CN118272424A - Method for increasing oil content of soybean seeds - Google Patents

Abstract

The invention discloses a method for improving the oil content of soybean seeds, which is realized by carrying out mutation inhibition expression on a transcription factor gene GmLO a or GmLO b for regulating and controlling the synthesis of soybean procyanidins; the method screens proper target sites, utilizes a CRISPR/CAS9 system, inhibits and controls the expression of transcription factor genes GmLO a or GmLO b for procyanidine synthesis by knocking out target site bases, and further has no obvious influence on the morphology and hundred-grain weight of soybean plants and seeds on the premise of not changing the agronomic characters of the soybean plants and the seeds, but can effectively improve the oil content of the soybean, particularly improve the content of oleic acid and linoleic acid and reduce the content of linolenic acid.

Description

Method for increasing oil content of soybean seeds

Field of the art

The invention belongs to the technical field of crop breeding and genetic engineering, and particularly relates to a method for increasing oil content of soybean seeds.

(II) background art

Soybean (Glycine max) originates in china, is called Shushu in ancient times, and is cultivated in a long time and is widely planted in various places throughout the country. Due to high nutritional value, it is gradually spread from China to countries around the world. With the gradual improvement of national economy level and dietary structure adjustment, the domestic soybean yield cannot meet the rapidly-increased soybean demand, and the soybean import scale is increased year by year. In 2020, the imported amount of Chinese soybeans exceeds 1 million tons, accounting for 60% of the world's soybean export amount. The situation that the soybeans are excessively depended on import is unfavorable for national grain safety, excellent soybean germplasm resources are mined, and the national soybean quality and yield are improved.

The transgenic technology is used as an emerging breeding technology, breaks the defects of the traditional breeding technology, is a common means for researching the key gene function of soybean, and is also an important way for cultivating new soybean varieties. Since the commercialization of the first transgenic herbicide-resistant soybean product in the mid 90 s of the 20 th century, soybean has become one of the most important crops improved by modern biotechnology and one of the major commercial transgenic plants in the world. Genetic transformation methods for soybean include transient transformation and stable transformation. Among them, the gene gun method and the agrobacterium-mediated transformation method are the common methods for the current stable genetic transformation of soybean. The transformation of hairy roots or stable genetic transformation in soybeans through gene editing technology or overexpression is a common means for researching the functions of key genes of soybeans and is also an important way for cultivating new varieties of soybeans.

The soybean is used as an important oil crop in China, and the oil content and the quality are key indexes for measuring the quality of the soybean. The soybean seeds have an oil content of about 20% and are mainly composed of fatty acids, including saturated fatty acids mainly composed of palmitic acid and stearic acid, and unsaturated fatty acids mainly composed of oleic acid, linoleic acid and linolenic acid. Excessive intake of saturated fatty acids increases the risk of cardiovascular diseases, while intake of unsaturated fatty acids has effects of preventing cardiovascular diseases, reducing cholesterol content, and enhancing brain activity. The transgenic technology is used for excavating high-quality oily genes, and the cultivation of soybean germplasm resources with high oil content and high unsaturated fatty acid is one of important targets of soybean breeding at present.

(III) summary of the invention

The invention aims to provide a method for improving the oil content of soybean seeds, which adopts a transgenic technology to mutate gene GmLO a/b expressed in the synthesis process of soybean procyanidine, so as to improve the total oil content of the soybean seeds, thereby meeting the soybean breeding target.

The technical scheme adopted by the invention is as follows:

The invention provides a method for increasing the oil content of soybean seeds, which is realized by carrying out mutation inhibition expression on a transcription factor gene GmLO a or GmLO b for regulating and controlling the synthesis of soybean procyanidins; the nucleotide sequence of the gene GmLO a is SEQ ID NO:1+seq ID NO:2 (1-363 bp in SEQ ID NO:1 is an untranslated region at the 5 'end, 364-467bp, 665-919bp, 3809-3905bp, 4195-4209bp, 4380-4436bp, 4567-5068bp are exons, 468-664bp, 920-3808bp, 3906-4194bp, 4210-4379bp, 4437-4566bp, 5069-5091bp are introns, 2235-2770bp, 3783-4178bp in SEQ ID NO:2 is an exon, 1-2234bp, 2771-3782bp are introns, 4179-4556bp is an untranslated region at the 3' end), and the nucleotide sequence of gene GmLO b is SEQ ID NO:3+seq ID NO:4 (1-504 bp in SEQ ID NO:3 is an untranslated region at the 5 'end, 505-608bp, 836-1090bp is an exon, 609-835bp, 1091-4730bp is an intron, 55-151bp, 670-684bp, 883-939bp, 1083-1590bp, 3545-4107bp, 4327-4722bp is an exon, 1-54bp, 152-669bp, 685-882bp, 940-1082bp, 1591-3544bp, 4108-4326bp is an intron, 4723-5041bp is an untranslated region at the 3' end).

Further, the mutation includes knocking out one or more bases in the nucleotide sequence of gene GmLO a or gene GmLO b to cause a frame shift mutation, inhibiting expression of the gene.

Further, the target site of the frameshift mutation should satisfy the following conditions:

(1) In the CDS region of the gene; (2) a 20bp fragment upstream of NGG beginning with G; (3) does not span introns; (4) GC content greater than 40%; (5) not containing more than 4 consecutive T's.

Still further, the target site of the frameshift mutation is SEQ ID NO:1, the 3848 to 3867bp of the nucleotide sequence shown in the formula 1; or SEQ ID NO:4, and the nucleotide sequence is 94-113bp.

The GmLO a amino acid sequence of the invention is SEQ ID NO:5 (364-467 bp, 665-919bp, 3809-3905bp, 4195-4209bp, 4380-4436bp, 4567-5068bp in SEQ ID NO:1 and 2235-2770bp, 3783-4178bp in SEQ ID NO: 2), gmLO b has the amino acid sequence of SEQ ID NO:6 (505-608 bp, 836-1090bp in SEQ ID NO:3 and 55-151bp, 670-684bp, 883-939bp, 1083-1590bp, 3545-4107bp, 4327-4722bp in SEQ ID NO: 4).

Further, the variety of the soybean is soybean Williams 82.

The transgenic operation method for inhibiting GmLO a and GmLO8b gene expression provided by the invention comprises the following steps:

(1) Constructing gDNA fragments containing a mutation target site of GmLO a or GmLO b genes according to the CRISPR/CAS9 system, and connecting the gDNA fragments to a vector MDC123 to serve as a transgenic vector for genetic transformation of soybeans; the mutant target site refers to one or more of base knockouts of the target site;

(2) Transferring the transgenic vector into an agrobacterium strain LBA4404 by a heat shock method, and carrying out soybean genetic transformation by using agrobacterium liquid carrying vector plasmids;

(4) Taking cotyledonary node of cultivated soybean Williams 82 as an explant, and transferring a target gene expression frame into a genome of a transgenic soybean acceptor variety Williams 82 by using an agrobacterium-mediated transformation method;

(5) The cotyledonary node is screened by herbicide glufosinate and grows to obtain a GmLO a/b gene expression inhibiting transgenic soybean plant.

The invention also provides a method for cultivating the soybean plants with high oil content, which comprises the following steps: and (3) selfing the soybean T0 generation plant for inhibiting the expression of the transcription factor gene GmLO a or GmLO b, and continuously selfing the obtained T1 generation to obtain a T2 homozygous plant, namely the soybean plant with high oil content.

Transgenic identification of soybean transgenic plants of the invention: PCR primers are designed at two ends of a target sequence of the gene according to the position of the mutation target site designed in the CRISPR/CAS9 system in the gene, and the condition that the target sequence is edited in the soybean genome is detected.

Compared with the prior art, the invention has the beneficial effects that: the invention provides a method for improving the oil content of soybean seeds, which is to screen proper target sites, inhibit the expression of transcription factor genes GmLO a or GmLO b for regulating and controlling the synthesis of procyanidins by utilizing a CRISPR/CAS9 system through knocking out the bases of the target sites, so that the oil content of the soybean seeds, particularly the content of oleic acid and linoleic acid, can be effectively improved and the linolenic acid content can be reduced on the premise of not changing the agronomic characters of soybean plants and seeds, such as no obvious influence on the morphology and hundred-grain weight of the soybean seeds. The soybean seeds with high oil content are obtained by constructing GmLO a or GmLO b transformation vectors containing target site knockout, transforming conventional soybean varieties by an agrobacterium-mediated method, selfing T0 generation transgenic soybean plants, and continuously selfing the obtained T1 generation to obtain T2 homozygous plants, thus obtaining homozygous T2 generation plant seeds with increased oil content. In addition, the method can be used for improving the oil content of soybean by transgenic technology breeding.

(IV) description of the drawings

FIG. 1 is a bar graph showing RNA expression levels of target gene GmLO a/b in different tissues of Williams 82 soybean variety. A represents GmLO a; b represents GmLO B. S1-S6 represent seeds of different development periods, S1 is lower than 10mg; s2, 15-25mg; s3, 35mg-65mg; s4, 90mg-120mg; s5, 180mg-220mg; s6, 300mg-350mg.

FIG. 2, vector backbone plasmid map. pBlu/gRNA vector backbone plasmid map. Cas9 MDC123 vector backbone plasmid map.

FIG. 3, creation of mutant materials for gene GmLO a/b using CRISPR-CAS9 system. A, CRISPR-CAS9 expression transformation vector MDC123-LO8a/b graph; LB and RB are the left and right boundaries of the T-DNA region, respectively; guide RNA CASSETTE is gRNA, mutant TARGET SITE is a target site, a P35S cauliflower mosaic virus 35S promoter, a Bar glufosinate acetyltransferase gene, and a Tnos nopaline synthase gene terminator; B. the structure of gene GmLO a/b and the position of the CRISPR-CAS9 mutation target site on gene GmLO a/b; C. the sequence of the target site for mutation of gene GmLO a/b and the genetically mutated form of soybean mutant material created by genetic transformation of soybean. D. Alignment of expression of GmLO a in wild-type WT and mutant lines gmlo a#1 and alignment of expression of GmLO b in wild-type WT and mutant lines gmlo b#1, gmlo b#2.

FIG. 4, agronomic traits in the field for GmLO a/b mutant materials created by the CRISPR-CAS9 system. A. Seed morphology, plant height, and hundred weight.

FIG. 5, gmLO a/b change in dry seed oil content in mutant materials. A. Content of different components of wild type WT and gmlo a#1, gmlo8b#1, gmlo b#2 mutant lines dry seed fatty acid. The fatty acid component mainly comprises the following five components: palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3). B. Total fatty acid content in dry seeds of three mutant lines of wild type WT and gmlo a#1, gmlo8b#1, gmlo b#2. Significance analysis was performed by T-test (P <0.05; P < 0.01;) P < 0.001).

(Fifth) detailed description of the invention

The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:

the experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The soybean seeds of the embodiment of the invention are all selected from Williams82 (Williams 82) varieties.

Example 1 spatial and temporal expression analysis of genes of interest

1. Extraction of total RNA from plants

(1) Plant material treatment and material selection: the root, root nodule, stem of Williams 82 soybean variety, stem top meristem, leaf, flower, 1cm pod of soybean in the vegetative growth stage (4 weeks after seeding) and seeds in different development stages were taken as samples, and about 100mg of each sample was taken and rapidly placed in liquid nitrogen for freezing at-80 ℃. Wherein seeds in different development periods are divided into six periods S1-S6 according to the weight of the seeds, and S1 is lower than 10mg; s2, 15-25mg; s3, 35mg-65mg; s4, 90mg-120mg; s5, 180mg-220mg; s6, 300mg-350mg.

(2) Extracting total RNA of plants: after grinding each sample in step (1) in liquid nitrogen, 500. Mu.l of RNA-easy Isolation Reagent (available from Vazyme company) was added to approximately every 25mg of tissue, and the sample was thoroughly lysed by vigorous shaking or pipetting. Adding 2/5 volume of RNase-free ddH ₂ O into the above lysate, and turning up and down

Mixing, standing at room temperature for 5min. Centrifuging at 12,000rpm, collecting supernatant, adding equal volume of isopropanol, mixing, and standing at room temperature for 10min. After removing the supernatant at 12,000rpm, the precipitate was washed twice with 75% ethanol. After air-drying at room temperature, RNase-free ddH ₂ O was added. Thus, the extraction of the total RNA of the plants is completed.

2. Analysis of target Gene expression

The concentration of the total RNA sample of the plant extracted in (2) was determined with a NanoDrop-1000 (Thermo scientific). Reverse transcription was performed using a reverse transcription kit (PRIMESCRIPT ^TM RT REAGENT KIT WITH GDNA ERASER, takara) according to the product instructions to obtain cDNA of soybean in different tissues.

The cDNA is used as a template, and specific quantitative primers LO8a-qRT-F/R, LO b-qRT-F/R of a target gene GmLO a (the nucleotide sequence is shown as SEQ ID NO:1+SEQ ID NO:2 in an end-to-end connection) and GmLO b (the nucleotide sequence is shown as SEQ ID NO:3+SEQ ID NO:4 in an end-to-end connection) are designed.

LO8a-qRT-F：CTACCTCCTCCGACCACATC；

LO8a-qRT-R：GTCTCAAAGTTTGGCAGGCA；

LO8b-qRT-F：TCTCTCCAAAGAAGCCAGCA；

LO8b-qRT-R：TTGCTGTCCACCTCATTTGC。

By Roche LightThe 480 fluorescent quantitative PCR instrument performs PCR reaction and detects the fluorescence intensity in real time. The gene expression level was calculated according to the formula 2 ^-ΔCt (Δct=ct target gene-Ct reference gene) using soybean reference gene GmACTIN as a control. All experiments were repeated using three biology and two techniques. And drawing a bar graph according to the fluorescence quantification result, as shown in figure 1.

FIG. 1 shows that the target genes GmLO a and GmLO8b are mainly and highly expressed in the periods S1, S2 and S3 of flower, 1cm pod and soybean seed development, and the expression level is highest in the period S2 of seed development.

Example 2, genetic transformation of Soybean and identification of mutant Material

1. Construction of transformation vector MDC123-LO8a/b for frame shift mutation of target gene

The construction method of the vector is a two-step method, and the skeleton vector involved in the process is as follows: intermediate vector-pBlu-gRNA, final vector-Cas 9MDC 123. Vector pBlu-gRNA was purchased from Addgene (# 59188), the plasmid map is shown in FIG. 2A, vector Cas9MDC123 was purchased from Addgene (# 59184), and the plasmid map is shown in FIG. 2B. The vector diagram of the final transformation vector MDC123-LO8a/b for the frameshift mutation of the target gene is shown in FIG. 3A, wherein the Mutant TARGET SITE in the gRNA is the insertion position of the target sequence.

The target site should be selected to meet the following conditions:

(1) In the CDS region of the gene; (2) a 20bp fragment upstream of NGG beginning with G; (3) does not span introns; (4) GC content greater than 40%; (5) not containing more than 4 consecutive T's.

5 20Nt target sites a1-a5 and B1-B5 were selected based on CDS sequences of target genes (GmLO a, gmLO 8B) respectively via an online site (http:// skl. Scau. Edu. Cn /), the target site positions being shown in FIG. 3B, the target site base sequences being shown in Table 1), and upstream and downstream primers were designed for synthesizing each target site of the target genes (Table 1).

The target site a1 of the target gene (GmLO a) is located at SEQ ID NO:1, a target site a2 is located at 830-849bp, a target site a3 is located at 891-910bp, a target site a4 is located at 3848-3867bp, and a target site a5 is located at 4875-4894 bp.

The target site b1 of the target gene (GmLO b) is located at SEQ ID NO:4, the target site b2 is positioned at 94-113bp, the target site b3 is positioned at 889-908bp, the target site b4 is positioned at 1280-1299bp, and the target site b5 is positioned at 1311-1330 bp.

The corresponding upstream and downstream primers for each target site were incubated at 50℃for 6 hours. The reaction product (i.e., the target site sequence) was then ligated to the position pBlu-gRNA (BbsI cut) at instant TARGET SITE by T4 ligase and sequencing verified. The constructed intermediate vectors are respectively named as pBlu-gRNA-GmLO8a1、pBlu-gRNA-GmLO8a2、pBlu-gRNA-GmLO8a3、pBlu-gRNA-GmLO8a4、pBlu-gRNA-GmLO8a5、pBlu-gRNA-GmLO8b1、pBlu-gRNA-GmLO8b2、pBlu-gRNA-GmLO8b3、pBlu-gRNA3-GmLO8b4、pBlu-gRNA-GmLO8b5.

The 10 intermediate vectors were digested with the endonuclease EcoRI, and the gRNA fragments including the target site were recovered by gel. The gel recovered fragment was ligated with the vector Cas9 MDC123 (EcoRI cleavage) using T4 ligase and sequencing verified. The constructed final vector was designated MDC123-GmLO8a1、MDC123-GmLO8a2、MDC123-GmLO8a3、MDC123-GmLO8a4、MDC123-GmLO8a5、MDC123-GmLO8b1、MDC123-GmLO8b2、MDC123-GmLO8b3、MDC123-GmLO8b4、MDC123-GmLO8b5. and these 10 final vectors were transformed into Agrobacterium tumefaciens LBA4404 and K599 Agrobacterium rhizogenes, respectively, using a cold shock method.

2. Soybean rooting experiment verifies mutation efficiency of target site

The soybean rooting experiment refers to the use of agrobacterium rhizogenes to mediate soybean hypocotyl transformation. The effect of the target site can be verified according to the mutation condition of hairy roots growing in the soybean rooting experiment. The method comprises the steps of disinfecting and germinating seeds, preparing agrobacterium tumefaciens bacteria liquid, and carrying out statistics on induced hairy roots and hairy root mutation conditions.

(1) Sterilization and germination of seeds: selecting full and disease-spot-free seeds, and placing the seeds in a disposable plastic culture dish. Drying, sealing and sterilizing with chlorine generated by bleaching water and concentrated hydrochloric acid, blowing off the chlorine in an ultra-clean bench after 10-16 hours, and sowing in moist vermiculite for germination.

(2) Preparing agrobacterium liquid: sowing soybean and simultaneously starting the preparation of agrobacterium liquid. The K599 Agrobacterium rhizogenes containing 10 final vectors obtained in step 1 were streaked twice consecutively on YEP solid medium, respectively. All colonies grown on the second plate were collected in 1ml of YEP liquid medium containing 15% (v/v) glycerol, vortexed until uniform, 200. Mu.L of the bacterial liquid was aliquoted onto four YEP solid media and incubated overnight at 28 ℃. YEP liquid medium: 10g/L peptone, 5g/L yeast extract, 5g/L sodium chloride, water as solvent, pH7.0. The YEP solid culture medium is prepared by adding 20g/L agar into YEP liquid culture medium.

(3) Inducing hairy roots: after 5 days of soybean germination (i.e., the end of overnight culture of Agrobacterium), all colonies on the allogeneic YEP solid medium were collected in 5ml of sterile Milli-Q water and vortexed until uniform. Sucking a proper amount of bacterial liquid by using a 1ml injector, injecting the bacterial liquid for 3-4 times at cotyledonary node or hypocotyl near the cotyledonary node, planting the injected soybean seedlings in wet vermiculite, planting the wound below the vermiculite, and adding the vermiculite again to cover the wound completely if the wound grows out of the surface of the vermiculite in the growth process. Hairy roots are induced after about 14-21 days.

(4) Hairy root mutation condition statistics: the growing hairy roots were extracted for genome, sequenced and the mutation was counted (Table 1). The hairy root mutation efficiency of the vectors MDC123-GmLO a4 and MDC123-GmLO8b2 is the highest, and the vectors MDC123-GmLO a4 and MDC123-GmLO b2 are selected for stable soybean genetic transformation.

TABLE 1 target site position, primer sequences and mutation efficiency

The underlined lines in table 1 indicate PAM.

3. Stable soybean genetic transformation

The genetic transformation of the stable soybean adopts a soybean agrobacterium-mediated cotyledonary node transformation method, and comprises the steps of seed surface disinfection and germination, agrobacterium preparation, explant preparation, infection and co-culture, cluster bud induction, cluster bud elongation, rooting cultivation and the like.

(1) Sterilization and germination of seed surface: the surface of soybean seeds is sterilized by chlorine gas dry method. Picking up normal Williams 82 soybean seeds with full seeds, no disease spots and no hard mass, and arranging the seeds in a single layer in a disposable culture dish with the thickness of 90 mm or 15 mm; the dish was uncapped into a desiccator, a500 ml glass beaker was placed in the center of the desiccator, 100ml of standing white multipurpose bleaching water was measured with a measuring cylinder and added to the beaker, and 5ml of hydrochloric acid (GR) was sucked up with a 5ml pipette and slowly added to the beaker along the wall of the cup. The cover of the drier is quickly covered, the sealing of the vessel is ensured, and the vessel is kept standing overnight for 10 to 12 hours. After sterilization, the petri dish is capped and transferred to a sterile super clean bench, the cap of the disposable petri dish is opened, and residual chlorine is removed by blowing with strong wind for 2 hours. Sowing the sterilized seeds on a Germination Medium (GM) with the umbilicus facing downwards, wherein each dish contains about 12-16 seeds; the culture dishes are stacked, wrapped and sealed by a preservative film, and placed in a plant culture room (24 ℃ C., 18h illumination/6 h darkness, 140 mu mole/m ²/s illumination intensity) for 16-24 hours. The formula of GM: 20g/L sucrose, 4g/L agar, milli-Q water as solvent, pH 5.8, and sterilizing with high temperature and high pressure steam (121 ℃ C., 20 min).

(2) Preparation of agrobacterium: single colony of the agrobacterium tumefaciens LBA4404 with the vector MDC123-GmLO a4 or MDC123-GmLO b2 is picked into a YEP liquid culture medium added with antibiotics (final concentration 50mg/L kanamycin (kan) and final concentration 25mg/L rifamycin (Rif)), and shake culture is carried out at 28 ℃ and 250rpm for 24-36 hours, so that saturated bacterial liquid with the vector MDC123-GmLO a4 or MDC123-GmLO b2 is obtained; 0.6ml of the saturated bacterial liquid was aspirated into 300ml of YEP liquid medium supplemented with antibiotics (final concentration of 25mg/L kanamycin, final concentration of 12.5mg/L rifamycin), and expanded at 28℃and 250rpm for about 10 hours until OD650 = 0.8-1.0, and the cells were collected and resuspended in an equal volume of liquid co-culture medium (LCCM). The formula of the liquid co-culture medium comprises: b5 salt powder 0.321g/L, sucrose 30g/L, organic buffer 2 (N-morpholino) ethanol sulfonic acid (MES) 3.9g/L, water As solvent, pH5.4, sterilizing at 121 ℃ for 20min, cooling, adding suction filtration sterile gibberellin (GA 3), 6-benzyl adenine (6-BA), cysteine (Cys), dithiothreitol (DTT) and acetosyringone (As) under sterile environment, and the final concentrations are 0.25mg/L, 1.67mg/L, 400mg/L, 154.2mg/L and 200 mu mol/L respectively.

(3) Preparation of explants: the soybean seeds which are inflated and pollution-free in the step (1) are selected and placed in a sterile culture dish, the seeds are longitudinally cut by a surgical knife along the umbilicus, cotyledons and hypocotyls are evenly separated into two leaves, and the cotyledon sections are gently scratched for 2-5 times to remove seed coats and then used as explants for standby.

(4) Infection and co-cultivation: 50ml of the bacterial suspension in the step (2) is poured into a clean sterile disposable culture dish, and about 50 explants prepared in the step (3) are put into the dish, and infected for 30 minutes at room temperature, and bacterial liquid is frequently stirred during the infection, so that the explants are fully contacted with the fresh bacterial liquid. 30ml LCCM liquid culture medium is added into a sterile stainless steel square box with the specification of 24 x 16 x 5cm and paved with two layers of filter paper, the infected explant is taken out, agrobacterium liquid on the explant is thrown away, the paraxial surface is paved on the filter paper, and about 100 containers can be placed in each box. Sealing the stainless square box, placing the square box in a plant culture room, and culturing in the dark at 24 ℃ for 3-5 days.

(5) And (3) clustered bud induction: after the co-cultivation is finished, the elongated hypocotyl of the explant is cut off, about 0.5cm is reserved, the hypocotyl is inserted on a bud induction (SI) culture medium at an oblique angle of 30-45 degrees, the culture medium is sealed by a 3M ventilation adhesive tape and then is transferred into a plant culture room for 4 weeks for cultivation, and fresh SI culture medium is replaced every two weeks. The formula of the SI culture medium: b5 salt powder 0.321g/L, sucrose 30g/L, MES 3.9g/L, agar8g/L, water as solvent, pH 5.7, sterilizing at 121deg.C for 20min; when the temperature is reduced to about 50 ℃, sterile 6-benzyl adenine (6-BA), ticarcillin (Tic), cefradine (cef) and glufosinate are added for suction filtration, and the final concentration is 1.67mg/L, 250mg/L, 100mg/L and 5mg/L respectively.

(6) Elongation of cluster buds: after 4 weeks of clustered shoot induction, cotyledons were excised and transferred to Shoot Elongation (SE) medium, which was placed in a plant culture chamber for 2-8 weeks with fresh SE medium replaced every 2 weeks. The formulation of the SE medium: MS salt powder (containing vitamins) 4.43g/L, sucrose 30g/L, MES 0.59g/L, agar 8g/L, water as solvent, pH5.7, sterilizing at 121deg.C for 20min; when the temperature is reduced to about 50 ℃, aseptic asparagine (Asp), glutamine (Glu), indoleacetic acid (IAA), zeatin (ZR), GA3, tic and cef are added for suction filtration, and the final concentration is respectively 50mg/L, 0.1mg/L, 1mg/L, 0.5mg/L, 250mg/L and 100mg/L.

(7) Rooting cultivation: cutting young stems which extend for 3-4 cm in SE culture medium, dipping in indolebutyric acid (IBA) for 30s, inserting into rooting culture medium (RM), placing in plant culture room, taking out root seedlings from the culture medium after growing out roots after 7-14 days, cleaning the residual culture medium of the roots, transferring into soil, and transferring to greenhouse for culture, thus obtaining the transgenic soybean plants with resistance. The formula of RM medium: MS salt powder (containing vitamins) 4.43g/L, sucrose 20g/L, MES 0.59g/L, plant gel (phytagel) 4g/L, and water as solvent.

4. Identification of GmLO a/b mutant materials

(1) Extraction of plant genome

Rapid extraction of plant genome: taking a proper amount of the transgenic soybean plant leaves (50 mg) obtained in the step 3, putting the transgenic soybean plant leaves into a 2ml centrifuge tube, adding 200 μl of TPS extract (100 mM Tris-HCl,10mM EDTA,1M KCl,pH =8.0), vibrating and grinding, carrying out water bath at 65 ℃ for 20min, centrifuging at 12000rpm for 5min, transferring the supernatant to a new 1.5ml centrifuge tube, adding equal volume of isopropanol, reversing and mixing, standing at room temperature for 10min, centrifuging at 12000rpm for 5min, discarding the supernatant, adding 1ml of 75% alcohol to wash the precipitate, centrifuging at 3500rpm for 5min, discarding the supernatant, standing at room temperature for 10min, allowing the alcohol to completely evaporate, and adding 30ml of ddH ₂ O to dissolve the precipitate, thereby obtaining the genome of the transgenic soybean seedlings with resistance.

(2) Identification of GmLO a/b mutant materials

PCR amplification was performed using 1. Mu.l of plant genome solution as a template, and GmLO a/b gene target site both ends specific primers (LO8a-ID-F：GTGTGTCAAGAGAGCCGCTA;LO8a-ID-R：ACAGGAAACCACAGGGAATACAAG;LO8b-ID-F：GTGCGAGCAAATTGGGCATT;LO8b-ID-R：GAGGGAAGGGCGGAATATAA). Meanwhile, soybean Williams82 genomic DNA was used as a negative control, and water was used as a blank control. The target PCR product amplified by the specific primers is recovered, after sequencing, the sequencing result is compared with the genome sequence of the target gene, the result is shown as C in figure 3, 3 mutant strains are obtained by screening, the gmlo a#1 mutant strain has one base deletion at an exon (3848-3867 bp of the nucleotide sequence shown as SEQ ID NO: 1), the frame shift mutation is caused, and the amino acid sequence of the coding region is shown as SEQ ID NO: shown in figure 7; the gmlo b#1 mutant line has a deletion of 4 bases at an exon (94-113 bp of the nucleotide sequence shown in SEQ ID NO: 4), which results in a frame shift mutation, and the amino acid sequence of the coding region is shown as SEQ ID NO: shown as 8; the gmlo b#2 mutant line has 2 base deletion at the exon (94-113 bp of the nucleotide sequence shown in SEQ ID NO: 4), resulting in frame shift mutation, and the amino acid sequence of the coding region is shown as SEQ ID NO: shown at 9. As shown in fig. 3D, gmLO a in the gmlo a#1 mutant had a mismatch at amino acid 138 and expression was terminated prematurely; gmLO8b in the gmlo b#2 mutant had a mismatch at amino acid 139 and expression was terminated prematurely.

Example 3 agronomic trait identification of transgenic Soybean GmLO a/b mutant materials

The 3 mutant transgenic soybeans selected in example 2 were subjected to T0 generation selfing to obtain T1 generation, T1 generation was subjected to T2 generation selfing again, and the material with the T2 generation showing homozygosity at the target gene locus was selected for use in the subsequent experiments. The non-transgenic soybean variety Williams82 (Williams 82) is used as a receptor material (wild type WT) and is sown in Changxing test fields and greenhouses together with transgenic soybeans, and seed copying is carried out after the seeds are ripe.

(1) Agronomic traits

As shown in FIG. 4, gmLO mutant materials showed no obvious differences in plant growth status, plant height, seed morphology, hundred grain weight compared to wild type WT.

(2) Oil content determination

The seed samples were placed in an oven at 65 ℃ for 1-3 days until completely dried. The seed sample to be tested was ground with a prototype grinder and sorted with a 100 mesh screen. Extracting oil (i.e. fatty acid) from seed sample by heating methyl esterification extraction. The main components of the fatty acid comprise the following five components: palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3). These five components account for over 99.85% of the total fatty acid content, and other fatty acid types are not considered in breeding.

The oil content extracted from the seed samples was quantitatively determined by gas chromatography.

As shown in fig. 5, the gmlo a#1, gmlo b#1, gmlo b#2 mutant lines can significantly increase the oleic acid and linoleic acid content in the seeds, reduce the linolenic acid content, and increase the total oil content in the seeds.

Claims (7)

1. A method for increasing the oil content of soybean seeds, which is characterized in that the method is realized by mutating a transcription factor gene GmLO a or GmLO b for regulating and controlling the synthesis of soybean procyanidins and inhibiting the expression; the nucleotide sequence of the gene GmLO a is SEQ ID NO:1+seq ID NO:2, the nucleotide sequence of gene GmLO b is shown as SEQ ID NO:3+seq ID NO:4 end-to-end.

2. The method of claim 1, wherein the mutation comprises a knockout of one or more bases in the nucleotide sequence of gene GmLO a or gene GmLO b resulting in a frameshift mutation that inhibits expression of the gene.

3. The method of claim 2, wherein the target site of the frameshift mutation should satisfy the following condition:

(1) In the CDS region of the gene; (2) a 20bp fragment upstream of NGG beginning with G; (3) does not span introns; (4) GC content greater than 40%; (5) not containing more than 4 consecutive T's.

4. The method of claim 2 or 3, wherein the target site of the frameshift mutation is SEQ ID NO:1, the 3848 to 3867bp of the nucleotide sequence shown in the formula 1; or SEQ ID NO:4, and the nucleotide sequence is 94-113bp.

5. The method of claim 1 wherein the soybean variety is soybean williams 82.

6. The method of claim 1, wherein the transgenic procedure for inhibiting expression of the transcription factor genes GmLO a, gmLO8b is as follows:

(1) Constructing gDNA fragments containing a mutation target site of GmLO a or GmLO b genes according to the CRISPR/CAS9 system, and connecting the gDNA fragments to a vector MDC123 to serve as a transgenic vector for genetic transformation of soybeans; the mutant target site refers to one or more of base knockouts of the target site;

(2) Transferring the transgenic vector into an agrobacterium strain LBA4404 by a heat shock method, and carrying out soybean genetic transformation by using agrobacterium liquid carrying vector plasmids;

(4) Taking cotyledonary node of cultivated soybean Williams 82 as an explant, and transferring a target gene expression frame into a genome of a transgenic soybean acceptor variety Williams 82 by using an agrobacterium-mediated transformation method;

(5) The cotyledonary node is screened and grown by herbicide glufosinate to obtain GmLO a and GmLO8b gene expression inhibiting transgenic soybean plants.

7. A method of growing the high oil soybean plant of claim 1, said method comprising: and (3) selfing the soybean T0 generation plant for inhibiting the expression of the transcription factor gene GmLO a or GmLO b, and continuously selfing the obtained T1 generation to obtain a T2 homozygous plant, namely the soybean plant with high oil content.