CN118345017A - Mutant strain knocked out by fowl pasteurella multocida hyaluronic acid synthetase and application thereof - Google Patents

Abstract

The invention discloses a mutant strain for knocking out a hyaluronic acid synthase of a pasteurella multocida and application thereof, wherein the mutant strain takes the pasteurella multocida GX-PM as an original strain, and a hyaD-X sequence on a genome of the pasteurella multocida is knocked out, wherein the hyaD-X sequence is a hyaD gene or a certain segment of sequence on a hyaD gene. The strain mhyaD-GX-PM takes fowl Pasteurella multocida GX-PM as an original strain, and two glutamic acids at 247 th and 527 th in the HyaD protein amino acid sequence are mutated into aspartic acid. The avian pasteurella multocida attenuated strain obtained by the invention has good in-vitro growth, genetic stability and safety; wherein mhyaD-GX-PM has good protection effect on acute death caused by infection of the avian Pasteurella multocida, and can be used for preparing attenuated vaccine for preventing the avian Pasteurella multocida.

Description

A mutant strain of hyaluronan synthase knocked out from avian Pasteurella multocida and its application

Technical Field

The invention relates to the field of biotechnology, and in particular to a mutant strain of avian Pasteurella multocida with hyaluronan synthase knocked out and application thereof.

Background technique

Pasteurella multocida is a gram-negative bacterium belonging to the family Pasteurellaceae. Pasteurella multocida can occur in a variety of domestic and wild animals as well as humans, most commonly fowl cholera in poultry, hemorrhagic septicemia and bovine respiratory disease in ruminants, hemorrhagic septicemia and progressive atrophic rhinitis and pneumonia in pigs and rabbits. Fowl cholera is a serious systemic disease that can infect all poultry species, causing huge economic losses to the poultry industry worldwide. In the past, antibiotics were used to prevent and control fowl cholera, but the emergence of resistant strains has made it necessary to limit the use of antibiotics. In addition, vaccination plays an important role in preventing Pasteurella multocida infection. Currently, inactivated vaccines only provide limited protection against homologous serotypes, while live attenuated vaccines may have the risk of reversion to virulence. Therefore, it is necessary to develop new vaccines.

Pasteurella multocida can be divided into five serotypes: A, B, D, E and F. Among them, the serotype of avian Pasteurella multocida is mainly type A. The main component of type A capsule is hyaluronic acid (HA), a polymer composed of repeating disaccharide β4 glucuronic acid (β4GlcUA)-β3N-acetylglucosamine (β3GlcNAc) units. In the capsule synthesis gene cluster of type A Pasteurella multocida, the genes related to capsule biosynthesis include the following genes: capsule synthesis initiation gene phyAB, capsule synthesis gene hyaBCDE and capsule transport gene hexABCD. HyaD encodes the HA synthase of Pasteurella multocida and polymerizes to form HA by sequentially adding β3N-acetylglucosamine (GlcNAc) and β4 glucuronic acid (GlcUA). HyaD contains two enzyme active sites. When the amino acids at the sites are mutated, the content of HA will be significantly reduced. In addition, the chemical structure of the Pasteurella multocida HA capsule is similar to that of vertebrate HA, so it can evade the cellular and humoral immune systems, is not recognized by antibodies or phagocytes, and successfully adhere to and colonize host cells in a short period of time.

Summary of the invention

The purpose of the present invention is to overcome the shortcomings of the prior art and provide a mutant strain of hyaluronan synthase knocked out of avian Pasteurella multocida and its application. The present invention aims to construct a hyaD gene knockout deletion mutant strain and a hyaD mutant strain with double enzyme activity site mutations, and conduct virulence research and protective efficacy evaluation on them, so as to provide candidate strains for subsequent Pasteurella multocida vaccine research.

To achieve the above purpose, the technical solution designed by the present invention is as follows:

The invention provides a mutant strain of avian Pasteurella multocida hyaluronan synthase knocked out. The mutant strain uses avian Pasteurella multocida GX-PM as the original strain, and the hyaD-X sequence on the genome of the avian Pasteurella multocida is knocked out, wherein the hyaD-X sequence is the hyaD gene or a certain sequence on the hyaD gene; and the nucleotide sequence of the hyaD gene is shown in SEQ ID NO: 1.

Furthermore, the hyaD-X sequence is the nucleotide sequence corresponding to the amino acids 150 to 748 in the hyaD gene, namely hyaD-598aa, and its nucleotide sequence is shown in SEQ ID NO:2.

The present invention also provides a method for constructing the above-mentioned mutant strain of avian Pasteurella multocida hyaluronan synthase knocked out, comprising the following steps:

S1. Amplify the upstream left and right arms hyaD-X-L and the downstream left and right arms hyaD-X-R of the hyaD-X sequence respectively, and connect the upstream left and right arms hyaD-X-L and the downstream left and right arms hyaD-X-R to form the left and right arm sequence hyaD-X-LR;

S2. Connect the left and right arm sequences hyaD-X-LR to the pSHK5Ts-NgAgoDM plasmid backbone to obtain the knockout plasmid pSHK5Ts-hyaD-X-NgAgoDM;

S3. The knockout plasmid pSHK5Ts-hyaD-X-NgAgoDM was electroporated into GX-PM to obtain ΔhyaD-X-GX-PM.

Furthermore, in step S1, when the hyaD-X sequence is the hyaD gene, the primers for amplifying the upstream left and right arms of hyaD-L are:

hyaD-L-F:aggtcgacggtatcgatagtagtgtgtaccaatgcgagg,

hyaD-L-R:aacacttgcattttattaaaaataaaatc;

The primers for amplifying the downstream left and right arms of hyaD-R are:

hyaD-R-F:taataaaatgcaagtgtttttctgtccttaaaaaattaactttgc,

hyaD-R-R:ggaattcgatatcaagctcaacgagcaaaatactttctg;

Alternatively, the hyaD-X sequence is a nucleotide sequence corresponding to amino acids 150 to 748 in the hyaD gene, that is, hyaD-598aa,

The primers for amplifying the upstream left and right arms hyaD-598aa-L are:

hyaD-598aa-L-F:aagtcttttctttcgctttttgtaccatg,

hyaD-598aa-L-R:caggaattcgatatcaagctacgcctttacggtgcagctgatc;

The primers for amplifying the downstream left and right arms of hyaD-598aa-R are:

hyaD-598aa-R-F:ggtcgacggtatcgataaactttattttgatcaatatctaataagatcac,

hyaD-598aa-R-R:aaagcgaaagaaaagacttaagaatcatcttacaccagatatc.

Furthermore, when the hyaD-X sequence is the hyaD gene, ΔhyaD-GX-PM is constructed by the following method:

S1. Amplify the upstream left and right arms hyaD-L and the downstream left and right arms hyaD-R of the hyaD gene respectively, and connect the upstream left and right arms hyaD-L and the downstream left and right arms hyaD-R to form the left and right arm sequence hyaD-LR;

S2. Connect the left and right arm sequences hyaD-LR to the pSHK5Ts-NgAgoDM plasmid backbone to obtain the knockout plasmid pSHK5Ts-hyaD-LR-NgAgoDM;

S3. The knockout plasmid pSHK5Ts-hyaD-LR-NgAgoDM was electroporated into GX-PM to obtain ΔhyaD-GX-PM;

Alternatively, the hyaD-X sequence is a nucleotide sequence corresponding to amino acids 150 to 748 in the hyaD gene, that is, hyaD-598aa, and ΔhyaD-598aa-GX-PM is constructed by the following method:

S1. Amplify the upstream left and right arms hyaD-598aa-L and the downstream left and right arms hyaD-598aa-R of hyaD-598aa respectively, and connect the upstream left and right arms hyaD-598aa-L and the downstream left and right arms hyaD-598aa-R to form the left and right arm sequence hyaD-598aa-LR;

S2. Connect the left and right arm sequences hyaD-598aa-LR to the pSHK5Ts-NgAgoDM plasmid backbone to obtain the knockout plasmid pSHK5Ts-hyaD-598aa-LR-NgAgoDM;

S3. The knockout plasmid pSHK5Ts-hyaD-598aa-LR-NgAgoDM was electroporated into GX-PM to obtain ΔhyaD-598aa-GX-PM.

The present invention also provides a strain mhyaD-GX-PM with a mutation in the active site of hyaluronan synthase of avian Pasteurella multocida. The strain mhyaD-GX-PM uses avian Pasteurella multocida GX-PM as the original strain, and two glutamic acids at positions 247 and 527 in the amino acid sequence of the HyaD protein are mutated into aspartic acid.

The present invention also provides a method for constructing the above-mentioned strain mhyaD-GX-PM, comprising the following steps:

a. amplifying the amino acid sequence of positions 150-250, 243-529 and 523-748 of hyaD, and mutating the two glutamic acids at positions 247 and 527 to aspartic acid, namely hyaD-A, hyaD-B and hyaD-C; connecting the hyaD-A, hyaD-B and hyaD-C fragments in sequence to form the nucleotide sequence hyaD-m;

b. The above sequence hyaD-598aa-L, the hyaD-m sequence amplified in step a, and the above sequence hyaD-598aa-R were connected and cloned into the pSHK5Ts-NgAgoDM plasmid backbone to construct the complemented mutant plasmid pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM;

c. The complemented mutant plasmid pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM was electroporated into the above method to obtain ΔhyaD-598aa-GX-PM, and the strain mhyaD-GX-PM was obtained.

Furthermore, in step a, three pairs of primers are designed:

hyaD-D247E-F:catatcacactcgagtaagccaata,

hyaD-D247E-R:aagcgaaagaaaagacttggcataaaacctgaacatcaac,

hyaD-dDE-F:atctgactctaactgcccaatgt,

hyaD-dDE-R:attggcttactcgagtgtgatatg,

hyaD-D527E-F:ctggtgtaagatgattcttatcaacatgtagaacaataacgaat,

hyaD-D527E-R:cattgggcagttagagtcagatg;

Among them, the amino acid sequence of positions 150-250 of the hyaD gene was amplified using the hyaD-D247E-F/R primers to obtain the fragment hyaD-A;

The amino acid sequence of the hyaD gene at positions 243-529 was amplified using primers hyaD-dDE-F/R to obtain fragment hyaD-B;

The amino acid sequence of positions 523-748 of the gene was amplified using primers hyaD-D527E-F/R to obtain fragment hyaD-C.

The present invention also provides an application of the mutant strain in preparing an attenuated vaccine for preventing and treating avian Pasteurella multocida disease, wherein the mutant strain is ΔhyaD-GX-PM or ΔhyaD-598aa-GX-PM.

The present invention also provides an application of the strain mhyaD-GX-PM in preparing an attenuated vaccine for preventing and treating avian Pasteurellosis multocida.

Beneficial effects of the present invention:

The invention successfully constructs a low-toxic strain of avian Pasteurella multocida with hyaD gene knockout and double enzyme activity site mutation.

The attenuated strain of avian Pasteurella multocida obtained by the invention has good in vitro growth, genetic stability and safety; wherein mhyaD-GX-PM can induce chickens to produce humoral immune response specific to avian Pasteurella multocida, and has good protective effect on acute death caused by avian Pasteurella multocida infection, and can be used to prepare attenuated vaccine for preventing avian Pasteurella multocida.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a diagram showing the PCR amplification results of the homology arms.

In the figure, A is the PCR amplification diagram of the upstream and downstream homologous arms of the hyaD gene, 1: hyaD-L; 2: hyaD-R;

B is the PCR amplification diagram of the upstream and downstream homology arms of the hyaD-598aa gene, 1: hyaD-598aa-L; 2: hyaD-598aa-R; M: DL2000 DNA Marker; and M represents DNA Marker;

FIG2 is a diagram showing the result of concatenating the fragments in FIG1.

In the figure, A is the concatenation diagram of the upstream and downstream homology arms of the hyaD gene, 1: hyaD-LR; B is the concatenation diagram of the upstream and downstream homology arms of the hyaD-598aa gene, 1: hyaD-598aa-LR; M: DL2000 DNA marker;

FIG3 is a diagram showing the PCR amplification results of the vector.

In the figure, 1: pSHK5Ts-NgAgoDM; M: DL15000 DNA Marker;

Figure 4 is the result of PCR identification of the recombinant plasmid.

In the figure, A is the plasmid map of pSHK5Ts-hyaD-LR-NgAgoDM;

B is the pSHK5Ts-hyaD-598aa-LR-NgAgoDM plasmid map; 1-5: single colonies to be identified; 6: H ₂ O; M: DL5000 DNA marker;

FIG5 is a diagram showing the results of identifying hyaD gene recombination,

In the figure, 3-8: single colonies to be identified; 2: GX-PM; 1: H ₂ O; M: DL15000 DNA marker;

FIG6 is a diagram showing the results of identifying a hyaD gene knockout strain.

In the figure, 1-4: single colonies to be identified; 5: GX-PM; 6: H ₂ O; M: DL15000 DNA marker;

FIG. 7 is a diagram showing the results of identifying hyaD-598aa gene recombination,

In the figure, 1-3: single colonies to be identified; 4: GX-PM; 5: H ₂ O; M: DL5000 DNA marker;

FIG8 is a diagram showing the results of identifying the hyaD-598aa gene deletion strain,

In the figure, 1-4: single colonies to be identified; 5: GX-PM; 5: H ₂ O; M: DL5000 DNA marker;

Figure 9 is a result diagram for identifying plasmid elimination,

In the figure, A is the result of ΔhyaD-GX-PM; B is the result of ΔhyaD-598aa-GX-PM; 1-4: single colonies to be identified; 5: pSHK5Ts-NgAgoDM; 6: H ₂ O; M: DL5000 DNA marker;

FIG10 is a diagram showing the PCR amplification results of the amino acid sequence 150-247, the amino acid sequence 248-526, and the amino acid sequence 523-748, including the amino acid sequence 527 substituted with aspartic acid, of hyaD, wherein the glutamic acid at position 247 is replaced with aspartic acid.

In the figure, 1: hyaD-C; 2: hyaD-B; 3: hyaD-A; M: DL2000 DNA Marker;

FIG11 is a diagram showing the result of the concatenation of the fragments in FIG10 into hyaD-m fragments,

In the figure, 1: hyaD-A+hyaD-B+hyaD-C; M: DL2000 DNA Marker;

FIG12 is a diagram showing the result of the concatenation of the hyaD-m fragment with hyaD-598aa-L and hyaD-598aa-R in FIG11 ,

In the figure, 1: hyaD-598aa-L+hyaD-m+hyaD-598aa-R; M: DL5000 DNA Marker;

Figure 13 is a diagram showing the PCR identification results of the recombinant plasmid pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM plasmid.

In the figure, 1-7: single colonies to be identified; 8: H ₂ O; M: DL5000 DNA marker;

FIG14 is a diagram showing the results of identifying the hyaD gene recombination with complementing enzyme activity mutation,

In the figure, 1-6: single colonies to be identified; 7: GX-PM; 8: H ₂ O; M: DL5000 DNA marker;

FIG15 is a diagram showing the results of identifying strains with hyaD gene mutants with complementation activity.

In the figure, 1-6: single colonies to be identified; 7: GX-PM; 8: H ₂ O; M: DL5000 DNA marker;

Figure 16 is a graph showing the results of identifying the elimination of the mhyaD-GX-PM plasmid,

In the figure, 1-4: single colonies to be identified; 5: pSHK5Ts-NgAgoDM; 6: H ₂ O; M: DL5000 DNA marker;

FIG17 is a graph showing growth curve measurement results;

FIG18 is a transmission electron microscope observation result diagram;

FIG19 is a diagram showing the results of hyaluronic acid content determination;

Fig. 20 is a graph showing the results of a chicken whole blood sterilization assay;

FIG21 is a graph showing the bacterial load in tissues and blood of chickens infected with recombinant bacteria;

Figure 22 is a graph showing the detection of antibody levels 14 days after immunization with recombinant bacteria;

Figure 23 is a graph showing the protection efficiency of the recombinant bacteria 14 days after infection.

Detailed ways

The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

Description of the materials used in this example

1. The nucleotide sequences used in the present invention are specifically shown in Table 1:

Table 1

2. The PCR primers used in the embodiments of the present invention are specifically shown in Table 2:

Table 2

3. Some abbreviations in the present invention are represented as follows: hyaD-L: hyaD upstream homology arm;

hyaD-R: hyaD downstream homology arm;

hyaD-LR: hyaD upstream and downstream homology arms;

hyaD-598aa-L: hyaD-598 upstream homology arm; hyaD-598aa-R: hyaD-598 downstream homology arm; hyaD-598aa-LR: hyaD-598 upstream and downstream homology arms;

hyaD-598aa: truncated hyaD gene with mutation in the enzyme activity site; hyaD-m: tandem fragment of hyaD-A+hyaD-B+hyaD-C;

mhyaD: hyaD-598aa-L+hyaD-m+hyaD-598aa-R tandem fragment;

ΔhyaD-GX-PM: hyaluronan knockout mutant of avian Pasteurella multocida GX-PM gene deletion;

ΔhyaD-598aa-GX-PM: GX-PM gene deletion mutant of avian Pasteurella multocida with amino acids 150-748 of hyaluronan knocked out;

mhyaD-GX-PM: A mutant strain of the GX-PM gene of avian Pasteurella multocida with mutations in both active sites of hyaluronan synthase.

4. The strains and plasmids used in the specific examples are shown in Table 3

table 3

5. The consumables used in the specific embodiments are shown in Table 4

Table 4

6. Instructions for strain preservation:

The type A avian Pasteurella multocida used in the embodiment is GX-PM, which was isolated from the liver tissue of dead chickens in a large-scale chicken farm in Guangxi in 2013, and was disclosed in the document "Yu C, Sizhu S, Luo Q, Xu X, Fu L, Zhang A. Genomesequencing of a virulent avian Pasteurella multocida strain GX-Pm reveals the candidate genes involved in the pathogenesis. Res Vet Sci. 2016Apr；105:23-7.doi:10.1016/j.rvsc.2016.01.013.Epub 2016Jan 18.PMID:27033902." and preserved in this laboratory.

Example 1 Construction of strain lacking hyaD gene

1. Construction of recombinant plasmid

1. Amplification of target gene and upstream and downstream left and right arms:

The following fragment amplification was performed using the system in Table 5 and the reaction conditions in Table 6.

1.1 The upstream left and right arms of hyaD-L were amplified using primers hyaD-L-F/R (SEQ ID NO: 9, 10), whose sequence is shown in SEQ ID NO: 3 and whose size is 810 bp; the downstream left and right arms of hyaD-R were amplified using primers hyaD-R-F/R (SEQ ID NO: 11, 12), whose sequence is shown in SEQ ID NO: 4 and whose size is 826 bp, as shown in FIG1A. hyaD-L and hyaD-R were connected to form a hyaD-LR fragment, whose size is 1618 bp, as shown in FIG2A.

table 5

Table 6

1.2 Vector amplification:

The pSHK5Ts-NgAgoDM plasmid was linearized using pSHK5Ts-MCS-F/R (SEQ ID NO: 7, 8). The experimental results are shown in Figure 3, and the size is 5433 bp.

1.3 Transformation of fragment and vector fusion

(1) The hyaD-LR fragment in 1.1 above was fused with the vector in 1.2. The fusion reaction system is shown in Table 7, and the reaction conditions are shown in Table 8.

Table 7

Table 8

(2) Take 10 μL of the fusion product and add it to the competent medium, and place it on ice for 30 min. Then heat shock it in a 42°C water bath for 90 sec. After the heat shock, quickly place it on ice for 2 min. Add 1 mL of LB medium to each tube and revive it at 37°C for 1 h. Centrifuge the revived bacterial solution at 5000 r/min for 4 min, discard the medium until only 200 μL is left, spread it on an LA plate containing 100 μg/mL kanamycin, and then place it in a 37°C incubator for overnight culture.

(3) PCR identification of plasmid transformants. Single colonies were identified using pSHK5Ts-MCS-ID-F/R primers (SEQ ID NOs: 23, 24). As shown in FIG4A , suspected correct single colonies were selected and sent for sequencing, and the alignment results showed no mutation, indicating that the pSHK5Ts-hyaD-LR-NgAgoDM plasmid was successfully constructed.

2. Construction of ΔhyaD-GX-PM mutant

2.1 Electroporation of recombinant plasmid into GX-PM

(1) Strain recovery: Take the GX-PM strain stored at -80°C and streak it into TSA + 10% FBS culture medium, and culture it in a 37°C incubator overnight.

(2) The next day, a single colony was picked from the plate and inoculated into 1 mL of TSB + 10% FBS culture medium, and then placed in a shaker at 37°C and cultured at 180 rpm for 12 h.

(3) The activated bacterial solution was transferred to 10 mL of TSB + 10% FBS culture medium at a ratio of 1:1000, and cultured in a 37°C shaker at 180 rpm for 4 h. When OD ₆₀₀ ≈ 0.4, the culture was removed and placed on ice for 30 min.

(4) Centrifuge at 5000 r/min for 10 min at 4°C, discard the supernatant and collect the cells in a sterile clean bench.

(5) Add 1 mL of pre-cooled sterile ultrapure water, centrifuge at 5000 rpm for 10 min, and discard the supernatant.

(6) Repeat step 5.

(7) Resuspend the cells in 100 μL of ultrapure water, add 1 μg of the recombinant plasmid, transfer to a pre-cooled 2 mm electroporation cuvette, adjust the voltage to 2500 V, and perform an electric shock once.

(8) After the electroporation, quickly transfer the bacterial solution in the electroporation cup to 1 mL of TSB + 10% FBS culture medium and revive at 28°C for 3 h.

(9) The revived bacteria were centrifuged at 5000 r/min for 4 min, the culture medium was discarded until only 200 μL remained, and the culture medium was spread on a plate containing 100 μg/mL kanamycin in TSA + 10% FBS, and then placed in a 28°C incubator for 48 h.

2.2 Screening and identification of deletion mutants

After the colonies grow on the plate after the above-mentioned electrotransformation, pick a single colony and place it in TSB + 10% FBS containing 100 μg/mL kanamycin, place it in a 28°C shaker for several passages and culture, then coat it with a plate containing 100 μg/mL kanamycin in TSA + 10% FBS, place it in a 28°C incubator for culture, and wait for a single colony to grow. Primers genome-hyaD-ID-F/R (SEQID NO: 27, 28) were used to identify whether the electrotransformed pSHK5Ts-hyaD-LR-NgAgoDM plasmid single colony had recombined. The wild control GX-PM amplification product size was 5053 bp, and the recombinant band was 2134 bp. The experimental results are shown in Figure 5.

2.3 Elimination of recombinant plasmid

(1) The suspected recombinant colonies identified above were inoculated into TSA + 10% FBS medium without antibiotics and cultured at 37°C for several times. After the 8th generation, the bacterial solution of appropriate dilution was spread on TSA + 10% FBS plates without antibiotics in each generation. The grown single colonies were dotted on the plates containing 100 μg/mL of kanamycin and TSA + 10% FBS plates without antibiotics. Bacteria that did not grow on the plates containing antibiotics but grew on the plates without antibiotics were screened as suspected recombinant bacteria with plasmid elimination. The primers genome-hyaD-ID-F/R (SEQ ID NO: 27, 28) were used to identify the single colonies. The results are shown in Figure 6, proving that they are homozygous strains. Primers were also used.

The colony was identified by NgAgoDM-ID-F/R (SEQ ID NO: 25, 26), and the result is shown in FIG9A , which proves that the plasmid has been successfully lost.

(2) Primers genome-hyaD-ID-F/R (SEQ ID NO: 27, 28) were used again to identify the single colony, and the band was cut out and sent to the company for sequencing. The results showed that the band was a gene deletion band.

(3) The above results prove that the ΔhyaD-GX-PM gene deletion mutant strain has been successfully obtained.

Example 2 Construction of hyaD strain with complementation of enzyme activity mutation

1. Construction of recombinant plasmid

1.1 Amplification of target gene and upstream and downstream left and right arms: Use the system in Table 5 and the reaction conditions in Table 6 to amplify the following fragments.

(1) Amplification of the upstream left and right arms using hyaD-598aa-L-F/R (SEQ ID NO: 13, 14)

hyaD-598aa-L, whose sequence is shown in SEQ ID NO: 5; the downstream left and right arms of hyaD-598aa-R were amplified using primers hyaD-598aa-R-F/R (SEQ ID NO: 15, 16), whose sequence is shown in SEQ ID NO: 6; as shown in Figure 1B. hyaD-598aa-L and hyaD-598aa-R were connected to form a hyaD-598aa-LR fragment with a size of 1684 bp, as shown in Figure 2B.

(2) Primers of SEQ ID NO: 17-22 were used to amplify the double enzyme activity site mutant fragments hyaD-A, hyaD-B, and hyaD-C, which were truncated to amino acids 150-748 of hyaD, as shown in FIG. 10 , and the sizes were 321 bp, 861 bp, and 678 bp, respectively; the above fragments were connected once to form the hyaD-m fragment, as shown in FIG. 11 , and the size was 1830 bp.

(3) The above hyaD-598aa-L+hyaD-m+hyaD-598aa-R fragments were connected in sequence, as shown in Figure 12, with a size of 3481 bp;

1.2 Amplification of vector: For specific steps, see 1.2 in Example 1.

1.3 Fragment fusion and vector transformation: For specific steps, see 1.3 in Example 1. The hyaD-598aa-LR fragment and the hyaD-598aa-L+hyaD-m+hyaD-598aa-R fragment were fused and transformed with the pSHK5Ts-NgAgoDM vector fragment. Successfully constructed

pSHK5Ts-hyaD-598aa-LR-NgAgoDM plasmid, the identification result is shown in FIG4B ; and pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM plasmid, the identification result is shown in FIG13 ;

2. Construction of ΔhyaD-598aa-GX-PM and mhyaD-GX-PM mutants:

The specific steps are shown in 2 of Example 1. Primers genome-hyaD-598aa-ID-F/R (SEQ ID NOs: 29, 30) were used to identify whether recombination occurred in a single colony of the electroporated plasmid.

Among them, the pSHK5Ts-hyaD-598aa-LR-NgAgoDM plasmid was electroporated into the GX-PM strain to construct the ΔhyaD-598aa-GX-PM deletion strain. The recombination results are shown in Figure 7, the homozygous strain identification results are shown in Figure 8, and the plasmid loss results are shown in Figure 9B;

pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM plasmid was electroporated into

The mhyaD-GX-PM complemented strain was constructed from the ΔhyaD-598aa-GX-PM strain. The recombination results are shown in FIG14 , the homozygous strain identification results are shown in FIG15 , and the plasmid loss results are shown in FIG16 .

Example 3 Study on biological characteristics of ΔhyaD-GX-PM and mhyaD-GX-PM mutants

1. Study on the in vitro growth characteristics of ΔhyaD-GX-PM and mhyaD-GX-PM mutants

The GX-PM, ΔhyaD-GX-PM and mhyaD-GX-PM mutants were coated with TSA + 10% FBS solid culture dishes and cultured in a 37°C incubator overnight. Single colonies were picked and inoculated into 1 mL TSB + 10% FBS medium and cultured in a 37°C shaker for 12 hours. After rejuvenation, the bacterial solution was transferred to 1 mL fresh culture medium at a ratio of 1:1000 and set up 3 replicates. Starting from 0h, the OD ₆₀₀ value of the bacterial solution was measured every 1 hour.

The results showed that under in vitro culture conditions, the growth rates of the ΔhyaD-GX-PM and mhyaD-GX-PM mutants were slower than those of the GX-PM wild-type strain ( FIG. 17 ).

2. Observation of bacterial capsule by transmission electron microscopy

In order to compare the capsule morphology and thickness of GX-PM and ΔhyaD-GX-PM, mhyaD-GX-PM mutant strains, single colonies were picked on the plates, inoculated in TSB + 10% FBS medium, placed in a 37°C shaker, and cultured overnight at 160 r/min; on the second day, they were transferred to fresh culture medium at a ratio of 1:1000, cultured in a 37°C shaker until the _OD600 value was about 1.0, 10 mL of culture was collected, the supernatant was discarded, the bacteria were washed several times with sterile PBS, resuspended in 2.5% glutaraldehyde fixative, fixed at 4°C overnight, and sent to the company for preparation of ultrathin frozen sections, which were observed under a transmission electron microscope.

As shown in Figure 18: The results show that under in vitro culture conditions, the hyaD-GX-PM and mhyaD-GX-PM mutants have basically lost their capsule structure compared to the GX-PM wild-type strain, and normal capsule morphology could not be observed.

3. Determination of hyaluronic acid content

In order to detect whether the hyaluronic acid synthesis ability of the mutant strain is reduced, single colonies of GX-PM, ΔhyaD-GX-PM and mhyaD-GX-PM mutant strains were picked on the plate, inoculated in TSB+10% FBS medium, placed in a 37°C shaker, and cultured overnight at 160r/min; on the second day, transferred to 5mL fresh culture medium at a ratio of 1:1000, cultured in a 37°C shaker until the _OD600 value was about 0.5, centrifuged at 7500g for 15min, discarded the supernatant, washed twice with sterile PBS, resuspended with 1mL PBS, and incubated at 42°C for 1h; centrifuged at 7500g for 15min, transferred the supernatant to a new EP tube; took 500μL of 2.5g/L CTAB in a clean EP tube, added 500μL of sample supernatant, let it stand at room temperature for 5min, and measured OD using a spectrophotometer The reading value is ₄₀₀ ; at the same time, according to the above method, the hyaluronic acid standard is mixed with CTAB and the reading value is determined, and a standard curve is drawn; the content of hyaluronic acid in the sample is calculated.

As shown in Figure 19: The results showed that the hyaluronic acid content of the ΔhyaD-GX-PM and mhyaD-GX-P mutants was significantly lower than that of the GX-PM wild-type strain.

4. Whole blood bactericidal test

In order to compare the survival ability of wild-type GX-PM with ΔhyaD-GX-PM and mhyaD-GX-PM mutants in whole blood, single colonies were picked from the plates, inoculated in TSB+10% FBS medium, and cultured overnight in a 37°C shaker at 160 r/min. On the second day, the colonies were transferred to 1 mL of fresh medium at a ratio of 1:1000, cultured in a 37°C shaker until the _OD600 value was about 0.5, centrifuged at 5000 r/min for 5 min, the supernatant was discarded, and the bacteria were washed twice with 1 mL PBS and diluted to 10 ⁵ The bacterial count was calculated by measuring the bacterial count in CFU/mL; 100 μL of the bacterial solution was added to 900 μL of chicken whole blood containing sodium heparin anticoagulant, and the culture was slowly rotated and incubated at 37°C for 1 hour, during which the culture was mixed every 15 minutes; after incubation for 1 hour, 100 μL of the mixed blood was taken, diluted and smeared on a plate, and incubated at 37°C overnight; the survival rate of the bacteria in the whole blood was calculated (the bacterial count after 1 hour of culture/the initial bacterial count × 100%).

As shown in Figure 20: The wild strain GX-PM can still proliferate rapidly in whole blood, while the survival rate of the ΔhyaD-GX-PM and mhyaD-GX-PM mutant strains in whole blood is significantly reduced.

Example 4 Pathogenicity test of ΔhyaD-GX-PM and mhyaD-GX-PM attenuated vaccines

1. Determination of _LD50 of ΔhyaD-GX-PM and mhyaD-GX-PM mutant recombinant strains in chickens

To investigate whether the mutant strains that lost the ability to synthesize capsules have reduced virulence, 10 ⁷ CFU, 10 ⁸ CFU, and 10 ⁹ CFU of mutant strains and 10 ² CFU of wild-type strains were injected intramuscularly into 30-day-old laying hens, and the mortality of the chickens was recorded for 14 consecutive days.

As shown in Figure 21: When the GX-PM infection dose was 10 ² CFU, all chickens died within 24 hours after the challenge, with a mortality rate of 100%. The ΔhyaD-GX-PM mutant did not cause the death of chickens at an infection dose of 10 ⁷ CFU, while at infection doses of 10 ⁸ CFU and 10 ⁹ CFU, the mortality rates were 50% and 100%, respectively, and the LD ₅₀ was 1.0×10 ⁸ CFU. The mhyaD-GX-PM mutant did not cause the death of chickens at different infection doses, and the LD ₅₀ was ＞1.0×10 ⁹ CFU. The above results show that the virulence of the ΔhyaD-GX-PM and mhyaD-GX-PM mutants is significantly reduced compared with the wild-type strain, and the mhyaD-GX-PM mutant has a higher safety (Table 9).

Table 9 Results of survival rate of chickens infected with 10 ⁷ , 10 ⁸ , and 10 ⁹ CFU recombinant bacteria

2. Detection of bacterial load in tissues of mhyaD-GX-PM recombinant strain

In order to study whether the mutant strain is rapidly cleared in the host, resulting in a decrease in its virulence, 10 ⁹ CFU mhyaD-GX-PM, 10 ⁷ CFU ΔhyaD-GX-PM mutant strain and 10 ² CFU GX-PM wild strain were injected intramuscularly into 30-day-old laying hens. On the first day after infection, the heart, liver, lung, brain and blood of the chickens were removed for detection of tissue bacterial load.

As shown in Figure 21: When the chickens were artificially infected with 10 ⁹ CFU mhyaD-GX-PM and 10 ⁷ CFU ΔhyaD-GX-PM mutant strains, the bacterial load in the tissues was significantly lower than that in the chickens infected with 10 ² CFU wild-type strains. Moreover, on the third day after infection with the mutant strains, no bacteria were detected in the tissues and blood. The above results indicate that the mhyaD-GX-PM and ΔhyaD-GX-PM mutant strains were rapidly cleared in the host, resulting in a significant reduction in their virulence.

Example 5 Study on the immune protection efficacy of mhyaD-GX-PM attenuated vaccine

The mhyaD-GX-PM mutant strain was cultured to OD ₆₀₀ = 0.5, with a bacterial count of about 10 ⁹ CFU/mL. 5 mL of bacterial solution was centrifuged, washed twice with PBS, and resuspended with 1 mL of PBS to prepare a 10 ⁹ CFU/200 μL attenuated vaccine. Each chicken in the experimental group was injected with 200 μL. A booster immunization was performed on the 7th day.

1. Detection of serum IgY antibodies

Chicken serum from the immunization group and the blank control group on the 14th day of immunization was collected, and the IgY antibody level in the serum was detected by ELISA. According to the square array experiment, the optimal coating concentration of the antigen was determined to be 1×10 ⁸ CFU/mL, and the optimal dilution was 1:400. GX-PM whole bacterial protein was used as the coating antigen, the serum to be tested was used as the primary antibody, and the goat anti-chicken antibody was used as the secondary antibody, and the antibody level was detected by indirect ELISA.

As shown in Figure 22: The mhyaD-GX-PM recombinant strain can produce high levels of IgY antibodies against GX-PM after 14 days of immunization.

2. Immunoprotective efficiency of the mhyaD-GX-PM recombinant strain in chickens

In order to study the immune protection efficiency of the mhyaD-GX-PM recombinant strain on chickens, 30-day-old healthy broilers were randomly divided into 3 groups, with 4 chickens in each group. Each chicken was immunized with 10 ⁹ CFU of the mhyaD-GX-PM recombinant strain intramuscularly, and a PBS challenge group and a PBS blank control group were set up. After 14 days of immunization, the mhyaD-GX-PM recombinant strain and the PBS challenge control group were artificially infected with 10 ³ CFU of GX-PM wild bacteria by intramuscular injection. The death of the chickens was continuously observed and recorded after infection.

As shown in FIG. 23 , the mhyaD-GX-PM recombinant strain can completely protect chickens infected with 10 ³ CFU GX-PM after 14 days of immunization.

Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims (10)

1. A mutant strain of hyaluronan synthase knocked out of avian Pasteurella multocida, characterized in that: the mutant strain is based on avian Pasteurella multocida GX-PM as the original strain, and the hyaD-X sequence on the genome of avian Pasteurella multocida is knocked out, wherein the hyaD-X sequence is the hyaD gene or a certain sequence on the hyaD gene; and the nucleotide sequence of the hyaD gene is shown in SEQ ID NO: 1. 2. The mutant strain according to claim 1, characterized in that: the hyaD-X sequence is the nucleotide sequence corresponding to the amino acids 150 to 748 in the hyaD gene, i.e., hyaD-598aa, and its nucleotide sequence is shown in SEQ ID NO: 2. 3. A method for constructing a mutant strain of hyaluronan synthase knocked out of avian Pasteurella multocida according to claim 1, characterized in that it comprises the following steps: S1. Amplify the upstream left and right arms hyaD-X-L and the downstream left and right arms hyaD-X-R of the hyaD-X sequence respectively, and connect the upstream left and right arms hyaD-X-L and the downstream left and right arms hyaD-X-R to form the left and right arm sequence hyaD-X–LR; S2. Connect the left and right arm sequences hyaD-X-LR to the pSHK5Ts-NgAgoDM plasmid backbone to obtain the knockout plasmid pSHK5Ts-hyaD-X-NgAgoDM; S3. The knockout plasmid pSHK5Ts-hyaD-X-NgAgoDM was electroporated into GX-PM to obtain ΔhyaD-X-GX-PM. 4. The construction method according to claim 3, characterized in that: in the step S1, when the hyaD-X sequence is the hyaD gene, the primers for amplifying the upstream left and right arms of hyaD-L are: hyaD-L-F:aggtcgacggtatcgatagtagtgtgtaccaatgcgagg, hyaD-L-R:aacacttgcattttattaaaaataaaatc; The primers for amplifying the downstream left and right arms of hyaD-R are: hyaD-R-F:taataaaatgcaagtgtttttctgtccttaaaaaattaactttgc, hyaD-R-R:ggaattcgatatcaagctcaacgagcaaaatactttctg; Alternatively, the hyaD-X sequence is a nucleotide sequence corresponding to amino acids 150 to 748 in the hyaD gene, that is, hyaD-598aa, The primers for amplifying the upstream left and right arms hyaD-598aa-L are: hyaD-598aa-L-F:aagtcttttctttcgctttttgtaccatg, hyaD-598aa-L-R:caggaattcgatatcaagctacgcctttacggtgcagctgatc; The primers for amplifying the downstream left and right arms of hyaD-598aa-R are: hyaD-598aa-R-F:ggtcgacggtatcgataaactttattttgatcaatatctaataagatcac, hyaD-598aa-R-R:aaagcgaaagaaaagacttaagaatcatcttacaccagatatc. 5. The construction method according to claim 4, characterized in that: when the hyaD-X sequence is the hyaD gene, ΔhyaD-GX-PM is constructed by the following method: S1. Amplify the upstream left and right arms hyaD-L and the downstream left and right arms hyaD-R of the hyaD gene respectively, and connect the upstream left and right arms hyaD-L and the downstream left and right arms hyaD-R to form the left and right arm sequence hyaD–LR; S2. Connect the left and right arm sequences hyaD–LR to the pSHK5Ts-NgAgoDM plasmid backbone to obtain the knockout plasmid pSHK5Ts-hyaD-LR-NgAgoDM; S3. The knockout plasmid pSHK5Ts-hyaD-LR-NgAgoDM was electroporated into GX-PM to obtain ΔhyaD-GX-PM; Alternatively, the hyaD-X sequence is a nucleotide sequence corresponding to amino acids 150 to 748 in the hyaD gene, that is, hyaD-598aa, and ΔhyaD-598aa-GX-PM is constructed by the following method: S1. Amplify the upstream left and right arms hyaD-598aa-L and the downstream left and right arms hyaD-598aa-R of hyaD-598aa respectively, and connect the upstream left and right arms hyaD-598aa-L and the downstream left and right arms hyaD-598aa-R to form the left and right arm sequence hyaD-598aa–LR; S2. Connect the left and right arm sequences hyaD-598aa–LR to the pSHK5Ts-NgAgoDM plasmid backbone to obtain the knockout plasmid pSHK5Ts-hyaD-598aa-LR-NgAgoDM; S3. The knockout plasmid pSHK5Ts-hyaD-598aa-LR-NgAgoDM was electroporated into GX-PM to obtain ΔhyaD-598aa-GX-PM. 6. A strain mhyaD-GX-PM with a mutation in the active site of hyaluronan synthase of avian Pasteurella multocida, characterized in that: the strain mhyaD-GX-PM is based on avian Pasteurella multocida GX-PM as the original strain, and the two glutamic acids at positions 247 and 527 in the amino acid sequence of the HyaD protein are mutated into aspartic acid. 7. A method for constructing the strain mhyaD-GX-PM of claim 6, characterized in that it comprises the following steps: a. amplifying the amino acid sequence of positions 150-250, 243-529 and 523-748 of hyaD, and mutating the two glutamic acids at positions 247 and 527 to aspartic acid, namely hyaD-A, hyaD-B and hyaD-C; connecting the hyaD-A, hyaD-B and hyaD-C fragments in sequence to form the nucleotide sequence hyaD-m; b. Connect the hyaD-598aa-L sequence of claim 4, the hyaD-m sequence amplified in step a, and the hyaD-598aa-R sequence of claim 4, and clone them into the pSHK5Ts-NgAgoDM plasmid backbone to construct the complemented mutant plasmid pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM; c. The complemented mutant plasmid pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM was electroporated into the method described in claim 5 to obtain ΔhyaD-598aa-GX-PM, thereby obtaining the strain mhyaD-GX-PM. 8. The construction method according to claim 1, characterized in that: in the step a, three pairs of primers are designed: hyaD-D247E-F:catatcacactcgagtaagccaata, hyaD-D247E-R:aagcgaaagaaaagacttggcataaaacctgaacatcaac, hyaD-dDE-F:atctgactctaactgcccaatgt, hyaD-dDE-R:attggcttactcgagtgtgatatg, hyaD-D527E-F:ctggtgtaagatgattcttatcaacatgtagaacaataacgaat, hyaD-D527E-R:cattgggcagttagagtcagatg; Among them, the amino acid sequence of positions 150-250 of the hyaD gene was amplified using the hyaD-D247E-F/R primers to obtain the fragment hyaD-A; The amino acid sequence of the hyaD gene at positions 243-529 was amplified using primers hyaD-dDE-F/R to obtain fragment hyaD-B; The amino acid sequence of positions 523-748 of the gene was amplified using primers hyaD-D527E-F/R to obtain fragment hyaD-C. 9. Use of the mutant strain according to claim 1 in preparing an attenuated vaccine for preventing and treating avian Pasteurellosis multocida, characterized in that the mutant strain is ΔhyaD-GX-PM or ΔhyaD-598aa-GX-PM. 10. Use of the strain mhyaD-GX-PM according to claim 6 in preparing an attenuated vaccine for preventing and treating avian Pasteurella multocida.