CN118324853A - Adeno-associated virus mutant and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biological medicines, and discloses an adeno-associated virus mutant and application thereof. The invention creatively simulates the blood brain barrier in vivo by using the method of using the brain-like chip in vitro, and efficiently screens adeno-associated virus mutants which penetrate the blood brain barrier and can infect nerve cells. The amino acid sequence of the AAV capsid protein mutant is shown in SEQ ID No.3 or 4. The invention also provides a recombinant adeno-associated virus comprising the AAV capsid protein mutant. The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant has high blood brain barrier penetrating efficiency and good infection effect, provides better gene therapy vector tools for nervous system diseases for patients with diseases, and has great clinical value and commercial application scene.

Description

Adeno-associated virus mutant and application thereof

Technical Field

The invention relates to the technical field of biological medicine, in particular to an adeno-associated virus mutant and application thereof.

Background

Adeno-associated viruses (AAV) are a class of non-enveloped small viruses that encapsulate a linear single-stranded DNA genome, belonging to the genus of dependent viruses of the family of parvoviridae, and require helper virus (usually adenovirus) for replication. AAV genomes are single-stranded DNA fragments contained in non-enveloped viral capsids and can be divided into three functional regions: two open reading frames (Rep gene, cap gene) and an Inverted Terminal Repeat (ITR). The recombinant adeno-associated virus vector (rAAV) is derived from a non-pathogenic wild adeno-associated virus, and is widely applied to gene therapy and vaccine research as a gene transfer vector due to the advantages of wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of exogenous genes, good diffusion performance, stable physical properties and the like. In medical research, rAAV is used in research (including in vivo and in vitro experiments) for gene therapy of various diseases, such as gene function research, construction of disease models, preparation of gene knockout mice, and the like.

The diseases of the nervous system are various and phenotypically complex, and the diseases affecting the Central Nervous System (CNS) have serious influence on the life quality and physical and mental health of patients, while the traditional drug therapies used at present have the disadvantages of non-durable curative effect and high off-target risk. In recent years, with the continuous development of in vivo AAV delivery vectors, gene editing technology, RNA interference and other molecular biology technologies, gene therapy may provide a long-term solution for targeting central nervous system monogenes and idiopathic diseases. AAV is currently the primary vector for in vivo delivery of transgenes to the CNS, with the ability to transduce efficiently, highly engineered cell targeting, low toxicity, and the potential to overcome physical barriers, which brings an exciting prospect and numerous examples of clinical success. Among them, genetic diseases of the nervous system represented by Spinal Muscular Atrophy (SMA) have been developed in recent years with breakthrough progress in gene therapy. For example Zolgensma is a gene therapy based on AAV type 9 vectors marketed in the united states in 2019 for the treatment of spinal muscular atrophy under 2 years of age with motor neuron survival gene 1 (SMN 1) allelic mutation. However, the cost of a single treatment is as high as 2 million dollars, which is associated with high intravenous doses, reaching 1.1E14 vg/kg. The use of large doses is not enough: on one hand, the difficulty of process development and control is high, and the production cost is high; on the other hand, the specificity is poor, and the hepatotoxicity is particularly obvious under the condition of systemic high-dose injection, so that the use risk is increased.

While AAV is one of the safest current gene therapy vectors, it has been widely used in the field of gene therapy. But are hampered by specificity problems, especially in the way of treatment by systemic injection across the blood brain barrier into the nervous system, the dosage requirements are higher, the cost and expense are also dramatically increased, and the patient is burdened. In addition, the potential toxic and side effects of the medicine are more obvious due to low specificity and high dosage. Given the need for successful gene therapy to allow efficient expression of therapeutic genes in target cells and to minimize side effects, the efficiency and targeting of the delivery vehicles is critical. Therefore, AAV which can cross the blood brain barrier, has better targeting of the nervous system and lower dosage requirement and cost is developed, and has important significance for clinical gene therapy of nervous system diseases.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide an adeno-associated virus mutant which can cross a blood brain barrier and target brain nerve cells and application thereof. The adeno-associated virus mutant has better targeting and lower dosage requirement.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

in a first aspect, the present invention provides a heterologous peptide capable of crossing the blood brain barrier and having a brain neural cell targeting property, wherein the amino acid sequence is shown in SEQ ID No.1 or 2.

In a second aspect, the present invention provides a nucleic acid encoding the heterologous peptide, the nucleotide sequence of which is shown in SEQ ID No.5 or 6.

In a third aspect, the invention provides an AAV capsid protein mutant comprising said heterologous peptide.

As a preferred embodiment of the AAV capsid protein mutant of the present invention, the AAV capsid protein mutant is obtained by inserting or replacing 5 to 20 amino acids of AAV capsid protein with the heterologous peptide.

As a preferred embodiment of the AAV capsid protein mutants of the invention, the insertion site of the heterologous peptide is located between amino acids 586 and 589 of AAV capsid protein VP 1.

Further, the insertion site of the heterologous peptide is between amino acids 588 and 589 of AAV9 VP 1.

As a preferred embodiment of the AAV capsid protein mutant of the present invention, the amino acid sequence is shown in SEQ ID No.3 or 4.

The invention takes AAV9 as a parent skeleton, and selects rAAV mutation containing 2 heterologous peptides and having mutant capsid proteins through several rounds of screening and enrichment of brain-like chips by using a directional screening method. The AAV capsid protein mutant of the present invention comprises a heterologous peptide having an amino acid sequence as set forth in SEQ ID No.1 or 2. The insertion site of the heterologous peptide is located between amino acids 588 and 589 of AAV capsid protein VP 1. The nucleotide sequence for encoding the heterologous peptide is shown as SEQ ID No.5 or 6.

The mutant has the capability of crossing blood brain barrier and nerve cell targeting of far exceeding the parental AAV9, and is a serotype mutant with excellent performance. Wherein the blood brain barrier crossing amount of AAV-M6 is about 5 times of AAV-PHP.eB. AAV-M8 spans approximately 3 times that of AAV-PHP.eB. Meanwhile, AAV-M6 crossing the blood brain barrier can efficiently and specifically infect nerve cells.

In a fourth aspect, the invention provides a nucleic acid encoding an AAV capsid protein mutant having a nucleotide sequence depicted in SEQ ID No.7 or 8.

In a fifth aspect, the invention provides a recombinant adeno-associated virus comprising the AAV capsid protein mutant.

The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant can cross the blood brain barrier, has strong nerve cell infection effect, better safety and wide application range.

As a preferred embodiment of the recombinant adeno-associated virus of the invention, a heterologous gene of interest is also included.

As a preferred embodiment of the recombinant adeno-associated virus of the invention, the heterologous gene of interest encodes any one of the gene products interference RNA, aptamer, endonuclease, guide RNA.

In a sixth aspect, the present invention provides the use of said heterologous peptide, said AAV capsid protein mutant, said recombinant adeno-associated virus in the manufacture of a medicament for delivering a gene product to a cell or tissue of a subject.

As a preferred embodiment of the use according to the invention, the cells are nerve cells.

In a seventh aspect, the present invention provides use of the heterologous peptide, the AAV capsid protein mutant, and the recombinant adeno-associated virus in the preparation of a delivery vehicle that spans the blood brain barrier in vivo and has brain neural cell targeting.

In an eighth aspect, the present invention uses the heterologous peptide, the AAV capsid protein mutant, and the recombinant adeno-associated virus as inactive ingredients in the preparation of a delivery kit for treating or preventing neurological diseases.

Compared with the prior art, the invention has the beneficial effects that:

The invention creatively combines the brain-like chip technology with the AAV screening technology to obtain some AAV virus mutants which cross the blood brain barrier and infect nerve cells. A batch of potential brain targeting AAV can be obtained rapidly, in a large scale and at lower cost, and the application risk caused by species difference can be avoided to a certain extent by using humanized cells. By utilizing a brain-like chip and a directional screening method, three rounds of gradient screening with gradually reduced AAV (AAV) virus input titer and gradually shortened incubation time are adopted, and 2 serotype mutants targeting the nervous system are obtained through screening. Wherein the blood brain barrier crossing amount of the mutant AAV-M6 is about 5 times that of AAV-PHP.eB. The mutant AAV-M8 spans approximately 3-fold greater than AAV-PHP.eB. The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant has stronger capability of crossing a blood brain barrier and infecting nerve cells, better safety and wide application range, provides better gene therapy vector tools for nervous system diseases for patients with wide diseases, and has huge clinical value and commercial application scenes.

Drawings

FIG. 1 is a schematic illustration of the construction of in vitro BBB biomimetic chip models, the construction of AAV libraries and three rounds of AAV screening based on BBB biomimetic chips; in fig. 1, (a) a schematic representation of a chip design comprising a medium storage layer, an upper chamber for cell seeding, a PET film separating the upper and lower layers, and a lower chamber for cell seeding; (B) cross-sectional view of BBB chip. Implanting astrocytes into the upper cavity to form a nerve cavity, and reversely implanting brain microvascular endothelial cells into the lower cavity to form a blood vessel cavity; (C) Construction of AAV heptapeptide variant libraries and library screening Using BBB model chips.

FIG. 2 is a representation of an in vitro BBB biomimetic chip model; in fig. 2, (a) monitoring blood brain barrier model cell transmembrane resistance (TEER) for 7 consecutive days; (B) Small molecule permeability experiments, adding a sodium Fluorescein (FLU) solution or fitc-glucan solution with a molecular weight of 40kDa or 70kDa into a vascular compartment of the BBB bionic chip model; after incubation for 2h, fluorescence signals were detected by fluorescence spectrophotometry from the neuro-ventricular sampling medium. Data are mean +/-SD of 3 independent experiments; significance was determined by two-way anova followed by mean comparison using Tukey's multiple comparison test; * Represents P <0.005; (C) Immunofluorescence staining detects ZO-1 tight junction protein expression; blue, DAPI stained nuclei; green, fitc stained ZO-1 protein.

FIG. 3 is a graph showing quantitative analysis and sequencing of genome copy numbers of 19 AAV variants obtained from three rounds of screening in the neural compartment of BBB chip model; in fig. 3, (a) quantitative analysis and sequencing of genome copy numbers of 19 AAV variants obtained from three rounds of screening in the BBB chip model neural chamber; data are mean +/-SD of 3 independent experiments; significance was determined by two-way anova followed by mean comparison using Tukey's multiple comparison test; * p <0.05, < p <0.001, < p <0.005; (B) Amino acid sequences of random heptapeptides inserted into capsid proteins of AAV-M6 and AAV-M8.

FIG. 4 is an analysis of the efficiency of two novel AAV across the BBB; in fig. 4, (a) compares the efficiency of 2 novel AAVs across the BBB; 200 mu L of 1×10 ¹⁰ GC/mL AAV suspension is added into a blood vessel chamber of the BBB chip model, a culture medium is extracted from the nerve chamber after 24 hours, and the AAV titer is determined by a qPCR method; data are mean +/-SD of 3 independent experiments; significance was determined by two-way anova followed by mean comparison using Tukey's multiple comparison test; ; * p <0.05, < p <0.001, < p <0.005; (B) change in TEER value upon addition of AAV; TEER values were continuously measured for BBB biomimetic chip models, with AAV added to the model on day 5, and TEER values were continuously monitored.

FIG. 5 is a characterization of in vitro AAV-M6 ability to cross the BBB; in FIG. 5, (A) 200. Mu.L of a virus suspension (1X 10 ¹⁰ GC/mL) containing AAV-M6 or AAV-PHP.eB control virus labeled with DYLIGHTTM amine reactive dye was added to the vascular lumen of the BBB model and incubated for 24 hours, then cells were labeled with viability tracking dye CMTPX; red, HA-1800 cells labeled with CMTPX; green, AAV labeled with DYLIGHTTM 488; (B) Quantitative analysis of AAV fluorescence in the HA-1800 cell layer of FIG. 5 was performed using Image J software; data are mean +/-SD of 3 independent experiments; significance was determined by two-way anova followed by mean comparison using Tukey's multiple comparison test; * P <0.005.

FIG. 6 is a graph depicting the transduction efficiency of AAV-M6 in astrocytes; in FIG. 6, (A) luciferase fluorescence (Fluc) detection of transfected HA-1800 cells after AAV-M6 crosses the BBB; (B) Quantitatively analyzing Fluc signal in AAV-infected HA-1800 cells; data are mean +/-SD of 3 independent experiments; significance was determined by two-way anova followed by mean comparison using Tukey's multiple comparison test; * P <0.005.

FIG. 7 is a molecular docking simulation of an insertion peptide in mutant AAV-M6 with a different AAV receptor protein; molecular docking of AV-M6 capsid insertion peptides with different AAV receptor proteins is simulated; in FIG. 7, molecular docking of the (A-E) receptor proteins LY6E, M6PR, MELTF, LY D or HBEFG (grey) with the inserted heptad residues (colored) in the AAV-M6 capsid were simulated; left diagram: a bar model of interacting residues; right figure: a space-filling model of receptor binding sites and heptad residues; (F) Binding energy between AAV-M6 heptapeptide sequence and LY6E, M, PR, MELTF, LY, 6D or HBEFG.

Detailed Description

For a better description of the objects, technical solutions and advantages of the present invention, the present invention will be further described with reference to the following specific examples. It will be appreciated by persons skilled in the art that the specific embodiments described herein are for purposes of illustration only and are not intended to be limiting.

The test methods used in the examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are all commercially available. The AAV capsid protein amino acid positions described herein correspond to AAV9 VP1 (GenBank accession number AY 530579.1), but are not limited to this serotype class.

Example 1: screening of novel mutants

(1) Construction of AAV9 capsid protein mutant library backbone plasmid

The backbone vector comprises an AAV5 p41 promoter fragment, an AAV2 rep splice signal sequence, and a mutant frame-shifted AAV9 CAP sequence (wherein the AAV9 CAP sequence is formed by mutating K of an original amino acid site 449 into R, mutating a nucleic acid sequence from tcaaag into tctaga, introducing an Xba I cleavage site, mutating a nucleic acid sequence of an amino acid G of an original amino acid site 594 into ggt from ggc, introducing a BshT I cleavage site, and simultaneously inserting a 34bp sequence containing a termination codon between the original amino acid site 588 and the site 589 to cause frame shifting of the sequence, avoid pollution caused by unclean cleavage of the backbone vector), and adding an SV40 polyA sequence after the CAP sequence. The sequences are synthesized by a gene synthesis method and inserted between ITR sequences of the rAAV vector to form AAV9 capsid protein mutant library skeleton plasmids.

(2) Construction of mutant Rep-CAP vectors

By introducing a stop codon into the N-terminal of VP1, VP2 and VP3 proteins of CAP sequence in AAV9, the Rep-CAP vector can normally express Rep protein and AAP protein, but can not express VP1, VP2 and VP3 proteins of CAP, thereby avoiding pollution of CAP sequence in parental AAV 9. The sequences were synthesized by gene synthesis and inserted into CAP sequences replacing the AAV9 Rep-CAP vector.

(3) Construction of a random 7 peptide vector library

2 Primers (5 '. Fwdarw.3') were designed as follows:

Primer 1: ACTCATCGACCAATACTTGTACTATCTCTCTAGAAC;

primer 2:

GTATTCCTTGGTTTTGAACCCAACCGGTCTGCGCCTGTGCMNNMNNMNN MNNMNNMNNMNNTTGGGCACTCTGGTGGTTTGTG。

One of the designed primers contains a 21bp nucleic acid sequence of a random 7 peptide, and PCR amplification is carried out by taking an AAV9 capsid protein mutant library skeleton vector as a template to obtain fragments containing the random sequence. And (3) carrying out gel electrophoresis and gel recovery on the fragments to obtain the nucleic acid fragments of the purified random 7 peptide library. The fragment was ligated into AAV9 capsid protein mutant library backbone vector by Gibson homologous recombination ligation (purified by XbaI and BshT I double cleavage and gel recovery). After the ligated vector was purified by the PCR product purification kit, it was digested with Plasmid-SAFE DNASE enzyme to remove the fragments that were not ligated. Finally purifying by a PCR product purification kit to obtain the constructed AAV9 random 7 peptide vector library, namely the AAV9 mutant plasmid library.

(4) Production of AAV9 Virus mutant libraries

The mutant Rep-Cap plasmid, AAV9 mutant plasmid library and pHelper plasmid are co-transferred into HEK-293T cells, iodixanol gradient ultra-high speed centrifugation is adopted to purify adeno-associated virus, the virus titer is measured to be 1X 10 ¹²GC/mL～1×10¹³ GC/mL as proper titer, and the AAV9 virus mutant library is obtained and placed at the temperature of minus 80 ℃ for standby.

(5) Screening of AAV9 mutants

(5.1) Brain-like chip screening procedure

Currently, most of the research on AAV crossing the blood brain barrier is based on animal model experiments. However, the results obtained in these experiments may not be reproducible in human clinical trials due to differences between species. In order to overcome the difference of blood brain barriers between species, the invention develops a bionic organ chip in vitro model of human blood brain barriers, which is used for carrying out multiple rounds of screening on AAV variants. Since a critical part of the blood brain barrier is the endothelial cell layer, which forms a tight junction preventing macromolecules from entering the brain from the blood by paracellular transport, the in vitro human blood brain barrier chip model described in this work builds up a layer of human brain microvascular endothelial cells (hCMEC/D3) and human astrocytes (HA-1800). The integrated bio-bionic chip comprises 24 independent functional units and can be used for high-throughput functional analysis of BBB related characteristics in parallel. Each cell contained an upper chamber, a lower chamber, and an intermediate layer for storage, separated by a PET film (fig. 1A). For the study of AAV across the BBB, a set of human blood brain barrier models was first constructed. 2.5X10 ⁶ cells/mL of human astrocytes (HA-1800) were seeded into the on-chip chamber (i.e.nerve lumen), and 1X10 ⁷ cells/mL of human brain microvascular endothelial cell (hCMEC/D3) suspension was seeded into the lower chamber (i.e.blood vessel lumen). The chip was then incubated on a precision shaker that was vibrated at 30 ° tilt at 2rpm to simulate blood flow velocity in humans (fig. 1B).

To assess barrier formation and stability prior to AAV screening, cell transmembrane resistance (TEER) values were measured daily for each compartment, starting with cell seeding. After hCMEC/D3 cell inoculation, TEER values gradually increased and tended to stabilize on day 5, indicating that the in vitro BBB model was established (FIG. 2A). In addition, a small molecule permeation assay was performed to measure the diffusion of sodium fluorescein solution (376 Da) or 40kDa or 70kDa FITC-dextran solution from the vascular compartment to the nerve compartment to assess barrier function at day 5 post inoculation. The permeability (Papp) estimated from fluorescence spectrophotometry showed a significant decrease in the number of each solute that could pass through the nerve cells compared to the respective control group, and the greater the solute, the lower the permeability across the membrane (fig. 2B), indicating that BBB barrier function has been established. Since BBB barrier function depends on high expression of specific proteins in endothelial cells, especially tight junction proteins such as ZO-1, ZO-1 expression in each chip was assessed by FITC staining at day 5 after model construction. As shown in FIG. 2C, ZO-1 protein was clearly detected in hCMEC/D3 cells by FITC staining on day 5 post-inoculation, indicating that ZO-1 protein was well expressed and barrier function was intact.

After BBB function was confirmed by TEER, complete AAV virus pools were inoculated into the vascular lumen of three replicate models and sequence enrichment was performed by controlling different screening conditions (progressive decrease in pool addition, progressive decrease in incubation time) for each screening round, and cells and supernatants for each round were collected for subsequent runs for a total of three screens.

(5.2) AAV genome extraction and amplification

AAV genomes in the screened cells or supernatants are extracted by a DNA extraction kit, and corresponding primers are designed for nested PCR amplification (first round of use (F (5 '. Fwdarw.3') ACTTCAACAGATTCCACTGCCACTTC, R (5 '. Fwdarw.3'): GCAATAAACAAGTTGGTCGACCATATG; second round of use (F (5 '. Fwdarw.3'): ACTCATCGACCAATACTTGTACTATCTCTCTAGAAC, R (5 '. Fwdarw.3'): GGAAGTATTCCTTGGTTTTGAACCCA)), the amplified PCR products are subjected to gel electrophoresis to confirm the size of the band, and the target band fragments are cut out, and the products are recovered by a gel recovery kit.

Wherein, screening the enriched AAV capsid protein mutant 6 (AAV-M6) and mutant 8 (AAV-M8), the VP1 has the amino acid sequence shown in SEQ ID No.3 and SEQ ID No.4, and the nucleotide sequence shown in SEQ ID No.7 and SEQ ID No. 8; the amino acid sequences of the targeting peptide in VP1 are shown as SEQ ID No.1 and SEQ ID No.2, and the nucleotide sequences are shown as SEQ ID No.5 and SEQ ID No. 6.

Example 2: construction of AAV capsid protein mutants and production of viruses

For the analytical screening of the function of enriching candidate serotypes, the enrichment sequences were constructed into Rep-CAP and the virus was packaged using the GOI plasmid carrying the reporter gene for subsequent verification.

(1) Construction of mutant serotype vector and plasmid extraction:

AAV9 Rep-CAP plasmid is digested with Smi I and BshT I, gel electrophoresis is carried out, and about 5000bp fragment band is cut off for gel recovery, so that digested skeleton fragment is obtained.

According to the Cap sequence of the mutant 6, the following primers are designed, and the specific steps are as follows: amplifying and colloid-recovering a target product mutant 6-1 by using a CAP-f+ mutant 6-R primer with a Rep-CAP plasmid of AAV9 as a template, amplifying and colloid-recovering a target product mutant 6-2 by using a mutant 6-F+ CAP-R primer with a Rep-CAP plasmid of AAV9 as a template, and recombining and constructing the Rep-CAP plasmid of mutant 6 by mixing a framework fragment, mutant 6-1 and mutant 6-2 according to the following steps and proportions;

according to the Cap sequence of the mutant 8, the following primers are designed, and the specific steps are as follows: amplifying and colloid-recovering a target product mutant 8-1 by using a CAP-f+ mutant 8-R primer with a Rep-CAP plasmid of AAV9 as a template, amplifying and colloid-recovering a target product mutant 8-2 by using a mutant 8-F+ CAP-R primer with a Rep-CAP plasmid of AAV9 as a template, and recombining and constructing the Rep-CAP plasmid of the mutant 8 by mixing a framework fragment, the mutant 8-1 and the mutant 8-2 according to the following steps and proportions;

the primers involved in the construction of the Rep-CAP vectors for AAV capsid mutants 6 and 8 above are shown in Table 1:

TABLE 1 primer sequences

Taking 1 clean 200uL PCR tube as a mark and placing the mark on an ice box, and cutting the enzyme-cleaved skeleton and each target fragment according to the skeleton: preparing a reaction solution with the fragment molar ratio of 1:3, and carrying out recombination connection in a PCR instrument at 50 ℃ for 30 min. Thawing 50 mu L of competent cells on ice, mixing 10 mu L of the ligation product with DH5 alpha competent cells, and standing on ice for 20-30 minutes; heat shock at 42 ℃ for 45 seconds; rapidly placing on ice for 2 minutes, adding 400 mu L of recovery SOC culture medium (without antibiotics), and culturing at 37 ℃ for 1h at 200 rpm; the mixture was spread on an Amp-resistant plate (50. Mu.g/mL) and incubated at 37℃for 14 hours. Monoclonal bacteria were selected and grown in 4mL of liquid LB medium (Amp+ resistant) for 14 hours at 37 ℃.

Centrifuging the bacterial liquid at 12000rpm for 1min, and pouring out the supernatant culture medium; adding 250 mu L of buffer P1/RNaseA mixed solution, and high-speed vortex to re-suspend bacteria; adding 250 mu L buffer P2, and reversing the above steps for 8 to 10 times; adding 350 mu L buffer P3, immediately reversing and uniformly mixing for 8-10 times to thoroughly neutralize the solution; centrifuging at 13000rpm for 10min, and collecting supernatant; centrifuging 12000 for 1min, pouring out the waste liquid, adding 500 mu L PW1, centrifuging 12000 for 1min, and pouring out the waste liquid; adding 600 μl of PW2, 12000 centrifuging for 1min, and removing supernatant; adding 600 μl of PW2, 12000 centrifuging for 1min, and removing supernatant; idle at 12000rpm for 2min; adding 30-50 mu L of preheated eluent at 55 ℃, standing for 2min, and centrifuging at 12000rpm for 1min. Concentration detection was performed using a micro nucleic acid quantitative instrument.

The obtained plasmid is subjected to concentration detection, 10 mu L of positive plasmid identified by enzyme digestion is taken and sequenced, and the positive plasmid is stored at-20 ℃. Sequencing results showed that the obtained plasmid was able to encode the variant capsid protein VP1. Finally, relevant Helper plasmids, each set of Rep-Cap plasmids (AAV 9 and the mutants described above) and GOI plasmids expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP) (ssaV.CAG.fluc-2 a-eGFP.WPRE.SV40 pA) were extracted according to the viral load required for the post-test.

(2) Packaging and purification of mutant serotype viruses

The obtained Rep-Cap plasmids of each group (AAV 9 and AAV mutant) as well as GOI plasmids expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP) and pHelper plasmids are co-transferred into HEK-293T cells in proper amounts, AAV viruses are purified by iodixanol gradient ultra-high speed centrifugation, and the virus titer is measured to be proper titer from 1E+11GC/mL to 1E+13GC/mL and placed at the temperature of minus 80 ℃ for standby.

Example 3: functional verification of mutant serotype viruses

(1) Ability of mutant serotypes to cross the BBB

For screening the enriched candidate serotypes, 19 serotype mutants were individually constructed and individually packaged into viruses for comparative analysis using BBB model chips. As a result, as shown in FIG. 3A, there were multiple serotype mutants that exhibited greater ability to cross the BBB, with AAV-M6 and AAV-M8 being the most effective (sequences shown in FIG. 3B). Thus, to further analyze the crossing efficiency of AAV-M6 and AAV-M8 variants, 200. Mu.L of a suspension containing each variant or AAV-PHP.eB control virus (1X 10 ¹⁰ GC/mL) was inoculated into the vascular cavity of the BBB model chip. After 6 hours of incubation, samples were taken from the neurospheres of each model to quantify the virus titer. qPCR analysis showed that the BBB crossing efficiency of AAV-M6 and AAV-M8 was significantly higher than AAV-PHP.eB, and that AAV-M6 accumulated approximately 5-fold of AAV-PHP.eB, and AAV-M8 was 3-fold of AAV-PHP.eB (FIG. 4A).

To investigate whether AAV-M6 and AAV-M8 are suitable for use in humans, further tests were performed to see if exposure to these AAV vectors or AAV-PHP.eB would compromise the integrity of the human BBB. For this purpose, TEER values were measured in the BBB model several days in succession after inoculation with AAV-M6 and AAV-M8 or AAV-php.eb to assess barrier integrity. Prior to addition of the virus suspension, cells were seeded into BBB chambers and barrier formation was then assessed for 5 days until steady state TEER was reached (fig. 4B). Then, as viral titer increases in cells, TEER was recorded two more days after transduction with candidate vector or AAV-php.eb. No significant changes in TEER were detected in any AAV group, indicating that none of these serotypes significantly affected the integrity of the BBB compared to control cultures without virus exposure.

On the basis of the verification of the high-efficiency crossing of AAV-M6 by the BBB, the in-vitro BBB crossing activity of AAV-M6 is further verified by live cell imaging in a BBB model. After BBB modeling (day 5), AAV-M6 or AAV9 labeled with DYLIGHTTM 488 amine reactive dye was added to the lower lumen. After 24 hours of incubation, hCMEC/D3 and HA-1800 cells in the BBB chip were washed to remove unbound virus and the cells were stained with viability tracking dye CMTPX for imaging with a multiphoton live cell microscope. AAV-M6, AAV9 and AAV-PHP.eB were all observed to reach the HA-1800 parenchymal cell layer (FIG. 5A), while image J quantitative analysis showed that AAV-M6 fluorescent signal was significantly stronger than AAV9 or AAV-PHP.eB, indicating that its titer was significantly higher than AAV9 or AAV-PHP.eB (FIG. 5B), consistent with our above results. Furthermore, AAV-M6 was found to enter HA-1800 cells in the in vitro BBB model, demonstrating that heptapeptide insertion did not negatively affect the ability of AAV-M6 to infect cells.

(2) Analysis of transduction efficiency of AAV-M6 in astrocytes

From the above results, AAV-M6 showed higher BBB crossing capacity in an in vitro model, and thus this variant was studied with great importance in subsequent functional experiments.

To verify the ability of AAV-M6 to cross the BBB and transduce HA-1800 cells in vitro, 200. Mu.L of AAV-M6 or AAV-PHP.eB suspension (1X 10 ¹⁰ GC/mL) was inoculated into the vascular compartment after barrier function establishment (day 5) was verified in the BBB model. After 24 hours of incubation, samples were taken from the nerve chamber and the medium was transferred to 96-well plates pre-seeded with 1X 10 ⁴ HA-1800 cells. After 5 days of culture, the results showed that AAV-M6 and AAV-PHP.eB did cross the endothelial cell layer and transduce HA-1800 cells (FIG. 6A). Quantitative analysis of AAV-infected HA-1800 cells showed significantly higher GFP fluorescence signal for AAV-M6-infected cells compared to AAV-PHP.eB-treated groups (FIG. 6B). Consistent with the above experimental results, these results further demonstrate that AAV-M6 is more capable of transducing brain parenchymal cells than AAV-PHP.eB after crossing the hCMEC/D3 cell layer.

(3) Molecular docking simulation

The present invention next investigated the molecular mechanism by which candidate AAV vectors cross the BBB, which is critical to vector development. It has been reported that, as a human homolog of the mouse lymphocyte antigen 6 complex locus a (LY 6A), lymphocyte antigen 6 complex locus E (LY 6E) may mediate AAV across BBBs 20, 29, while membrane proteins M6PR and MELTF and epidermal growth factor HBEGF may also be involved in endocytosis of AAV and transduction from endothelial cells. The present invention next performed molecular docking simulations to determine receptors responsible for AAV cell phagocytosis. Simulations with the heptapeptide sequence inserted at AAV-M6 capsid protein AA588-589 and LY6D, LY6E, M6PR, MELTF and HBEFG, using AlphaFold2, independent three-dimensional structure predictions were generated for each of these five proteins. Docking simulations of 50 nanoseconds (ns) (GROMACS 5.0) showed that LY6D and M6PR can stably interact with AAV-M6 heptapeptide capsid regions (fig. 7A-E). The list of residues that can interact with the heptad insert is shown in table 2.

TABLE 2 complete list of interacting residues in the molecular docking simulation of human viral receptor proteins and AAV-M6 heptapeptide insertion residues

Among them, M6PR has the highest binding energy (-22.81 kcal/mol) and the lowest Ki (0.12. Mu.M), which indicates that the complex formed is extremely stable and has extremely high affinity. Furthermore, LY6D binding energy was-19.83 kcal/mol, ki value (0.96. Mu.M) was also very low, which also means that the AAV variants can form high affinity, tightly-bound and stable receptor-ligand complexes (FIG. 7F).

Finally, it should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solution of the present invention may be modified or substituted equally without departing from the spirit and scope of the technical solution of the present invention.

Claims (14)

1. A heterologous peptide capable of crossing the blood brain barrier and having the brain nerve cell targeting function is characterized in that the amino acid sequence is shown as SEQ ID No.1 or 2.

2. A nucleic acid encoding the heterologous peptide of claim 1, wherein the nucleotide sequence is set forth in SEQ ID No.5 or 6.

3. An AAV capsid protein mutant comprising the heterologous peptide of claim 1.

4. The AAV capsid protein mutant according to claim 3, wherein said AAV capsid protein mutant is obtained by inserting or replacing 5 to 20 amino acids of an AAV capsid protein with said heterologous peptide.

5. The AAV capsid protein mutant according to claim 4, wherein the insertion site of the heterologous peptide is located between amino acids 586 and 589 of AAV capsid protein VP 1.

6. The AAV capsid protein mutant according to claim 5, wherein the amino acid sequence is shown in SEQ ID No.3 or 4.

7. A nucleic acid encoding an AAV capsid protein mutant, wherein the nucleotide sequence is shown in SEQ ID No.7 or 8.

8. A recombinant adeno-associated virus comprising an AAV capsid protein mutant according to any one of claims 3-6.

9. The recombinant adeno-associated virus of claim 8, further comprising a heterologous gene of interest.

10. The recombinant adeno-associated virus of claim 9, wherein the heterologous gene of interest encodes any one of a gene product of interfering RNA, an aptamer, an endonuclease, a guide RNA.

11. Use of the heterologous peptide of claim 1, the AAV capsid protein mutant of any one of claims 3-6, the recombinant adeno-associated virus of any one of claims 8-10 in the manufacture of a medicament for delivering a gene product to a cell or tissue of a subject.

12. The use according to claim 11, wherein the cells are nerve cells.

13. Use of the heterologous peptide of claim 1, the AAV capsid protein mutant of any one of claims 3-6, the recombinant adeno-associated virus of any one of claims 8-10 in the preparation of a delivery vehicle that spans the blood brain barrier in vivo and has brain neural cell targeting.

14. Use of the heterologous peptide of claim 1, the AAV capsid protein mutant of any one of claims 3-6, the recombinant adeno-associated virus of any one of claims 8-10 as a non-active ingredient in the preparation of a delivery medicament for the treatment or prevention of neurological disorders.