CN118345017A

CN118345017A - Mutant strain knocked out by fowl pasteurella multocida hyaluronic acid synthetase and application thereof

Info

Publication number: CN118345017A
Application number: CN202410504504.0A
Authority: CN
Inventors: 张安定; 高培颖; 王利波; 韩丽
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2024-04-25
Filing date: 2024-04-25
Publication date: 2024-07-16

Abstract

The invention discloses a mutant strain for knocking out a hyaluronic acid synthase of a pasteurella multocida and application thereof, wherein the mutant strain takes the pasteurella multocida GX-PM as an original strain, and a hyaD-X sequence on a genome of the pasteurella multocida is knocked out, wherein the hyaD-X sequence is a hyaD gene or a certain segment of sequence on a hyaD gene. The strain mhyaD-GX-PM takes fowl Pasteurella multocida GX-PM as an original strain, and two glutamic acids at 247 th and 527 th in the HyaD protein amino acid sequence are mutated into aspartic acid. The avian pasteurella multocida attenuated strain obtained by the invention has good in-vitro growth, genetic stability and safety; wherein mhyaD-GX-PM has good protection effect on acute death caused by infection of the avian Pasteurella multocida, and can be used for preparing attenuated vaccine for preventing the avian Pasteurella multocida.

Description

Mutant strain knocked out by fowl pasteurella multocida hyaluronic acid synthetase and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a mutant strain knocked out by fowl Pasteurella multocida hyaluronic acid synthase and application thereof.

Background

The fowl Pasteurella multocida is a gram negative bacterium belonging to the family Pasteurellaceae. Pasteurella multocida can occur in a variety of domestic and wild animals as well as humans, most commonly in avian cholera in birds, hemorrhagic septicemia in ruminants and bovine respiratory disease, hemorrhagic septicemia and progressive atrophic rhinitis and pneumonia in pigs and rabbits, and the like. Fowl cholera is a serious systemic disease that can infect all birds, causing a huge economic loss to the poultry industry worldwide. In the past, antibiotics have been used to prevent and control avian cholera, but the emergence of resistant strains has made it necessary to limit the use of antibiotics. Furthermore, vaccination plays an important role in the prevention of pasteurellosis infection. Currently, inactivated vaccines offer limited protection against homologous serotypes, while live attenuated vaccines are at risk of virulence return. Therefore, there is a need to develop new vaccines.

Pasteurella multocida can be divided into A, B, D, E and F five serotypes. Wherein the serotype of avian Pasteurella multocida is predominantly type A. The main component of the type a capsule is Hyaluronic Acid (HA), a polymer consisting of repeating disaccharide β 4 glucuronic acid (β4glcua) - β3n-acetamido glucose (β3glcnac) units. In the pasteurella multocida capsular synthesis gene cluster, genes involved in capsular biosynthesis include the following genes: a capsular synthesis initiation gene phyAB, a capsular synthesis gene hyaBCDE, and a capsular transport gene hexABCD. HyaD encodes a Pasteurella multocida HA synthase and polymerizes to form HA by sequential addition of beta 3N-acetylglucosamine (GlcNAc) and beta 4 glucuronic acid (GlcUA). HyaD contain two enzyme active sites, and when the site amino acid is mutated, the HA content is significantly reduced. In addition, the chemical structure of the pasteurella multocida HA capsule is similar to that of vertebrate HA, so that it can evade the cellular and humoral immune systems, is not recognized by antibodies or phagocytes, and successfully adheres to and colonizes host cells in a short time.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a mutant strain knocked out by avian Pasteurella multocida hyaluronic acid synthase and application thereof, and aims to construct hyaD gene knocked-out deletion mutant strain and hyaD mutant strain with double enzyme activity site mutation, and carry out toxicity research and protection efficacy evaluation on the mutant strain, so as to provide candidate strains for subsequent Pasteurella multocida vaccine research.

In order to achieve the above purpose, the technical scheme of the invention is as follows:

The invention provides a mutant strain knocked out by fowl multocida hyaluronic acid synthetase, which takes fowl multocida Pasteurella GX-PM as an original strain, knocks out hyaD-X sequence on fowl multocida Pasteurella genome, wherein hyaD-X sequence is hyaD gene or a certain segment of sequence on hyaD gene; and the nucleotide sequence of hyaD gene is shown as SEQ ID NO. 1.

Furthermore, the hyaD-X sequence is hyaD gene, the nucleotide sequence corresponding to the 150 th to 748 th amino acids in the hyaD gene is hyaD-598aa, and the nucleotide sequence is shown as SEQ ID NO. 2.

The invention also provides a construction method of the mutant strain knocked out by the fowl pasteurella multocida hyaluronic acid synthetase, which comprises the following steps:

s1, respectively amplifying upstream left and right arms hyaD-X-L and downstream left and right arms hyaD-X-R of hyaD-X sequences, and connecting the upstream left and right arms hyaD-X-L and the downstream left and right arms hyaD-X-R to form left and right arm sequences hyaD-X-LR;

S2, connecting left and right arm sequences hyaD-X-LR to a pSHK5Ts-NgAgoDM plasmid skeleton to obtain a knockout plasmid pSHK5Ts-hyaD-X-NgAgoDM;

S3, the knocked-out plasmid pSHK5Ts-hyaD-X-NgAgoDM is electrically transformed into GX-PM to obtain delta hyaD-X-GX-PM.

Further, in the step S1, when the hyaD-X sequence is hyaD gene, primers for amplifying the upstream left and right arms hyaD-L are:

hyaD-L-F：aggtcgacggtatcgatagtagtgtgtaccaatgcgagg，

hyaD-L-R：aacacttgcattttattaaaaataaaatc；

The primers for amplifying the downstream left and right arms hyaD-R are:

hyaD-R-F：taataaaatgcaagtgtttttctgtccttaaaaaattaactttgc，

hyaD-R-R：ggaattcgatatcaagctcaacgagcaaaatactttctg；

Or the hyaD-X sequence is the nucleotide sequence corresponding to 150 th to 748 th amino acids in hyaD gene, namely hyaD-598aa,

The primers for amplifying the upstream left and right arms hyaD-598aa-L are:

hyaD-598aa-L-F：aagtcttttctttcgctttttgtaccatg，

hyaD-598aa-L-R：caggaattcgatatcaagctacgcctttacggtgcagctgatc；

The primers for amplifying the downstream left and right arms hyaD-598aa-R are:

hyaD-598aa-R-F：ggtcgacggtatcgataaactttattttgatcaatatctaataagatcac，

hyaD-598aa-R-R：aaagcgaaagaaaagacttaagaatcatcttacaccagatatc。

Further, when the hyaD-X sequence is hyaD gene, delta hyaD-GX-PM is constructed by the following method:

S1, respectively amplifying an upstream left arm hyaD-L and a downstream left arm hyaD-R of hyaD genes, and connecting the upstream left arm hyaD-L and the downstream left arm hyaD-R to form a left arm sequence hyaD-LR;

s2, connecting left and right arm sequences hyaD-LR to a pSHK5Ts-NgAgoDM plasmid skeleton to obtain a knockout plasmid pSHK5Ts-hyaD-LR-NgAgoDM;

s3, electrically converting the knocked-out plasmid pSHK5Ts-hyaD-LR-NgAgoDM into GX-PM to obtain delta hyaD-GX-PM;

Or the hyaD-X sequence is a nucleotide sequence corresponding to amino acids 150 to 748 in the hyaD gene, namely hyaD-598aa, and the delta hyaD-598aa-GX-PM is constructed by the following method:

s1, respectively amplifying upstream left and right arms hyaD-598aa-L and downstream left and right arms hyaD-598aa-R of hyaD-598aa, and connecting the upstream left and right arms hyaD-598aa-L and the downstream left and right arms hyaD-598aa-R to form a left and right arm sequence hyaD-598aa-LR;

s2, connecting left and right arm sequences hyaD-598aa-LR to a pSHK5Ts-NgAgoDM plasmid skeleton to obtain a knockout plasmid pSHK5Ts-hyaD-598aa-LR-NgAgoDM;

s3, the knocked-out plasmid pSHK5Ts-hyaD-598aa-LR-NgAgoDM is electrically transformed into GX-PM to obtain delta hyaD-598aa-GX-PM.

The invention also provides a strain mhyaD-GX-PM with the mutation of the hyaluronic acid synthase active site of the pasteurella multocida, wherein the strain mhyaD-GX-PM takes the pasteurella multocida GX-PM as an original strain, and two glutamic acids at 247 th and 527 th in the amino acid sequence of HyaD protein are mutated into aspartic acid.

The invention also provides a construction method of the strain mhyaD-GX-PM, which comprises the following steps:

a. Amplifying the amino acid sequence of the hyaD th to 250 th positions, the amino acid sequence of the 243 th to 529 th positions and the amino acid sequence of the 523 th to 748 th positions, and mutating the two glutamic acids of the 247 th and 527 th positions into aspartic acid, wherein the aspartic acid is hyaD-A, hyaD-B, hyaD-C respectively; sequentially connecting hyaD-A, hyaD-B, hyaD-C fragments to form a nucleotide sequence hyaD-m;

b. Ligating the above sequence hyaD-598aa-L, the hyaD-m sequence amplified in step a, and the above sequence hyaD-598aa-R, and cloning onto pSHK5Ts-NgAgoDM plasmid backbone, constructing a make-up mutant plasmid pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM;

c. The complementation mutant plasmid pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM was electrotransformed into the above-described method to give Δ hyaD-598aa-GX-PM, to give strain mhyaD-GX-PM.

Further, in the step a, three pairs of primers are designed:

hyaD-D247E-F：catatcacactcgagtaagccaata，

hyaD-D247E-R：aagcgaaagaaaagacttggcataaaacctgaacatcaac，

hyaD-dDE-F：atctgactctaactgcccaatgt，

hyaD-dDE-R：attggcttactcgagtgtgatatg，

hyaD-D527E-F：ctggtgtaagatgattcttatcaacatgtagaacaataacgaat，

hyaD-D527E-R：cattgggcagttagagtcagatg；

wherein, the amino acid sequence of 150 th to 250 th positions of hyaD gene is amplified by hyaD-D247E-F/R primer to obtain fragment hyaD-A;

amplifying 243-529 amino acid sequence of hyaD gene by hyaD-dDE-F/R primer to obtain fragment hyaD-B;

The amino acid sequence at 523-748 of the gene was amplified using hyaD-D527E-F/R primer to give fragment hyaD-C.

The invention also provides application of the mutant strain in preparing attenuated vaccine for preventing and treating fowl pasteurellosis, wherein the mutant strain is delta hyaD-GX-PM or delta hyaD-598aa-GX-PM.

The invention also provides application of the strain mhyaD-GX-PM in preparing attenuated vaccine for preventing and treating fowl pasteurellosis.

The invention has the beneficial effects that:

The invention successfully constructs the avian pasteurella multocida attenuated strain with hyaD gene knockout and double enzyme active site mutation.

The avian pasteurella multocida attenuated strain obtained by the invention has good in-vitro growth, genetic stability and safety; wherein mhyaD-GX-PM can induce chicken to generate humoral immune response specific to the avian Pasteurella multocida, has good protection effect on acute death caused by infection of the avian Pasteurella multocida, and can be used for preparing attenuated vaccine for preventing the avian Pasteurella multocida.

Drawings

FIG. 1 is a graph showing the result of PCR amplification of homology arms,

In the figure, A is a PCR amplification diagram of a homology arm at the upstream and downstream of hyaD genes, 1: hyaD-L;2: hyaD-R;

B is a PCR amplification diagram of hyaD-598aa gene upstream and downstream homology arms, 1: hyaD-598aa-L;2: hyaD-598aa-R; m: DL2000 DNA MARKER; and M represents DNA MARKER;

figure 2 is a graph of the results of the fragments of figure 1 after concatenation,

In the figure, A is a hyaD gene upstream and downstream homology arm tandem diagram, 1: hyaD-LR; b is a hyaD-598aa gene upstream and downstream homology arm tandem diagram, 1: hyaD-598aa-LR; m: DL2000 DNA MARKER;

FIG. 3 is a diagram showing the result of PCR amplification of the vector,

In the figure, 1: pSHK5Ts-NgAgoDM; m: DL15000 DNA MARKER;

FIG. 4 is a diagram showing the results of PCR identification of recombinant plasmids,

In the figure, A is pSHK5Ts-hyaD-LR-NgAgoDM plasmid map;

b is pSHK5Ts-hyaD-598aa-LR-NgAgoDM plasmid map; 1 to 5: single colonies to be identified; 6: h ₂ O; m: DL5000 DNA MARKER;

FIG. 5 is a diagram showing the results of identifying hyaD gene recombinations,

In the figure, 3 to 8: single colonies to be identified; 2: GX-PM;1: h ₂ O; m: DL15000 DNA MARKER;

FIG. 6 is a graph showing the results of identifying a knock-out hyaD gene-deleted strain,

In the figure, 1 to 4: single colonies to be identified; 5: GX-PM;6: h ₂ O; m: DL15000 DNA MARKER;

FIG. 7 is a diagram showing the results of identifying hyaD-598aa gene recombination,

In the figure, 1 to 3: single colonies to be identified; 4: GX-PM;5: h ₂ O; m: DL5000 DNA MARKER;

FIG. 8 is a graph showing the results of identifying hyaD-598aa gene-deleted strains,

In the figure, 1 to 4: single colonies to be identified; 5: GX-PM;5: h ₂ O; m: DL5000 DNA MARKER;

FIG. 9 is a graph showing the results of identifying plasmid elimination,

In the figure, A is a graph of the results of Δ hyaD-GX-PM; b is a result graph of delta hyaD-598 aa-GX-PM; 1 to 4: single colonies to be identified; 5: pSHK5Ts-NgAgoDM;6: h ₂ O; m: DL5000DNA MARKER;

FIG. 10 is a diagram showing the results of PCR amplification of amino acid sequences 150-247, 248-526, and 523-748 comprising substitution of glutamic acid at position 527 with aspartic acid,

In the figure, 1: hyaD-C;2: hyaD-B;3: hyaD-A; m: DL2000 DNA MARKER;

FIG. 11 is a graph showing the results of the concatenation of the fragments of FIG. 10 into hyaD-m fragments,

In the figure, 1: hyaD-A+ hyaD-B+ hyaD-C; m: DL2000 DNA MARKER;

FIG. 12 is a graph showing the results of the hyaD-m fragment in tandem with hyaD-598aa-L and hyaD-598aa-R in FIG. 11,

In the figure, 1: hyaD-598aa-L+ hyaD-m+ hyaD-598aa-R; m: DL5000 DNA MARKER;

FIG. 13 is a diagram showing the results of PCR identification of recombinant plasmids of pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM,

In the figure, 1 to 7: single colonies to be identified; 8: h ₂ O; m: DL5000 DNA MARKER;

FIG. 14 is a diagram showing the results of identifying the gene recombination of the anaplerotic enzyme activity mutation hyaD,

In the figure, 1 to 6: single colonies to be identified; 7: GX-PM;8: h ₂ O; m: DL5000 DNA MARKER;

FIG. 15 is a diagram showing the results of identifying a mutant strain of the make-up enzyme activity mutation hyaD gene,

FIG. 16 is a graph showing the results of identifying mhyaD-GX-PM plasmid elimination,

In the figure, 1 to 4: single colonies to be identified; 5: pSHK5Ts-NgAgoDM;6: h ₂ O; m: DL5000 DNA MARKER;

FIG. 17 is a graph of the measurement results of a growth curve;

FIG. 18 is a view of the transmission electron microscope;

FIG. 19 is a graph showing the results of the measurement of the content of hyaluronic acid;

FIG. 20 is a graph showing the results of a chicken whole blood sterilization assay;

FIG. 21 is a graph showing the results of tissue and blood bacterial load after infection of chickens with recombinant bacteria;

FIG. 22 is a graph showing the detection of antibody levels after 14 days of immunization with recombinant bacteria;

FIG. 23 is a graph showing the results of protection efficiency after 14 days of challenge for recombinant bacteria immunization.

Detailed Description

The present invention is described in further detail below in conjunction with specific embodiments for understanding by those skilled in the art.

Description of the materials used in this example

1. The nucleotide sequences used in the present invention are specifically shown in Table 1:

TABLE 1

2. The PCR primers used in the examples of the present invention are shown in Table 2:

TABLE 2

3. Some abbreviations in this invention are represented as: hyaD-L: hyaD upstream homology arms;

hyaD-R: hyaD downstream homology arms;

hyaD-LR: hyaD upstream and downstream homology arms;

hyaD-598aa-L: hyaD-598 upstream homology arms; hyaD-598aa-R: hyaD-598 downstream homology arms; hyaD-598aa-LR: hyaD-598 upstream and downstream homology arms;

hyaD-598aa: a truncated hyaD gene with a mutation in the enzyme activity site; hyaD-m: hyaD-A+ hyaD-B+ hyaD-C tandem fragments;

mhyaD: hyaD-598aa-L+ hyaD-m+ hyaD-598aa-R tandem fragment;

Δ hyaD-GX-PM: a hyaluronic acid knockout avian pasteurella multocida GX-PM gene deletion mutant;

Δ hyaD-598aa-GX-PM: a deletion mutant strain of the GX-PM gene of the avian Pasteurella multocida with the 150 th to 748 th amino acid knocked out hyaluronic acid;

mhyaD-GX-PM: a mutant strain of fowl Pasteurella multocida GX-PM gene with double enzyme active site mutation of hyaluronic acid synthetase.

4. The strains and plasmids used in the examples are shown in Table 3

TABLE 3 Table 3

5. The consumables used in the examples are shown in Table 4

TABLE 4 Table 4

6. Strain preservation description:

The A-type fowl Pasteurella multocida used in the examples was GX-PM, which was isolated in 2013 from liver tissue of a sick and dead chicken in Guangxi large scale chicken farm, and was stored in the laboratory as disclosed in literature "Yu C,Sizhu S,Luo Q,Xu X,Fu L,Zhang A.Genome sequencing of a virulent avianPasteurella multocida strain GX-Pm reveals the candidate genes involved in the pathogenesis.Res Vet Sci.2016Apr;105:23-7.doi:10.1016/j.rvsc.2016.01.013.Epub 2016Jan 18.PMID:27033902.".

EXAMPLE 1 construction of the Strain lacking hyaD Gene

1. Recombinant plasmid construction

1. Amplification of the target Gene and upstream and downstream left and right arms:

The following fragment amplifications were performed using the system of Table 5 and the reaction conditions of Table 6.

1.1 Amplifying upstream left and right arms hyaD-L by using hyaD-L-F/R (SEQ ID NO:9, 10) primers, wherein the sequence of the upstream left and right arms hyaD-L is shown as SEQ ID NO:3, and the size of the upstream left and right arms is 810bp; the downstream left and right arms hyaD-R were amplified using hyaD-R-F/R (SEQ ID NOS: 11, 12) primers, the sequence of which is shown in SEQ ID NO:4, and the size of which is 826bp, as shown in FIG. 1A. hyaD-L and hyaD-R are connected to form a hyaD-LR fragment with the size of 1618bp, as shown in FIG. 2A.

TABLE 5

TABLE 6

1.2 Amplification of vector:

pSHK5Ts-NgAgoDM plasmid was linearized using pSHK5Ts-MCS-F/R (SEQ ID NO:7, 8), the experimental results are shown in FIG. 3, size 5433bp.

1.3 Fusion transformation of fragments with vector

(1) The hyaD-LR fragment of 1.1 was fused with the vector of 1.2, the fusion reaction system is shown in Table 7, and the reaction conditions are shown in Table 8.

TABLE 7

TABLE 8

(2) Adding 10 mu L of the fusion product into competence, and carrying out ice bath for 30min; then heat-shocking for 90sec in a water bath at 42 ℃, rapidly cooling for 2min on ice after finishing, adding 1mL of LB culture medium into each tube, and resuscitating for 1h at 37 ℃; the resuscitated bacterial solution was centrifuged at 5000r/min for 4min, the medium was discarded until only 200. Mu.L remained, plated onto LA dishes containing 100. Mu.g/mL kanamycin, and placed in an incubator at 37℃for overnight incubation.

(3) PCR identification of plasmid transformants Single colonies were identified with pSHK5Ts-MCS-ID-F/R primers (SEQ ID NO:23, 24) by selecting single colonies suspected to be correct, as shown in FIG. 4A, and sequencing, and the comparison showed NO mutation, indicating successful construction of pSHK5Ts-hyaD-LR-NgAgoDM plasmid.

2. Construction of the Delta hyaD-GX-PM mutant

2.1 Electric transformation of recombinant plasmid into GX-PM

(1) Recovery of the strain: streaking GX-PM strain preserved at-80deg.C, inoculating to culture medium of TSA+10% FBS, and culturing at 37deg.C overnight.

(2) The following day, single colonies on plates were picked and inoculated in 1mL of TSB+10% FBS medium, and placed on a shaking table at 37℃and shake-cultured at 180r/min for 12h.

(3) The activated bacterial liquid is prepared according to the following steps of 1:1000 were transferred to 10mL of TSB+10% FBS medium, placed on a shaking table at 37℃and shake-cultured at 180r/min for 4 hours, and when OD ₆₀₀. Apprxeq.0.4, the culture was taken out and left on ice for 30 minutes.

(4) Centrifuging at 4deg.C for 10min at 5000r/min, discarding supernatant in a sterile super clean bench, and collecting thallus.

(5) 1ML of sterilized ultrapure water was added, centrifuged at 5000r/min for 10min, and the supernatant was discarded.

(6) And (5) repeating the step 5.

(7) The cells were resuspended in 100. Mu.L of ultrapure water, 1. Mu.g of recombinant plasmid was added, transferred to a pre-chilled 2mm electric beaker, and the voltage was adjusted to 2500v and shocked once.

(8) The bacterial solution in the electric rotating cup after electric shock is quickly transferred to 1mL of culture medium of TSB+10% FBS, and resuscitated at 28 ℃ for 3 hours.

(9) Resuscitated bacteria were centrifuged at 5000r/min for 4min, medium was discarded to 200. Mu.L, plated with TSA+10% FBS containing 100. Mu.g/mL kanamycin, and placed in a 28℃incubator for 48h.

2.2 Screening and identification of deletion mutants

After the colonies growing on the plates after the above electric transfer, single colonies were picked up and placed in TSB+10% FBS containing 100. Mu.g/mL kanamycin, and after several passages of culture in a shaker at 28℃plates containing 100. Mu.g/mL kanamycin were plated in TSA+10% FBS, and placed in an incubator at 28℃for culture, and single colonies were grown. The primers genome-hyaD-ID-F/R (SEQ ID NO:27, 28) were used to identify whether single colonies of the electrokinetic pSHK5Ts-hyaD-LR-NgAgoDM plasmid were recombined, the size of the wild control GX-PM amplified product was 5053bp, the recombination zone was 2134bp, and the experimental results are shown in FIG. 5.

2.3 Elimination of recombinant plasmids

(1) The suspected recombinant colonies identified above were inoculated into TSA+10% FBS medium without antibiotics and incubated several times at 37 ℃. To passage 8, each passage was plated with appropriate dilutions of bacterial fluid on TSA+10% FBS plates without antibiotics. Single colonies grown were streaked onto TSA+10% FBS plates containing 100. Mu.g/mL kanamycin and TSA+10% FBS plates without antibiotics in this order. Bacteria that did not grow on plates containing antibiotics but did not grow on plates containing antibiotics were screened for suspected plasmid-depleted recombinant bacteria and single colonies were identified using primers genome-hyaD-ID-F/R (SEQ ID NO:27, 28) and the results are shown in FIG. 6, demonstrating homozygous strains. And using primers

NgAgoDM-ID-F/R (SEQ ID NOS: 25, 26) identified this colony, as shown in FIG. 9A, demonstrating successful plasmid loss.

(2) Single colonies were identified again using primer genome-hyaD-ID-F/R (SEQ ID NO:27, 28) and the bands excised and sent to the company for sequencing, which demonstrated that the bands were gene deleted.

(3) The above results demonstrate that the Delta hyaD-GX-PM gene deletion mutant has been successfully obtained.

EXAMPLE 2 construction of the make-up enzyme Activity mutant hyaD Strain

1. Construction of recombinant plasmids

1.1 Amplification of the Gene of interest and the upstream and downstream left and right arms: the following fragment amplifications were performed using the system of Table 5 and the reaction conditions of Table 6.

(1) Amplification of upstream left and right arms Using hyaD-598aa-L-F/R (SEQ ID NOS: 13, 14)

HyaD-598aa-L, the sequence of which is shown in SEQ ID NO. 5; amplifying the downstream left and right arms hyaD-598aa-R with hyaD-598aa-R-F/R (SEQ ID NO:15, 16) primers, the sequence of which is shown as SEQ ID NO: 6; as shown in fig. 1B. hyaD-598aa-L and hyaD-598aa-R were ligated to construct a hyaD-598aa-LR fragment of 1684bp size, as shown in FIG. 2B.

(2) The 150-748 amino acid truncated double enzyme activity site mutant fragment hyaD-A, hyaD-B, hyaD-C of hyaD is amplified by using the primer of SEQ ID NO. 17-22, as shown in figure 10, the sizes are 321bp, 861bp and 678bp respectively; the fragments are connected at a time to form hyaD-m fragments, and the size of the fragments is 1830bp as shown in FIG. 11.

(3) The hyaD-598aa-L+ hyaD-m+ hyaD-598aa-R fragments are sequentially connected, as shown in FIG. 12, and the size is 3481bp;

1.2 amplification of vector: see example 1 for specific steps 1.2.

1.3 Fusion transformation of fragments with vector: see example 1 for specific steps 1.3. The hyaD-598aa-LR fragment and hyaD-598aa-L+ hyaD-m+ hyaD-598aa-R fragment were transformed by fusion with the pSHK5Ts-NgAgoDM vector fragment, respectively. Successful construction

PSHK5Ts-hyaD-598aa-LR-NgAgoDM plasmid, the identification results are shown in FIG. 4B; and pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM plasmid, the identification results are shown in FIG. 13;

2. construction of the Δ hyaD-598aa-GX-PM and mhyaD-GX-PM mutants:

Specific procedures are shown in example 1,2, and primer genome-hyaD-598aa-ID-F/R (SEQ ID NO:29, 30) is used to identify whether recombination occurs in single colonies of the electrotransfer plasmid.

Wherein, pSHK5Ts-hyaD-598aa-LR-NgAgoDM plasmid was electrotransferred into GX-PM strain to construct delta hyaD-598aa-GX-PM deletion strain. The recombination results are shown in FIG. 7, the identification results of the homozygous strains are shown in FIG. 8, and the plasmid loss results are shown in FIG. 9B;

plasmid pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM was electrotransferred to

In the strain delta hyaD-598aa-GX-PM, a mhyaD-GX-PM anaplerotic strain is constructed, the recombination result is shown in figure 14, the identification result of the homozygous strain is shown in figure 15, and the plasmid loss result is shown in figure 16.

EXAMPLE 3 biological Property Studies of Delta hyaD-GX-PM and mhyaD-GX-PM mutants

1. Research on in vitro growth characteristics of Delta hyaD-GX-PM and mhiaD-GX-PM mutant

GX-PM, delta hyaD-GX-PM and mhyaD-GX-PM mutants were each plated with TSA+10% FBS solid dishes and incubated overnight at 37 ℃. Single colonies were picked separately, inoculated in 1mL of TSB+10% FBS medium, and cultured in a shaker at 37℃for 12 hours. After rejuvenation, the bacterial solutions were transferred to 1mL fresh medium at a ratio of 1:1000, and 3 replicates were set. The OD ₆₀₀ of the bacterial liquid was measured every 1 hour from 0 hour.

The results show that: under in vitro culture conditions, the growth rates of the Δ hyaD-GX-PM and mhyaD-GX-PM mutants were slowed down compared to the GX-PM wild type (FIG. 17).

2. Bacterial capsule observation by transmission electron microscope

In order to compare the capsular morphology and thickness of GX-PM and Delta hyaD-GX-PM and mhiaD-GX-PM mutant strains, single colonies were picked on plates, inoculated in TSB+10% FBS medium, placed in shaking table at 37℃and shake-cultured overnight at 160 r/min; day 2 at 1:1000 were transferred to fresh medium, shake cultured at 37℃until OD ₆₀₀ was about 1.0, 10mL of the culture was collected, the supernatant was discarded, the cells were washed several times with sterile PBS, resuspended with 2.5% glutaraldehyde fixative, fixed overnight at 4℃and sent to the company for preparation of ultra-thin frozen sections, and observed with a transmission electron microscope.

As shown in fig. 18: the results are shown in the following: under in vitro culture conditions, hyaD-GX-PM and mhyaD-GX-PM mutants had substantially lost capsule structure compared to the GX-PM wild type strain, and no normal capsular morphology could be observed.

3. Determination of the content of hyaluronic acid

In order to detect whether the hyaluronic acid synthesis capacity of the mutant strain is reduced, single colonies of GX-PM, delta hyaD-GX-PM and mhiaD-GX-PM mutant strains are respectively picked on a plate, inoculated into a TSB+10% FBS culture medium, placed in a shaking table at 37 ℃ and shake-cultured for overnight at 160 r/min; day 2 at 1:1000 is transferred to 5mL of fresh culture medium, shake cultured at 37 ℃ until the OD ₆₀₀ is about 0.5, centrifuged for 15min at 7500g, the supernatant is discarded, washed twice with sterile PBS, resuspended in 1mL of PBS, and incubated at 42 ℃ for 1h;7500g was centrifuged for 15min and the supernatant transferred to a new EP tube; taking 2.5g/L CTAB 500 mu L in a clean EP tube, adding 500 mu L of sample supernatant, standing at room temperature for 5min, and measuring the reading value of OD ₄₀₀ by using a spectrophotometer; meanwhile, according to the method, the hyaluronic acid standard substance and CTAB are mixed, then the reading value is measured, and a standard curve is drawn; the content of hyaluronic acid in the sample was calculated.

As shown in fig. 19: the results show that: the content of hyaluronic acid of the Δ hyaD-GX-PM and mhyaD-GX-P mutants was significantly reduced compared to the GX-PM wild type strain.

4. Whole blood sterilization test

To compare the viability of GX-PM wild strain with that of Delta hyaD-GX-PM and mhyaD-GX-PM mutant strains in whole blood, single colonies were picked on plates, inoculated in TSB+10% FBS medium, placed in shaking tables at 37℃and shake-cultured overnight at 160 r/min; day 2at 1:1000 are transferred to 1mL of fresh culture medium, shake culture is carried out at 37 ℃ until the OD ₆₀₀ value is about 0.5, centrifugation is carried out for 5min at 5000r/min, supernatant is removed, thalli are washed twice by 1mL of PBS, and then the thalli are respectively diluted to the bacterial load of 10 ⁵ CFU/mL by the PBS; adding 100 μl of bacterial liquid into 900 μl of chicken whole blood containing heparin sodium anticoagulant, slowly rotating, standing at 37deg.C for 1 hr, and mixing every 15 min; after 1h of culture, 100 mu L of mixed blood is taken, diluted and coated with the plate and placed in a 37 ℃ incubator for standing overnight; the survival rate of the bacteria in whole blood was calculated (amount of bacteria after 1 hour of culture/initial amount of bacteria×100%).

As shown in fig. 20: wild strain GX-PM can still proliferate rapidly in whole blood, while the survival rate of delta hyaD-GX-PM and mhyaD-GX-PM mutant strains in whole blood is obviously reduced.

EXAMPLE 4 Delta hyaD-GX-PM and mhyaD-GX-PM attenuated vaccine pathogenicity test

1. Determination of chicken LD ₅₀ by recombinant strains of Delta hyaD-GX-PM and mhyaD-GX-PM mutant strains

To investigate whether the virulence of the mutant strain, which had lost the capsule synthesis ability, was reduced, the present study recorded the death of the chickens by intramuscular injection of 10 ⁷CFU、10⁸ CFU and 10 ⁹ CFU mutant strain and 10 ² CFU wild strain for 30 days old layer chickens, and continuous 14d observation.

As shown in fig. 21: at a GX-PM infection dose of 10 ² CFU, all chickens died within 24: 24h after challenge with 100% mortality. The Δ hyaD-GX-PM mutant did not cause death of chickens at an infection dose of 10 ⁷ CFU, whereas at an infection dose of 10 ⁸CFU、10⁹ CFU, the mortality was 50% and 100%, respectively, and LD ₅₀ was 1.0X10 ⁸ CFU. The mhyaD-GX-PM mutant did not cause death of chickens at various doses of infection, LD ₅₀＞1.0×10⁹ CFU. The above results demonstrate that both the Δ hyaD-GX-PM and mhyaD-GX-PM mutants had significantly reduced virulence compared to the wild type strain, and the mhyaD-GX-PM mutant had greater safety (Table 9).

Table 9 results of survival rate of ⁷、10⁸、10⁹ CFU recombinant infected chickens

Detection of tissue bacterial load of mhiaD-GX-PM recombinant strain

To investigate whether the mutant was rapidly cleared in the host resulting in a decrease in virulence, 10 ⁹CFU mhyaD-GX-PM、10⁷ CFU Δ hyaD-GX-PM mutant and 10 ² CFU GX-PM wild strain were intramuscular injected into 30 day old layer hens, respectively. At 1d after infection, the chicken heart, liver, lung, brain and blood were removed for detection of tissue load.

As shown in fig. 21: when artificially infecting 10 ⁹ CFU mhyaD-GX-PM and 10 ⁷ CFU delta hyaD-GX-PM mutant strains, the tissue bacterial load is obviously lower than that of chickens infected with 10 ² CFU wild strain groups. And, no bacteria have been detected in tissues and blood 3d after infection with the mutant strain. The above results demonstrate that mhyaD-GX-PM and Δ hyaD-GX-PM mutant strains are rapidly cleared in the host, resulting in a significant reduction in virulence.

EXAMPLE 5mhyaD-GX-PM attenuated vaccine immunoprotection efficacy study

The mhyaD-GX-PM mutant strain was grown to OD ₆₀₀ =0.5, and the bacterial load was about 10 ⁹ CFU/mL. After centrifugation of 5mL of the bacterial liquid, PBS was used for washing 2 times, and 1mL of PBS was used for resuspension of the bacterial cells to prepare 10 ⁹ CFU/200 uL of attenuated vaccine, and 200 uL of each chicken of the experimental group was injected. And boost once on day 7.

1. Detection of serum IgY antibodies

Chicken sera were collected from immunized group 14d and from the blank group, and the IgY antibody level in the sera was detected by ELISA. The optimal coating concentration of the antigen was determined to be 1X 10 ⁸ CFU/mL according to the square matrix experiment, and the optimal dilution was 1:400. GX-PM whole bacterial protein is used as a coating antigen, serum to be detected is used as a primary antibody, goat anti-chicken antibody is used as a secondary antibody, and the detection of the antibody level is carried out by indirect ELISA.

As shown in fig. 22: mhyaD-GX-PM recombinant strains can produce high levels of IgY antibodies against GX-PM after immunization for 14 d.

Immunoprotection efficiency of mhiaD-GX-PM recombinant strain on chickens

To study the immunoprotection efficiency of mhyaD-GX-PM recombinant strains on chickens, healthy broilers at 30 days of age were randomly divided into 3 groups of 4 broilers, each chicken was immunized by intramuscular injection of 10 ⁹ CFU of bacterial liquid with mhyaD-GX-PM recombinant strains, and PBS challenge groups and PBS blank groups were set. Immunization 14d, mhyaD-GX-PM recombinant strain and PBS challenge control group were artificially infected with 10 ³ CFU of GX-PM wild type strain by intramuscular injection. The death of the chickens was continuously observed and recorded after infection.

As shown in fig. 23: after the mhyaD-GX-PM recombinant strain is immunized for 14d, chickens infected with 10 ³ CFU GX-PM can be completely protected.

Other parts not described in detail are prior art. Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims

1. A mutant strain of avian pasteurella multocida hyaluronan synthase knockout, characterized in that: the mutant strain takes the Pasteurella multocida GX-PM as an original strain, and knocks out hyaD-X sequences on the genome of the Pasteurella multocida, wherein hyaD-X sequences are hyaD genes or a certain segment of sequences on hyaD genes; and the nucleotide sequence of hyaD gene is shown as SEQ ID NO. 1.

2. The mutant strain according to claim 1, wherein: the hyaD-X sequence is hyaD gene, the nucleotide sequence corresponding to amino acids 150 to 748 in the hyaD gene is hyaD-598aa, and the nucleotide sequence is shown as SEQ ID NO. 2.

3. A method of constructing a mutant strain of avian pasteurella multocida hyaluronate synthase knockout according to claim 1, comprising: the method comprises the following steps:

4. A method of construction according to claim 3, wherein: in the step S1, when the hyaD-X sequence is hyaD gene, the primers for amplifying the upstream left and right arms hyaD-L are as follows:

hyaD-L-F：aggtcgacggtatcgatagtagtgtgtaccaatgcgagg，

hyaD-L-R：aacacttgcattttattaaaaataaaatc；

The primers for amplifying the downstream left and right arms hyaD-R are:

hyaD-R-F：taataaaatgcaagtgtttttctgtccttaaaaaattaactttgc，

hyaD-R-R：ggaattcgatatcaagctcaacgagcaaaatactttctg；

The primers for amplifying the upstream left and right arms hyaD-598aa-L are:

hyaD-598aa-L-F：aagtcttttctttcgctttttgtaccatg，

hyaD-598aa-L-R：caggaattcgatatcaagctacgcctttacggtgcagctgatc；

The primers for amplifying the downstream left and right arms hyaD-598aa-R are:

hyaD-598aa-R-F：ggtcgacggtatcgataaactttattttgatcaatatctaataagatcac，

hyaD-598aa-R-R：aaagcgaaagaaaagacttaagaatcatcttacaccagatatc。

5. the construction method according to claim 4, wherein: when the hyaD-X sequence is hyaD gene, the delta hyaD-GX-PM is constructed by the following method:

6. A strain mhyaD-GX-PM with a mutation in the site of the hyaluronic acid synthase enzyme activity of pasteurella multocida, characterized in that: the strain mhyaD-GX-PM takes fowl Pasteurella multocida GX-PM as an original strain, and two glutamic acids at 247 th and 527 th in the HyaD protein amino acid sequence are mutated into aspartic acid.

7. A method for constructing strain mhyaD-GX-PM according to claim 6, wherein: the method comprises the following steps:

b. Ligating the sequence hyaD-598aa-L of claim 4, the hyaD-m sequence amplified in step a, and the sequence hyaD-598aa-R of claim 4, and cloning onto the pSHK5Ts-NgAgoDM plasmid backbone to construct a make-up mutant plasmid pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM;

c. the complementation mutant plasmid pSHK5Ts-hyaD-598aa-L-hyaD-m-R-NgAgoDM was electropositively transformed into the method of claim 5 to give Δ hyaD-598aa-GX-PM, resulting in strain mhyaD-GX-PM.

8. The construction method according to claim 1, wherein: in the step a, three pairs of primers are designed kuoz: