-10% then and comprise among the 3-5% glucose fermentation substratum 10XBasal salts;

B. aeration-agitation is cultivated, and oxygen saturation is not less than 20% in whole culturing process;

C.18 hour after, the glucose solution that adds 23-25% according to the traffic flow of 17-19ml/hr/L continues to cultivate more than 3 hours;

D. the traffic flow according to 4-6ml/hr/L adds 23-27% glucose: methyl alcohol=3-5: the 1-2 mixing solutions, continue to cultivate more than 3 hours;

E. add inductor methyl alcohol, make the final concentration of methyl alcohol maintain 0.1-0.5%, continue to cultivate more than 3 hours.

15. in accordance with the method for claim 14, it is characterized in that aeration-agitation was cultivated after 18 hours, add 25% glucose solution according to the traffic flow of 18.15ml/hr/L and continue to cultivate 4 hours; Traffic flow according to 5ml/hr/L adds 25% glucose: methyl alcohol=4: 1 mixing solutionss, continue to cultivate 5 hours; Add inductor methyl alcohol, make the final concentration of methyl alcohol maintain 0.3%, continue to cultivate 108-132 hour.

16. a feed is characterized in that it contains the tunning of the described fermentation process of claim 14.

Images