CN118271417A

CN118271417A - Application of Zkscan4 1-133 peptide fragment in antidepressant

Info

Publication number: CN118271417A
Application number: CN202410414368.6A
Authority: CN
Inventors: 张岱; 高凯; 李俊; 孙晓璇; 刘河生
Original assignee: PEKING UNIVERSITY SIXTH HOSPITAL
Current assignee: PEKING UNIVERSITY SIXTH HOSPITAL
Filing date: 2024-04-08
Publication date: 2024-07-02

Abstract

The invention discloses an application of Zkscan41-133 peptide in antidepressant. The Zkscan41-133 peptide disclosed by the invention is as follows A1), A2) or A3): a1 Amino acid sequence is the protein at positions 1-133 of SEQ ID No. 2; a2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues for the amino acid sequence shown in the 1 st to 133 st positions of SEQ ID No.2 in the sequence table and has the same function; a3 A fusion protein obtained by ligating a tag to the N-terminal or/and the C-terminal of A1) or A2). The Zkscan-133 peptide can inhibit the expression of 5-hydroxytryptamine 2a receptor (Htr 2 a) in vivo, correct synaptic function abnormality and animal depression-like behavior caused by the abnormal expression of Htr2a, and has good application prospect.

Description

Application of Zkscan4 1-133 peptide fragment in antidepressant

Technical Field

The invention relates to application of Zkscan4 1-133 peptide in antidepressant in the biomedical field.

Background

Depression (Major depressive disorder, MDD) is a common, major mental disorder characterized by a marked and persistent mood depression, clinically manifested as persistent mood depression, hypointerest, loss of pleasure, thought and motor retardation, with sleep disorders, loss of appetite, etc. MDD affects about 10% of the population worldwide and is one of the main causes of disability and suicide.

The etiology of depression is largely unknown to date, and MDD is generally thought to be the result of interactions between genetic and environmental factors. The pathogenesis of depression has not yet been elucidated, and the deficiency of the central monoamine neurotransmitter (5-hydroxytryptamine and norepinephrine) functions is one of the most widely accepted hypotheses for depression. The principle of action of currently clinically used antidepressant drugs is mostly based on enhancing the function of these transmitters. First-line antidepressants are mainly selective 5-hydroxytryptamine reuptake inhibitors (SSRI such as fluoxetine, paroxetine, citalopram and escitalopram), 5-hydroxytryptamine and norepinephrine reuptake inhibitors (SNRI such as venlafaxine, duloxetine), monoamine receptor blockers (such as mirtazapine, etc.), monoamine oxidase inhibitors (MAOI such as molobetaine), etc. In general, the medicines have the limitations of slow onset of action, low anti-depression effective rate (the single medicine has the highest effective rate of about 50 percent, only 30 percent of patients can completely relieve), large toxic and side effects, high price, easy recurrence and the like. Whereas the rapid antidepressant drug ketamine that has emerged in recent years presents a risk of addiction.

Studies report that 5-hydroxytryptamine 2A (5-HT 2A) receptor is significantly higher than normal in brain and peripheral blood of depressed patients, that 5-HT2A receptor expression levels are significantly positively correlated with depression severity, duration of depressive symptoms, that 5-HT2A receptor expression is significantly reduced in depressed patients treated with antidepressant drugs compared to pre-treatment, suggesting that down-regulation of 5-HT2A receptor or normalization of 5-HT2A receptor-mediated signaling pathways may be critical for antidepressant treatment.

Disclosure of Invention

The technical problem to be solved by the invention is how to treat depression.

In order to solve the technical problems, the invention firstly provides application of protein (the name of which is Zkscan4 1-133) in preparing a product for treating or preventing depression;

Zkscan4 1-133 are the following A1), A2) or A3):

A1 Amino acid sequence is the protein at positions 1-133 of SEQ ID No. 2;

a2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues for the amino acid sequence shown in the 1 st to 133 st positions of SEQ ID No.2 in the sequence table and has the same function;

a3 A fusion protein obtained by ligating a tag to the N-terminal or/and the C-terminal of A1) or A2).

The protein of A2) has 75% or more identity with the amino acid sequence of the protein shown in positions 1-133 of SEQ ID No.2 and has the same function. Identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, by using blastp as a program, expect values are set to 10, all filters are set to OFF, BLOSUM62 is used as Matrix, gap existence cost, per residue gap cost and Lambda ratio are set to 11,1 and 0.85 (default values), respectively, and identity of a pair of amino acid sequences is searched for and calculated, and then the value (%) of identity can be obtained. The identity of 75% or more is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity.

The protein in A2) can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.

The gene encoding the protein in A2) above can be obtained by deleting one or more amino acid residues from the DNA sequence shown in positions 1 to 399 of SEQ ID No.3 and/or performing one or more base pair missense mutations and/or ligating the coding sequence of the tag at the 5 'end and/or 3' end thereof. Wherein the DNA molecule shown in positions 1-399 of SEQ ID No.3 encodes the protein shown in positions 1-133 of SEQ ID No. 2.

A3 The tag may be a polypeptide or protein that is fusion expressed with the protein of interest using in vitro recombinant DNA techniques to facilitate expression, detection, tracking and/or purification of the protein of interest. The tag may be a Poly-Arg, poly-His, FLAG, strep-tag II, c-myc, MBP tag, HA tag, GST tag, and/or SUMO tag, etc.

In order to solve the technical problems, the invention also provides application of the biological material related to Zkscan4 1-133 in preparing a product for treating or preventing depression; the biomaterial is any one of the following B1) to B5):

B1 A nucleic acid molecule encoding Zkscan4 1-133;

b2 An expression cassette comprising the nucleic acid molecule of B1);

B3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);

B4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

B5 A transgenic cell line comprising the nucleic acid molecule of B1) or a transgenic cell line comprising the expression cassette of B2).

In the above applications, the nucleic acid molecule of B1) may be B11) or B12) or B13) or B14) or B15) as follows:

b11 A DNA molecule of which the coding sequence is 1 st to 399 th positions of SEQ ID No.3 in a sequence table;

b12 DNA molecules shown in the 1 st-399 th positions of SEQ ID No.3 in the sequence table;

b13 A DNA molecule shown in SEQ ID No.3 of the sequence Listing;

b14 A DNA molecule which has 75% or more identity to the nucleotide sequence defined in b 11) or b 12) or b 13) and which encodes Zkscan4 1-133;

b15 A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in b 11) or b 12) or b 13) or b 14) and which codes for Zkscan4 1-133.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The nucleotide sequence encoding the Zkscan4 1-133 protein of the invention can be easily mutated by a person skilled in the art using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence of Zkscan4 1-133 protein isolated by the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode Zkscan4 1-133 protein and function as Zkscan4 1-133 protein.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of a protein consisting of the amino acid sequence shown in the coding sequence 1 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

In the above application, the stringent conditions may be as follows: hybridization at 50℃in a mixed solution of 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO ₄ and 1mM EDTA, rinsing in 2 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: hybridization at 50℃in a mixed solution of 7% SDS, 0.5M NaPO ₄ and 1mM EDTA, rinsing in 1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: hybridization at 50℃in a mixed solution of 7% SDS, 0.5M NaPO ₄ and 1mM EDTA, rinsing in 0.5 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: hybridization at 50℃in a mixed solution of 7% SDS, 0.5M NaPO ₄ and 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: hybridization at 50℃in a mixed solution of 7% SDS, 0.5M NaPO ₄ and 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 65 ℃; the method can also be as follows: hybridization was performed in a solution of 6 XSSC, 0.5% SDS at 65℃and then washed once with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS; the method can also be as follows: hybridization and washing the membrane 2 times at 68℃in a solution of 2 XSSC, 0.1% SDS for 5min each time, and hybridization and washing the membrane 2 times at 68℃in a solution of 0.5 XSSC, 0.1% SDS for 15min each time; the method can also be as follows: hybridization and washing of membranes were performed at 65℃in 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS solution.

The 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

In the above applications, the expression cassette (Zkscan-133 gene expression cassette) of B2) containing a nucleic acid molecule encoding Zkscan41-133 protein refers to DNA capable of expressing Zkscan41-133 protein in a host cell, and the DNA may include not only a promoter for initiating Zkscan41-133 gene transcription but also a terminator for terminating Zkscan41-133 gene transcription. Further, the expression cassette may also include an enhancer sequence.

Recombinant vectors containing the Zkscan4 1-133 gene expression cassette can be constructed using existing expression vectors.

In the above applications, the vector may be a plasmid, cosmid, phage or viral vector. The viral vector may be an adeno-associated virus.

B3 The recombinant vector may specifically be AAV-Zkscan-133 virus.

In the above application, the microorganism may be yeast, bacteria, algae or fungi.

In the above applications, the transgenic cell line does not include propagation material.

Use of Zkscan4 1-133 in the treatment or prevention of depression is also within the scope of the present invention.

The application of the biological material in treating or preventing depression also belongs to the protection scope of the invention.

In the above, the treatment or prevention of depression may be embodied in the following aspects: improving the reduction in the frequency of microscopic excitatory postsynaptic currents in a depressed animal, correcting social avoidance behavior in a depressed animal, correcting a lack of pleasure in a depressed animal (as reflected in a reduced sugar water preference in mice in one embodiment of the invention), and/or improving the destiny symptoms in a depressed animal (as reflected in an increased time of forced swim test and tail suspension test in mice in one embodiment of the invention).

The application of Zkscan4 1-133 in preparing antidepressant drugs also belongs to the protection scope of the invention.

The application of the biological material in preparing antidepressant drugs also belongs to the protection scope of the invention.

Wherein the antidepressant may be embodied as follows: improving the reduction in the frequency of microscopic excitatory postsynaptic currents in a depressed animal, correcting social avoidance behavior in a depressed animal, correcting a lack of pleasure in a depressed animal (as reflected in a reduced sugar water preference in mice in one embodiment of the invention), and/or improving the destiny symptoms in a depressed animal (as reflected in an increased time of forced swim test and tail suspension test in mice in one embodiment of the invention).

The invention also provides a product, the active ingredient of which can be Zkscan4 1-133 or the biological material.

The product can be used for treating or preventing depression and can also be used for preparing antidepressant drugs.

The animal may be a human or a mouse.

The Zkscan-133 peptide can inhibit Htr2a receptor expression in vivo, correct synaptic transmission abnormality and mouse depression-like behavior caused by Htr2a expression abnormality, provide a novel antidepressant polypeptide medicine for realizing the function of downregulating Htr2a to play a role in antidepressant, and have good application prospect.

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

Drawings

FIG. 1, zkscan identification of F1-generation knockout mice. The upper panel shows the detection result of the PCR product of the knockout mouse, and the lower panel shows the detection result of the PCR product of the wild mouse. B6 is a negative control, and the DNA template is genomic DNA of C57/B6J; n is a blank control, no template control; TRANS2K PLUS II band: the molecular weight of the DNA is standard, and the size is 5000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp; the DNA templates of lanes 10 and 12 are F1 generation knockout mice 10# and 12# and Zkscan4 gene deletion 6010bp; the DNA templates of lanes 11, 13 and 14 are F1 knockout mice 11#, 13#, 14#, and Zkscan4 gene deletion 5995bp.

FIG. 2, zkscan construction and detection of knockout mice. A, experimental CRISPR/Cas9 technology constructs Zkscan a schematic diagram of a Zkscan knockout mouse. B, zkscan4 mice genotype identification is schematically shown, zkscan 4. 4 ^-/- is Zkscan knockout mice homozygous, WT-F and WT-R cannot amplify DNA fragments with the size of 469bp, mut-F and Mut-R can amplify DNA fragments with the size of 577 bp; zkscan 4. 4 ^+/- is a Zkscan knockout mouse heterozygote, zkscan 4. 4 ^-/- is only 577bpDNA fragment; zkscan4 ^+/+ is a wild type mouse, only a DNA fragment of 469bp wild type. C, zkscan expression detection of the gene at mRNA level. D, in situ hybridization found that Zkscan4 knockout mice had no mRNA signal of Zkscan4 gene. E, immunoblotting detection Zkscan, knock-out mouse Zkscan protein expression.

Figure 3, subthreshold social frustration stress induced Zkscan a 4 knockout mouse depression-like behavior. A, a schematic diagram of subthreshold social frustration stress. B, socially detecting each group to represent the heat map. C, post-subthreshold stress, zkscan4 knockout mice exhibit a significant decrease in social rate (social time in social area when CD1 appears/time in social area when CD1 is absent). And D, the movement distance of each group of mice is not different in social detection. E, F, post-threshold stress Zkscan knockout mice had a reduced sugar water preference (E), but had no difference in total water intake from the other groups of mice (F). G, H, post-subthreshold Zkscan knockout mice have significantly increased immobility time in forced swimming (G) and tail-suspension experiments (H).

FIG. 4, zkscan4 knockout mouse hippocampal CA3-CA1 excitatory synaptic transmission abnormalities. A, electrophysiological detection schematic diagram. B, recorded trace plot representative of the postsynaptic excitatory current. C, zkscan4 knockout mice have significantly reduced frequency of postsynaptic excitatory currents. D, zkscan4 knockout mice were unchanged in the magnitude of the postsynaptic excitatory current.

FIG. 5, zkscan4 inhibits transcription of Htr2 a. mRNA levels of hippocampal Htr2a were elevated in A, zkscan4 knockout mice. B, C, zkscan4 knockout rat Htr2a protein expression elevation and statistics. D, chromatin co-immunoprecipitation found Zkscan4 to bind to the promoter of the Htr2a gene. E, double luciferase experiments found that Zkscan4 inhibited Htr2a expression, while inhibiting Zkscan expression followed by an increase in Htr2 a-initiated luciferase activity.

FIG. 6, zkscan4 mice knockdown were hippocampal injected with Zkscan-133 expressed virus. Fluorescent microscopy observation 3 weeks after virus injection showed expression of EGFP (green), blue as nuclei (DAPI-containing anti-fluorescence quenching caplets using Southern Biotech company, cat# 0100-20).

FIG. 7, zkscan, 41-133 rescue the expression of Htr2a in Zkscan knockout mice. A, zkscan, 41-133 rescue the increase in mRNA levels of Htr2 a. B, C, zkscan41-133 rescue the elevation of Htr2a protein level and statistical plots.

FIG. 8, zkscan 4.1-133, partially rescued Zkscan for excitotransmission abnormalities in the 4 knockout mice. A, a trace representative of the recorded postsynaptic excitatory current. B, zkscan parts 41-133 rescue Zkscan knockout mice from a decrease in the frequency of current after the mini-excitatory synapses. C Zkscan41-133 had no effect on the magnitude of the current after the micro-excitatory synapse of the Zkscan knockout mouse.

Figures 9, zkscan, 41-133 correct Zkscan knockout mice for depression-like behavior. A, B, zkscan, 41-133 correct heat and statistics of social avoidance behavior of Zkscan knockout mice. C-E, zkscan, 41-133 rescue Zkscan knockout mice with reduced sugar water preference (C), increased immobility time in forced swim test (D) and tail suspension test (E).

Detailed Description

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents, instruments and the like used in the examples described below are commercially available unless otherwise specified. The quantitative tests in the following examples were each set up at least three replicates. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.

The peptide fragments of examples 1, zkscan4 1-133 have antidepressant effect

The inventor firstly constructs Zkscan gene knockout mice, the obtained mice have depression-like behaviors, and then finds out that Zkscan4 1-133 peptide fragments in Zkscan gene knockout mice have the capability of regulating Htr2a expression, can correct depression-like behaviors caused by the increase of Htr2a expression, and prompts the antidepressant effect of Zkscan4 1-133 peptide fragments.

1. Preparation of Zkscan4 Gene knockout mice

1. Construction of Zkscan Gene knockout mice Using CRISPR-Cas9 technology

Zkscan4 knockout (Zkscan 4 ^-/-) mice with all three exons of Zkscan4 gene knocked out were constructed using CRISPR-Cas9 technology: injecting 4 pieces of artificially synthesized sgRNA (sgRNA-5 s1, sgRNA-5s2, sgRNA-3s1, sgRNA-3s 2) and Cas9 mRNA of the targeted Zkscan4 Gene (Gene ID:544922,updated on 5-Mar-2024) into fertilized eggs of C57/B6J background; the fertilized eggs obtained after injection were transplanted into C57/B6J mice to obtain F0-generation mice. The sgRNA target sequence used is shown in table 1 below, and Cas9 mRNA sequence is shown in SEQ ID No. 1.

TABLE 1 sgRNA sequences

The positive F0 generation is obtained by PCR screening and backcrossed with a wild type C57/B6J mouse, and then the positive F1 generation is obtained by PCR screening (shown in figure 1 and figure 2). In the screened mouse 10# and 12# genomes, the Zkscan gene of one chromosome is unchanged, the 6010bp of the other chromosome Zkscan gene is deleted (a segment from 5'UTR to 3' UTR of Zkscan gene is deleted, A in fig. 2), and the sequence deletion condition is as follows:

GTAGGTGACACCTCTGCAGCTGTGCCTTTGGTGAC (deletion 6010 bp) CCAGCAGTTTTCTCCTGAATGGATGGTTCCGGATT.

In the screened genome of mice 11#, 13#, 14#, zkscan gene of one chromosome is unchanged, 5995bp of the other chromosome Zkscan gene is deleted (a segment from 5'UTR to 3' UTR of Zkscan gene is deleted, A in fig. 2), and the sequence deletion condition is as follows:

ACCTCTGCAGCTGTGCCTTTGGTGACCCAGAGCAC (deletion 5995 bp) TCGTAGCCAGCAGTTTTCTCCTGAATGGATGGTTC.

All mice were bred with heterozygous mice and identified by PCR (primers shown in table 2) to give wild type (Zkscan, 4, ^+/+), heterozygous knockout (Zkscan, ^+/-) and homozygous knockout (Zkscan, ^-/-) littermates (B in fig. 2).

Table 2.Zkscan4 knock-out mouse identification primers

The Zkscan gene was tested for expression at the mRNA level using the primers Zkscan-F: AAGGTGGCAGTGGTGACA; zkscan4-R: GTCTCAGGCTTCATTTCCAG, the internal reference is beta-actin, and the internal reference primer is beta-actin-F: TGTGATGGTGGGAATGGGTCAGAA; beta-actin-R TGTGGTGCCAGATCTTCTCCATGT. The results (C in FIG. 2) showed that the Zkscan gene expression levels were significantly higher in wild-type mice than in heterozygous and homozygous knockout mice.

In situ hybridization assay Zkscan for expression of Zkscan gene in mice with knockdown of Zkscan on mRNA level, using ADVANCED CELL Diagnostics product (cat No. 485521) as hybridization probe Zkscan, the results (D in FIG. 2) showed that homozygous knockdown mice had no mRNA signal for Zkscan gene.

Immunoblotting detection Zkscan the expression of Zkscan protein in the knockout mouse Zkscan, and the antibody used was Zkscan antibody of Wohan Ebolac Biotechnology Co. The results (E in fig. 2) show that the Zkscan protein content of wild type mice is significantly higher than that of homozygous knockout mice.

Mice matched in age were randomly assigned to each experimental group. All experimental mice were fed with food and water in a standard feeding regimen, 4-5 cages, automatically controlled 12 hour circadian rhythm (20:00 lights off).

2. The behavioural test shows that the stress sensitivity of Zkscan4 knockout mice is increased, the mice to be tested with depression-like behaviors are offspring of 11#, 13#, and 14# when the mice are subjected to subthreshold stress, and the ages of the mice are 2-3 months.

Subthreshold social frustration stress: subthreshold social frustration stress was used to assess stress susceptibility in experimental mice. The experimental mice (including wild mice and homozygous knockout mice of the litters) were placed in a cage with a baffle (a transparent plastic baffle with dense small holes so that the mice on both sides can still see each other and smell but cannot touch each other), the CD1 male mice were on the same side, CD1 was in direct contact with and challenged the experimental mice for 5 minutes, then the experimental mice were moved to the other side of the baffle, the previous steps were repeated every day with replacement of the experimental mice into another, unfamiliar cage of CD1 male mice, and then the experimental mice were removed and kept alone for 4 days, and social examination was performed after 24 hours.

Wherein, CD1 male mice (5-8 months old) are produced by Vetong Liwa or Style Bei Fu (Beijing) biotechnology limited company, and are raised in solitary, and food and water are self-obtained.

Social detection: social detection is performed according to literature-described methods. Firstly, a special device for social detection is ordered, an open field device (length 42cm, width 42cm, height 42 cm) and two empty metal grids (length 10cm, width 6.5cm, height 42 cm) which can be freely inserted into the open field device are arranged, one of the devices is specially used for putting in CD1 male mice, and the other device is not used for putting in CD1 male mice. During social detection, an empty metal grid is inserted into an open field device, then an experimental mouse is placed into the open field area to freely explore for 2.5 minutes, and the movement and exploration time of the mouse are recorded by using an Ethovision 8.5Noldus system automatic tracking system. After 30 seconds, the empty metal mesh was replaced with another metal mesh with a new CD1 mouse, the experimental mouse was then placed in the open field for 2.5 minutes, and the time and distance of activity of the experimental mouse in the social area were recorded. Social ratios were calculated as follows: when CD1 male mice appear, experimental mice search time in social areas/experimental mice search time in social areas without CD1 male mice, the experimental mice are defined as stress susceptibility when the social ratio is less than 1, and the experimental mice are defined as stress resistance when the social ratio is greater than or equal to 1. After the recording is finished, the experimental mice are put back into the rearing cage.

Sugar water preference experiment: the mice to be tested are adapted to two water bottles (one is filled with tap water and the other is filled with 1% sucrose water) for 3 days, sucrose water is changed into tap water for two days again, the mice are bred in the solitary mode on the fifth day 17:00, only food is provided and no water is provided, one bottle of weighed tap water starts to be provided at the night 19:00, one bottle of 1% sucrose water is freely selected, the positions of the tap water and the sugar water are changed once every 1.5 hours for removing the position preference (19:00-23:30) of the mice, then the water bottles are placed still until 9:00 in the morning on the next day, and weighing is performed again. The sugar water preference is calculated as weight of sugar water consumed x 100%/(weight of sugar water consumed + weight of tap water consumed). After the experiment is finished, the experimental mice are put back into the rearing cage.

Forced swimming: the mice to be tested are put into a cylindrical plastic forced swimming bucket (25 cm in height and 20cm in diameter) filled with room-temperature tap water, the water depth is about 18cm, the temperature of the water is 22-25 ℃, the mice are put into the water to be forced swimming for 6 minutes, the SMART 3.0 software is used for analyzing the image pixel change, and the immobility time of the mice in the last 4 minutes is counted. After the recording is finished, the experimental mice are put back into the rearing cage.

Tail suspension experiment: tail suspension experiments used tail suspension boxes (PHM-300, med company) to suspend the tail of the mice on hooks for 6 min, data were analyzed by Med company tail suspension software, and the sum of the time under the threshold of the mice at the last 4 min was counted to obtain the immobility time of the mice. After the recording is finished, the experimental mice are put back into the rearing cage.

Results as shown in fig. 3, following subthreshold stress, zkscan4 knockout mice exhibited a significant decrease in social ratio (social time in social area when CD1 occurred/time in social area when CD1 was absent) (C in fig. 3); the movement distance of each group of mice was not different at the time of social detection (D in fig. 3); sugar water preference was reduced in post-subliminal stress Zkscan4 knockout mice (fig. 3E), but total water intake was not different from other groups of mice (fig. 3F); post-threshold stress Zkscan4 knockout mice have significantly increased immobility time in forced swimming (G in fig. 3) and tail-suspension experiments (H in fig. 3). It was shown that Zkscan4 knockout mice have depression-like behavior.

3. Electrophysiological experiments find that Zkscan4 knockout mice have reduced excitatory synaptic transmission frequency

Mice to be tested are offspring of # 11, # 13 and # 14, and the ages of the mice are 2-3 months.

The experimental method is as follows: preparation of ex vivo brain tablets: the experiments used Zkscan4 knockout mice and their littermates wild-type control mice at 8-12 weeks of age. Taking out a pre-cooled (0 ℃) and mixed gas oxygenated (95% oxygen: 5% carbon dioxide; volume ratio) phosphate buffer solution of an experimental mouse under a state of deep anesthesia after isoflurane is inhaled, carrying out heart perfusion on the experimental mouse by using 30mL buffer solution, pouring the rest buffer solution into a pre-cooled slice box (0 ℃) and continuously filling the mixed gas, quickly taking out the brain after the perfusion is finished, repairing the bilateral temporal lobes including the hippocampal brain region by using a blade, fixing the brain tissue block on a slice disc by using glue, then placing the slice disc fixed with the hippocampal tissue block into the slice box, and carrying out vibration slicing by using a vibration slicer (Leica, VT 1000S), wherein the slicing angle is a coronal section, and the slicing thickness is 350 mu m. the excised brain pieces were pipetted into an incubator previously filled with pre-heated (32 ℃) and oxygenated artificial cerebrospinal fluid for 40 minutes, after which the incubator was left to stand at room temperature (22 ℃) for at least one hour. Under room temperature, the recording tank is placed on a microscope (600-FN, nikon), the recording tank is filled with circulating artificial cerebrospinal fluid, the flow rate is 3-4ml per minute, brain slices in the incubation box are transferred into the immersed recording tank by a suction tube and are lightly pressed and fixed by a nylon net, a stimulating electrode made of platinum iridium gold wire wrapped by double Teflon is placed on an axon (Schaffer side branch) of a CA3 cone neuron of the Hippocampus towards a CA1 area radiation layer (Stratum radium), a silicon boron glass electrode (resistance 1-3MΩ) drawn by a drawing instrument (P-97, sutter) is poured into an internal liquid ACSF to serve as a recording electrode, it was placed on the Schaffer lateral branch of the CA1 zone radiation layer approximately 300-400 μm from the stimulating electrode for recording extracellular signals. Whole cell recording: after pyramidal neurons in the CA1 region are found by using an infrared differential interference phase difference (IR-DIC) microscope, a borosilicate glass electrode (resistance 3-6MΩ) drawn by a glass electrode drawing instrument is filled into intracellular fluid (internal solution) to serve as a recording electrode, and a whole-cell record (whole cell recording) is formed with the pyramidal neurons. Cells were clamped at-60 mV and a final concentration of 100 μm GABAa receptor antagonist Picrotoxin (PTX) and a final concentration of 1 μm na+ channel blocker tetrodotoxin (TTX) were added to the circulation and a minimal postsynaptic excitatory current was recorded (miniature excitatory post-synaptic current, mEPSC); Cells were clamped at 0mV, and a final concentration of 20. Mu.M of the AMPA receptor antagonist CNQX, a final concentration of 50. Mu.M of the NMDA receptor antagonist D-AP5, and a final concentration of 1. Mu.M of TTX were added to the circulation and a minimal postsynaptic inhibitory current was recorded (miniature inhibitory post-syntropic current, mIPSC). The processing of the electrophysiological signal is done by a digital to analog converter (Digidata 1440A,Molecular Devices) and an amplifier (Multiclamp B700, molecular Devices), the signal is filtered to 2kHz and the sampling frequency is 10-20kHz. Signal recording was done by software pCLAMP 10 (Molecular Devices). The field potential data analysis software was Clampfit 10 (Molecular Devices). The analysis software for the postsynaptic excitatory current (mEPSC) and postsynaptic inhibitory current (mIPSC) was MINI ANALYSIS (Synaptosoft). Brain slices with field potential maxima less than 0.5mV do not enter the data analysis. Non-entry analysis of whole cell series resistance ranges from 10-25mΩ, cells that varied by more than 20% during the recording were not included in the analysis. the medicines PTX, CNQX, D-AP5 and TTX are Sigma company products.

As a result, as shown in fig. 4, the frequency of the post-micro-synaptic excitation current of Zkscan4 knockout mice was significantly reduced (C in fig. 4), and the amplitude of the post-micro-synaptic excitation current was unchanged before and after Zkscan knockout (D in fig. 4).

4. Using RNA sequencing techniques, the Zkscan4 knockout mice were found to have significantly elevated Htr2a expression; and Htr2a expression is regulated by Zkscan gene.

Mice to be tested are offspring of # 11, # 13 and # 14, and the ages of the mice are 2-3 months. The results are shown in FIG. 5.

Sequencing RNA: the Zkscan4 knockout mice and their littermates after experiencing subthreshold stress extract hippocampal tissue. The samples were then sent to Beijing Boolor classical biotechnology limited for high throughput RNA sequencing using Illumina. The original sequencing data used the genome of the mice as reference sequences, using P <0.05 and the fold difference |log2ratio| >0.5 as thresholds for differentially expressed genes.

Western blot: hippocampus tissue was dissected using RIPA lysate, 1% Triton X-100, protease inhibitor on ice for 15min, then centrifuged at 12000rpm for 10 min at 4deg.C, the supernatant was assayed for protein using BCA protein assay kit, and then 1ug/ul of protein was prepared using loading buffer, denatured at 95deg.C for 10 min, and 5-25ul of sample was loaded. Protein electrophoresis was performed using 7% or 10% nupage gels, and then proteins were transferred onto nitrocellulose membranes using a constant current of 200 mA. At room temperature, 5% -10% skimmed milk is used for sealing for 1 hour, PBST (TWEEN 20 PBS) is used for washing three times for 5 minutes each time, then the corresponding primary antibody is added, and the mixture is placed in a chromatography cabinet at 4 ℃ for overnight incubation. The next day was washed three times with PBST for 5 minutes each, then secondary antibodies of the corresponding species were added for 1 hour at room temperature and then developed. The primary antibody is anti-Htr2a (Immunostar, cat# 24288) and the secondary antibody is horseradish enzyme-labeled goat anti-rabbit IgG (Beijing Ding Guo Changchun biotechnology Co., cat# IH-0011).

Fluorescent quantitative PCR: the hippocampal tissue is used for extracting total RNA by using Trizol reagent according to standard operation of the specification, determining the RNA amount, then carrying out reverse transcription of the first strand of cDNA, preparing a corresponding reaction system by using 2XSYBR green mix, and using primers as shown in the following table; the reaction was performed for 40 cycles using a fluorescent quantitative PCR instrument, and finally the relative expression level of the gene was calculated using LIGHTCYCLE and 96 application software.

Chromatin co-immunoprecipitation: the preparation was performed using EZ ChIP ^TM immunoprecipitation kit (Millipore Co., ltd., cat. No. 17-731) standard procedure, in brief, the hippocampal tissue was removed, crosslinked with freshly prepared formaldehyde, nucleoprotein was isolated and sonicated to break DNA, then incubated overnight in a corresponding antibody 4℃chromatography cabinet, eluted the next day in the order of low-salt-high-salt-lithium chloride eluent-TE eluent, and then the DNA was recovered after decrosslinking and then subjected to PCR detection.

The results (FIG. 5) show that Zkscan4 knockdown mice had elevated levels of mRNA for Htr2a with primers Htr2a-F: TAATGCAATTAGGTGACGACTCG; htr2a-R: GCAGGAGAGGTTGGTTCTGTTT, the internal reference is beta-actin, and the internal reference primer is beta-actin-F: TGTGATGGTGGGAATGGGTCAGAA; beta-actin-R TGTGGTGCCAGATCTTCTCCATGT. The Htr2a content increases; chromatin co-immunoprecipitation found Zkscan4 to bind to the promoter of the Htr2a gene; double luciferase experiments found that Zkscan4 inhibited the expression of Htr2a, while interfering with the increase in Htr2 a-initiated luciferase activity following Zkscan4 expression.

2. Detection of antidepressant action of Zkscan4 1-133 peptide fragment

5. Intra-brain injection Zkscan-133 can inhibit the increase of Htr2a expression in the brain of Zkscan knockout mice

The therapeutic effect of Zkscan4 1-133 on depression was examined using adeno-associated virus capable of expressing Zkscan4 1-133 peptide fragment (sequence of which is positions 1-133 of SEQ ID No.2 in the sequence Listing) and EGFP fusion protein, as follows:

Virus construction: the coding gene of Zkscan41-133 peptide (the sequence of which is SEQ ID No.3 in the sequence table) is constructed into an adeno-associated virus vector to obtain a recombinant vector pAAV-CamKII-Zkscan-133-3 XFlag-P2A-EGFP-WPRE (and Meta Biotechnology (Shanghai) Co., ltd., vector number H28738), and a vector pAAV-CaMKIIa-EGFP-3xFLAG-WPRE vector (and Meta Biotechnology (Shanghai) Co., ltd., vector number AOV 012) which does not express Zkscan41-133 peptide is used as a control. The construction steps of the viral vector are as follows:

1) Total RNA from the hippocampal tissue of mice was extracted using RNASIMPLE Total RNA extraction kit (Tiangen Biochemical technology (Beijing), inc., cat# DP 419). The first strand of mouse cDNA was then reverse transcribed using total RNA as template using FASTKING CDNA first strand synthesis kit (Tiangen Biochemical technologies (Beijing), inc., cat. No. KR 116). Using the primer-1 and the primer-3, performing PCR (polymerase chain reaction) by taking a first strand of the cDNA obtained by reverse transcription as a template, and cutting and recycling to obtain a fragment a; using primer-2 and primer-3, performing PCR with empty vector of pAAV-CaMKIIa-EGFP-3xFLAG-WPRE (and vector number AOV012 of Meta Biotechnology (Shanghai) Co., ltd.) as template, and cutting gel and recovering to obtain fragment b; and using NheI and HindIII to enzyme-cut pAAV-CamKII-EGFP-3xFlag-WPRE empty vector and cutting gel to recover cut vector fragment c, then using Gibson assembly (NEB company, cat. E2611S) to seamlessly clone fusion fragments a, b, c to obtain recombinant vector with correct sequence, namely pAAV-CamKII-Zkscan4 1-133-3XFlag-P2A-EGFP-WPRE vector (and Meta biotechnology (Shanghai) Co., ltd., vector number H28738).

Primer-1 AAACCCCGGTCCGGCTAGCGCCACCATGGCTAGAGAACCCGGAACGTCCGCAGCCC;

primer-2: CGCTGCTGGAGTACTTGGACAGGCAGCTGGACTACAAGGATGACGATGACAAGGATTACAAAG;

Primer-3: TCGATAACCGGTTTAAAGCTTTTACTTGTACAGCTCGTCCATGCCGAG.

2) The pAAV-CamKII-Zkscan41-133-3XFlag-P2A-EGFP-WPRE vector was co-transfected into AAV-293 cells (providing the trans-acting factors required for AAV replication and packaging) with pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes). Recombinant AAV was assembled in packaging cells 2 to 3 days post transfection.

3) AAV viral particles are collected from infected AAV-293 cells, typically the AAV particles are enriched in packaging cells, so that a substantial portion of the AAV particles can be recovered by collecting the cells and then lysing the cells to release the AAV particles to the supernatant.

4) Concentrating and purifying the virus supernatant of step 3), wherein the primary supernatant contains a plurality of cellular protein molecules and fragments, and most of the cellular proteins and residual gradient liquid can be removed by density gradient centrifugation and ultrafiltration.

5) The titer of the obtained virus was measured by quantitative PCR to obtain the physical titer value of AAV genome packed in particles, and the virus titer was 1.0X10 ¹² or more.

The AAV virus (hereinafter referred to as AAV-Zkscan, 41-133 virus) obtained contains the Zkscan, 41-133, XFlag-P2A-EGFP encoding gene shown in SEQ ID No.3, and is capable of expressing Zkscan, 41-133, 3, XFlag-P2A-EGFP shown in SEQ ID No. 2.

According to the steps, the pAAV-CamKII-Zkscan, 41-133-3XFlag-P2A-EGFP-WPRE vector is replaced by the pAAV-CamkII-EGFP-3xFLAG-WPRE vector, so that the control virus is obtained.

Stereotactic injection: all surgical procedures were performed on pentobarbital sodium anesthetized mice at a concentration of 0.7% pentobarbital sodium at a dose of 0.1ml/10g. After the mice to be tested are anesthetized, fixing the mice on a stereotactic instrument, exposing the bones of the mice, injecting viruses (titer 1.0X10 ¹²) on both sides by using a microsyringe (Hamilton microsyringe), and injecting the sea horse CA3 brain region with the coordinates of AP of-2.6 mm by using a Bregma point as the origin of coordinates; ML +/2.5 mm; DV-3.0 mm. All mice were injected with virus three weeks after birth (fig. 6), and then allowed to recover for at least 4 weeks, virus refractive positions and virus expression were verified using expression of EGFP and immunoblotting. The mice used were Zkscan4 ^-/- mice, AAV-Zkscan41-133 or control viruses, and Zkscan4 ^+/+ mice were injected with control viruses as controls.

As shown in FIG. 7, the results show that Zkscan knockout mouse Htr2a expression is increased, and Zkscan4 1-133 can reduce the expression level of Htr2a in Zkscan knockout mouse. Antibody was used: anti-Htr2a (Immunostar, cat. No. 24288) and the secondary antibody was horseradish enzyme-labeled goat anti-rabbit IgG (Beijing Ding Guo Changchun Biotechnology Co., ltd., cat. No. IH-0011).

6. Correction of Zkscan knockout mice by intracerebral injection Zkscan-133 reduction in excitatory synaptic transmission frequency

And (3) recovering the mice obtained in the step (5) for 4 weeks, and then carrying out an electrophysiological experiment, wherein the electrophysiological experiment is carried out according to the step (3).

As shown in FIG. 8, zkscan41-133 can partially rescue Zkscan the frequency of the tiny excitatory postsynaptic current in the knockout mouse (B in FIG. 8); zkscan41-133 had no effect on the magnitude of the micro-excitatory postsynaptic current of the Zkscan knockout mouse (C in FIG. 8).

7. Intra-brain injection Zkscan41,41-133 reduced rescue-induced depression-like behavior in ZKscan4 knockout mice

And 4, recovering the mice obtained in the step 5 for 4 weeks, and performing a behavioural experiment according to the step 2.

As shown in FIG. 9, zkscan, 41-133, can correct the social avoidance behavior of Zkscan, knockout mice (A, B in FIG. 9); zkscan 41A 41-133 also corrected the lack of pleasure in Zkscan knockout mice (C in FIG. 9) and the increase in immobility time in forced swim tests (D in FIG. 9) and tail suspension tests (E in FIG. 9). It is stated that Zkscan that 41-133 can treat depression in mice.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains.

Claims

1. Use of a protein for the preparation of a product for the treatment or prevention of depression;

The protein is A1), A2) or A3) as follows:

A1 Amino acid sequence is the protein at positions 1-133 of SEQ ID No. 2;

2. Use of a biomaterial related to the protein of claim 1 for the preparation of a product for the treatment or prevention of depression; the biomaterial is any one of the following B1) to B5):

b1 A nucleic acid molecule encoding the protein of claim 1;

b2 An expression cassette comprising the nucleic acid molecule of B1);

3. The use according to claim 2, characterized in that: b1 The nucleic acid molecule is b 11) or b 12) or b 13) or b 14) or b 15) as follows:

b13 A DNA molecule shown in SEQ ID No.3 of the sequence Listing;

b14 A DNA molecule which has 75% or more identity to the nucleotide sequence defined in b 11) or b 12) or b 13) and which encodes a protein according to claim 1;

b15 A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in b 11) or b 12) or b 13) or b 14) and which codes for a protein according to claim 1.

4. Use of a protein as claimed in claim 1 for the treatment or prophylaxis of depression.

5. Use of the biomaterial according to claim 2 or 3 for the treatment or prophylaxis of depression.

6. Use according to any one of claims 1-5, characterized in that: the treatment or prevention of depression is manifested in improving the reduction in frequency of microscopic excitatory postsynaptic currents in a depressed animal, correcting social avoidance behavior in an animal, correcting a lack of pleasure in a depressed animal, and/or correcting a destiny symptom in a depressed animal.

7. Use of a protein as claimed in claim 1 in the manufacture of an antidepressant.

8. Use of the biomaterial according to claim 2 or 3 for the manufacture of an antidepressant.

9. Use according to claim 7 or 8, characterized in that: the anti-depression is characterized by improving the reduction in frequency of micro-excitatory postsynaptic currents in a depressed animal, correcting social avoidance behavior in a depressed animal, correcting a lack of hedonia in a depressed animal, and/or improving the desperate symptoms in a depressed animal.

10. A product comprising as an active ingredient the protein of claim 1 or the biomaterial of claim 2 or 3.