CN118215508A

CN118215508A - Double AAV8 vector system for coding otoabnormal protein isoform 5 and application thereof

Info

Publication number: CN118215508A
Application number: CN202280074731.3A
Authority: CN
Inventors: S·萨菲丁; C·珀蒂; M-J·勒孔特; G·拉赫卢
Original assignee: Assistance Publique Hopitaux de Paris APHP; Institut Pasteur de Lille
Current assignee: Assistance Publique Hopitaux de Paris APHP; Institut Pasteur de Lille
Priority date: 2021-09-10
Filing date: 2022-09-09
Publication date: 2024-06-18

Abstract

The invention is based on the observation that: a dual AAV vector strategy encoding the cDNA of the otoxin isoform 5, which has been split into two expression cassettes both packaged in and delivered by AAV8 capsids, can effectively deliver the otoxin cDNA to the Inner Hair Cells (IHCs). Furthermore, the inventors emphasized that the use of the CMV promoter in one of the two AAV8 vectors provided significant expression of the teratogens in these specific cells. Since the AAV serotypes and promoter types used are two key elements that have a significant impact on transduction efficiency, the development of the vector system of the invention will provide the best therapeutic benefit for patients suffering from DFNB deafness. To further enhance this therapeutic effect, the inventors finally tested some specific dual vector constructs encoding otoabnormal proteins to identify enhanced transfection rates and very efficient in vitro and in vivo expression of otoabnormal proteins that lead to their hearing recovery in the mature cochlea of the DFNB mouse model.

Description

Double AAV8 vector system for coding otoabnormal protein isoform 5 and application thereof

Summary of The Invention

The invention is based on the observation that: a dual AAV vector strategy encoding an eartenascin isoform 5cDNA, which has been split into two expression cassettes both packaged in and delivered by AAV8 capsids, can effectively deliver the eartenascin cDNA to Inner Hair Cells (IHCs). Furthermore, the inventors emphasized that the use of the CMV promoter in one of the two AAV8 vectors provided significant expression of the teratogens in these specific cells. Since AAV serotypes and the promoter type used are two key elements that have a significant impact on transduction efficiency, the development of the vector system of the invention will provide the best therapeutic benefit for patients suffering from DFNB deafness. To further enhance this therapeutic effect, the inventors finally tested some specific dual vector constructs encoding otoabnormal proteins to identify enhanced transfection rates and very efficient in vitro and in vivo expression of otoabnormal proteins that lead to their hearing recovery in the mature cochlea of the DFNB mouse model.

Background

More than half of cases of non-symptomatic severe congenital deafness have genetic causes, most (about 80%) being in the autosomal recessive inherited (DFNB) form (Duman D. & Tekin M, front Biosci (LANDMARK ED) 17:2213-2236 (2012)). Gene diagnosis of deafness provides important information for cochlear gene therapy, and the accuracy and accessibility of gene detection have progressed rapidly over the past few years. The symptomatic deafness gene mutation can be identified many years before the patient develops symptoms, thereby providing time for disease management planning.

The protein encoded by the deafness gene has various molecular functions that are important for cochlear functions such as development of sensory organs, sound transduction in the hair cell static cilia, maintenance of intra-cochlear potential (EP), and high concentration of extracellular potassium, as well as synaptic neurotransmission between hair cells and Spiral Ganglion Neurons (SGNs). Major proteins produced by the deafness gene include ion channels and transporters, gap junctions and tight junctions, protein subunits in cytoskeleton and molecular motor, and transiently expressed transcription factors in the development of the ear snail. Whether mutations affect early cochlear development and lead to significant cellular degeneration is a major factor in determining the "treatment time window", a key issue in this therapeutic area.

Prosthetic cochlear implants are currently used for rehabilitation (Kral A & O' Donoghue GM N Engl J Med363 (15): 1438-1450 (2010)), but hearing recovery is far from perfect, especially speech perception or music perception in noisy environments, because of the inherent limitations on frequency resolution caused by inter-channel electrical interference.

The main motivation for developing biological therapies is to restore hearing without implanting any prosthetic devices and achieve much better sound resolution quality and unit cost than can be achieved with current cochlear implants. In particular, it has been proposed to treat human forms of deafness using local adeno-associated virus (AAV) -mediated gene therapy (Zhang et al Frontiers in Molecular Neuroscience, vol.11, art.221, 2018). Currently, this method is being tested against a variety of genetic disorders, including parkinson's disease, vision disorders, and metabolic disorders, in various preclinical and clinical trials.

Such tests for hearing loss have not been performed in humans, but the anatomy of the human inner ear is ideal for in vivo gene therapy methods, as the relatively separated liquid-filled compartments provide opportunities for local application of the virus and are less risky to spread.

AAV8 serotypes with a hybrid CMV enhancer/chicken beta-actin promoter (CAG promoter) have been demonstrated to specifically target cochlea and vestibular hair cells in the past decade (Emptoz et al Proc NATL ACAD SCI U S A.2017Sep 5;114 (36): 9695-9700). With this AAV configuration, hearing was restored in DFNB mice models, hearing and balance were improved (Delmaghani et al.Cell.2015Nov5;163(4):894-906;Emptoz et al.Proc Natl Acad Sci U S A.2017Sep5;114(36):9695-9700;Dulon et al.J Clin Invest.2018Aug 1;128(8):3382-3401). in both Usher 1G and IIIA syndrome mice models, and a first principle verification was generated indicating that dual AAV gene therapy could reverse the deafness phenotype in mice models with a severe form of deafness, DFNB, which holds promise for future gene therapy for DFNB9 patients. Notably, dual AAV therapy not only prevented hearing loss in these mutant mice, but hearing was restored in mice injected after hearing appearance. These results bring a strong hope for future gene therapy trials in DFNB (Akil et al. Proc NATL ACAD SCI U SA.2019Mar 5;116 (10): 4496-4501).

The development of vectors with optimized properties, including enhanced targeting specificity to ensure specific infection of defective cells, and high levels of expression of the affected proteins in these specific cells, currently appears to be an important step in the development of curative gene therapies for hereditary inner ear defects.

Disclosure of Invention

Against this background, the inventors devised new therapeutic recombinant vectors that could be used in DFNB a pre-clinical trial. These vectors differ from the prior art in that they express isoform 5 of human teratogens, are placed under the control of a CMV promoter, optionally followed by an intron sequence, and they are packaged in AAV8 capsids, specifically targeting endohair cells (IHCs). Their comparison determines that the specific construct effectively encodes the otoxin isoform 5 at the correct location, at the correct level, at the correct time, and thus yields the optimal therapeutic effect.

It is well known that the packaging capacity of AAV is exceeded by the otoxin cDNA sequence (6 kb). Thus, the double AAV vector strategy was employed in a manner similar to that successfully used in previous mouse studies (Akil et al Proc NATL ACAD SCI U S A.2019Mar5; 116 (10): 4496-4501). The cDNA of the cochlear isoform (isoform 5) and the novel isoform) of the expected human otoxin is split into two expression cassettes, both delivered by AAV8 vectors. Since the efficacy of double AAV transfer may be affected by cleavage sites within the otoxin cDNA, multiple cleavage sites between exons encoding the otoxin transcripts were studied. The corresponding 5' and 3' portions of the human otoxin cDNA were cloned into a shuttle vector with AAV Inverted Terminal Repeats (ITRs), and a ubiquitin CMV promoter (ubiquitous CMV promoter) was inserted upstream of the 5' human otoxin cDNA, optionally followed by an intron sequence. The different bipartite was then tested in vitro by transfecting HEK293 cells using liposomes as vector and assessing OTOF expression using immunocytochemistry and western blot 48 hours after transfection (fig. 3,5 and 7). The recombinant efficacy of various double AAV OTOF vectors to produce full length proteins was further studied by RT-PCR (fig. 7A). By verifying the accuracy of the recombinant regions producing the full-length protein, further studies were made of the dual vectors that showed the best transfection efficiency and most efficient in vitro protein expression. The dual expression cassette was then packaged in AAV8 capsid and delivered in vivo to the cochlea of the DFNB mouse model. Immune confocal microscopy was used to determine whether or not the teratogen was correctly targeted to IHC following cochlear AAV delivery. The recovery of hearing in mice was assessed by recording auditory evoked brainstem response at various stages after AAV delivery.

The otoxin is abundantly expressed in sensory IHC of the cochlea. It is also expressed in other cells of the central nervous system. It plays a key role in the final step of fusion of the cochlear hair cell synapses with synaptic vesicles that afferent spiral ganglion neurons. More precisely, it is important for exocytosis at auditory zone synapses (Roux et al, cell 127 (2): 277-89, 2006). In humans, mutations affecting the otoxin gene ("OTOF gene") can lead to severe non-symptomatic bilateral hearing loss after birth but before language is obtained. Some of these also lead to temperature-sensitive non-syndromic auditory neuropathy, which is triggered when body temperature increases significantly (e.g. in the case of fever, please see Marlin S.et al,Biochemical and Biophysical Research Communications,394(2010)737-742;Varga R.et al,J.Med.Genet 2006;43:576-581;Zhang Q.et al,Hearing research,Volume 335,May 2016,P.53-63;Starr A.et al,Brain,Volume 119,Issue 3,June 1996,P.741–753).

To date, at least 75 mutations have been identified, 7 of which are known as thermosensitive (P.Q994VfsX6,P.I515T,p.G541S,PR1607W,p.E1804del,c.2975_2978delAG/c.4819C>T,c.4819C>T(c.R1607W), for review, see Pangrsic t.et al, trends in Neurosciences,2012, col.35, no.11. These deafness phenotypes (constitutive and inducible) are found throughout the world and are referred to as "autosomal recessive 9 deafness" or "DFNB" deafness. DFNB9 deafness accounts for 10% of autosomal recessive non-syndrome hearing loss and therefore belongs to the first five hereditary hearing disorders that still require therapeutic intervention.

Importantly, the inventors have shown that AAV8 vectors comprising the 5' portion of the human otoxin cDNA under transcriptional control of the CMV promoter are optimal and efficient in target cells. Thus, the present inventors have established a dual AAV vector system for IHC comprising two halves of the identified promoter and otoabnormal protein genes, wherein trans-splicing and/or homologous recombination occurs, resulting in expression of the full length protein.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. For the purposes of the present invention, the following terms are defined as follows.

Definition of the definition

As used herein, the terms "nucleic acid" and "nucleotide sequence" and "polynucleotide sequence" refer to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and encompass known analogs of natural nucleotides that can function in a manner similar to naturally occurring nucleotides, unless otherwise limited.

As used herein, the term "teratoprotein (Otoferlin)" refers to an teratoprotein polypeptide. Abbreviated herein as "OTOF". The polypeptides are also referred to as "AUNB1", "DFNB6", "DFNB9", "NSRD" and "FER1L2".

The polypeptide is a member of the Ferlin family of transmembrane proteins, having a C2 domain as a synapse binding protein (synaptotagmin), PKC and PLC (Yasunaga S et al, J Hum Genet.2000Sep;67 (3): 591-600). This long form contains six C2 domains. As described above, it is involved in synaptic vesicle fusion between cochlear hair cells and afferent spiral ganglion neurons (Roux et al, cell 127 (2): 277-89,2006;Michalski et al,Elife,2017Nov 7;6e31013).

As used herein, the term "teratogen polypeptide (Otoferlin polypeptide)" refers to isoform 5 (variant e) and homologous sequences of the wild-type human teratogen polypeptide of SEQ ID No. 5 (corresponding to Genbank number np_ 001274418). It is encoded, for example, by the cDNA sequence NM-001287489.1 (SEQ ID NO:91, in which the coding sequence for the isoform starts from nucleotide 186) and SEQ ID NO:15 (coding sequence corresponding to the isoform).

Homologous polypeptides whose amino acid sequence has at least 70% identity and/or similarity to SEQ ID NO. 5, retaining at least one biological function of the otoabnormal protein polypeptide of SEQ ID NO. 5 are contemplated herein. For example, this biological function is associated with the modulation of vesicle fusion at the synapse of the intra-cochlear hair cell zone activating the primary auditory neuron (MICHALSKI ET AL, elife,2017Nov 7;6e31013). Such modulation can be assessed by classical ex vivo electrophysiological measurements. More preferably, the homologous sequence has at least 75%, even more preferably at least 80%, at least 85% or at least 90% identity and/or similarity to SEQ ID NO. 5. When the homologous polypeptide is much shorter than SEQ ID NO. 5, local alignment can be considered.

The homologous polypeptide may have an amino acid sequence as shown, for example, in SEQ ID NO. 1 (corresponding to Genbank accession number NP-919224.1). The sequence characterizes isoform a (variant 1) of the wild-type human teratogen polypeptide. The variant has an alternative in-frame and out-of-frame exon in the 3' coding region compared to SEQ ID NO. 5. It also comprises a different C-terminus (but the N-terminal portion is identical) compared to SEQ ID NO. 5.

The homologous polypeptide may also have the amino acid sequence shown in SEQ ID NO. 2 (corresponding to Genbank number NP-004793.2) or the amino acid shown in SEQ ID NO. 3 (corresponding to Genbank number NP-919303.1) corresponding to short isoforms b and c (variants 2 and 3), respectively. More precisely, SEQ ID NO. 2 represents isoform b (variant 2, also referred to as "short form 1") which has a shorter N-terminus and lacks a segment than SEQ ID NO. 1. On the other hand, SEQ ID NO. 3 represents isoform C (variant 3, also referred to as "short form 2"), which differs from variant 1 (SEQ ID NO. 1) in the 5' UTR and in the coding sequence, since it has a shorter and different C-terminus than SEQ ID NO. 1.

The homologous polypeptide may also have the amino acid sequence shown in SEQ ID NO. 4 (corresponding to Genbank accession number NP-919304.1) corresponding to isoform d (variant 4). The variant differs in the 5'UTR and coding region and in the 3' coding region compared to variant 1. The resulting isoform (d) has a shorter N-terminus and a different C-terminus than isoform a of SEQ ID NO. 1. It is encoded by SEQ ID NO. 14 (corresponding to GenBank accession No. NM-194323.3).

In one embodiment, the vector system of the invention may allow expression of a functional fragment of the otoxin polypeptide of SEQ ID NO. 5. The term "functional fragment (functional fragment)" refers herein to any fragment of a human teratogen polypeptide or any fragment of a polypeptide having a homologous sequence as defined above, wherein the fragment retains at least one biological function of the teratogen polypeptide of interest herein. For example, this biological function is associated with the modulation of vesicle fusion at the synapse of the intra-cochlear hair cell zone activating the primary auditory neuron (MICHALSKI ET AL, elife,2017Nov 7;6e31013). Such modulation can be assessed by classical ex vivo electrophysiological measurements.

In another embodiment, the vector system of the invention may allow expression of three specific homologous proteins of variant 5 (see example 2 and related FIG. 6). These three alternative OTOF isoforms have the amino acid sequences of SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8. They may be encoded by the cDNA sequences of SEQ ID NO. 16, SEQ ID NO. 17 and SEQ ID NO. 18, respectively. Thus, it is preferred to use any of these novel isoforms in the vector systems of the present invention, as they are believed to have the potential to restore human hearing.

After recombination, these novel isoforms may encode in situ, in addition to the current isoform 5 transcript, the proteins of SEQ ID No. 6, SEQ ID No. 7 and/or SEQ ID No. 8 having the potential to restore human hearing.

Thus, in a specific embodiment, the vector system of the invention allows the expression of SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8, or functionally homologous polypeptides thereof which retain the activity of these novel isoforms and/or SEQ ID NO. 5. The amino acid sequences of these functional homologs have at least 70%, at least 75%, at least 80%, at least 85% or at least 90% identity and/or similarity to SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8. When the homologous polypeptide is much shorter than SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8, then local alignment can be considered.

The present invention provides a system for encoding homologous amino acid sequences as defined above which are "similar" to these sequences. In this case they comprise a coding sequence, which may be, for example, the long cDNA sequence NM-194248.3 (isoform a or variant 1, SEQ ID NO: 11), the shorter cDNA sequence NM-004802.4 (isoform b or variant 2, SEQ ID NO: 12), the cDNA sequence NM-194322.3 (isoform c or variant 3, SEQ ID NO: 13), or the cDNA sequence NM-194323.3 (isoform d or variant 4, SEQ ID NO: 14). The coding sequence may also have the sequence SEQ ID NO 16, 17 or 18 corresponding to the cDNA of the novel isoform of the OTOF gene, as explained below.

In a preferred embodiment, the coding sequence is derived from the human otoxin gene of SEQ ID NO. 91 (NM-001287489.1) encoding transcript variant 5 (the coding sequence of which starts from nucleotide 186). More preferably as disclosed in SEQ ID NO. 15.

Thus, in the vector system of the invention, the coding sequence is preferably SEQ ID NO. 15. Any homologous sequence thereof having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO. 15 may also be used.

In the context of the present invention, when the sequences are approximately the same size, the percentage of identity between two homologous sequences is preferably identified by global alignment of the sequences as a whole. Such an alignment may be performed by algorithms well known to those skilled in the art, such as the algorithm disclosed in NEEDLEMAN AND Wunsch (1970). Thus, sequence comparison between two amino acid sequences or two nucleotide sequences can be performed, for example, by using any software known to those skilled in the art, such as "needle" software using a "gap open" parameter of 10, a "gap extend" parameter of 0.5, and a "Blosum 62" matrix.

When local alignment of sequences is to be considered (e.g. in the case of homologues of smaller size than the sequences of the invention), the alignment may be carried out by conventional algorithms such as the algorithms disclosed in Smith and Waterman (J.mol. Evol.1981;18 (1) 38-46).

The "similarity" of two target amino acid sequences can be determined by calculating a similarity score for the two amino acid sequences. As used herein, "similarity score" refers to the score generated for two sequences when optimally aligned using the BLOSUM62 amino acid substitution matrix with a gap existence penalty of 11 and a gap extension penalty of 1. When two sequences are aligned to produce the maximum possible score for the pair of sequences (which may require the introduction of gaps in one or both sequences to achieve the maximum score), they are "optimally aligned". Two amino acid sequences are substantially similar if their similarity score exceeds a certain threshold. For a particular reference sequence (e.g., SEQ ID NO: 15), the threshold may be any integer ranging from at least 1190 to the highest possible score. For example, the similarity score threshold may be 1190、1200、1210、1220、1230、1240、1250、1260、1270、1280、1290、1300、1310、1320、1330、1340、1350、1360、1370、1380、1390、1400、1410、1420、1430、1440、1450、1460、1470、1480、1490、1500 or higher. If in a particular embodiment of the invention the threshold score is set to, for example, 1300 compared to a reference sequence, any amino acid sequence that can be optimally aligned with the reference sequence to produce a similarity score greater than 1300 is "similar" to the reference sequence. Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well known in the art and are described, for example, in Dayhoff et al.(1978),"A model of evolutionary change in proteins","Atlas of Protein Sequence and Structure,"Vol.5,Suppl.3(ed.M.O.Dayhoff),pp.345–352.Natl.Biomed.Res.Found.,Washington,D.C.and in Henikoff et al.(1992)Proc.Natl.Acad.Sci.USA 89:10915–10919. although optimal alignment and scoring can be done manually, the process is more convenient using computer-implemented alignment algorithms, such as gapped BLAST 2.0, described in Altschul et al, (1997) Nucleic Acids Res.25:3389-3402, and open to the public on the national center for Biotechnology information website. To generate accurate similarity scores using NCBI BLAST, it is important to shut down any filtering (e.g., low complexity filtering) and disable combination-based statistics. It should also be confirmed that the correct replacement matrix and gap penalty are used. Optimal alignment, including multiple alignment, can be performed using, for example, PSI-BLAST, which is available through NCBI Internet site and described in Altschul et al, (1997) Nucleic Acids Res.25:3389-3402.

The sequences of the mouse otoxin gene can also be used, as shown in example 1 below, in particular SEQ ID NOs 79 and 80 encoding the N-and C-terminal portions of the mouse otoxin gene isoform 1 (NM-001100395.1).

The carrier system of the invention

In a first aspect, the invention relates to a vector system comprising at least two different AAV particles, namely:

a) At least one AAV8 particle comprising a first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: a CMV promoter sequence followed by a partial coding sequence comprising the N-terminal coding portion of an otoabnormal protein gene, and

B) At least one AAV8 particle comprising a second polynucleotide, the second polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: a partial coding sequence comprising the C-terminal coding part of an otoabnormal protein gene, optionally followed by a polyadenylation sequence,

Wherein the first and second polynucleotides comprise recombinantly occurring polynucleotide sequences (recombinogenic polynucleotide sequence),

And wherein the coding sequences in the first and second polynucleotides, when combined, encode isoform 5 of the teratogenen polypeptide, a homologous fragment or functional fragment thereof, as defined above.

The vector system of the invention comprises at least one AAV8 particle comprising a polynucleotide as defined in a) (i.e. encoding the N-terminal coding portion of an otoabnormal protein), and at least one AAV8 particle comprising a polynucleotide as defined in b) (i.e. encoding the C-terminal coding portion of an otoabnormal protein. In other words, the vector system comprises the first and second polynucleotides, each preferably comprised in a separate AAV8 particle. Two different types of AAV8 particles may be contained within the same composition or within different compositions, and may be administered together or separately.

It is understood herein that "first" and "second" are not meant to imply a particular order or importance. However, it is essential that the vector system of the invention comprises two different recombinant AAV vectors, one of which comprises the above-described polynucleotide a) and the other of which comprises the above-described polynucleotide b), such that both polynucleotides are present in the target cell at the same time, and the teratogen polypeptide can be produced in situ.

AAV is a small replication-defective adeno-dependent virus of the parvoviridae family. They have an icosahedral capsid of 20-25nm diameter and a 4.7kb genome flanked by two Inverted Terminal Repeats (ITRs). Following capsid removal in a host cell, the recombinant AAV genome can remain stable episomal by forming high molecular weight head-to-tail circular concatamers, thereby providing long term and high levels of transgene expression. AAV8 is the preferred AAV serotype in the present invention, and is currently being tested in vivo.

AAV8 may be genetically modified in order to increase the efficacy of gene expression and prevent unwanted transmission of viruses. These genetic modifications include deletions of the E1 region, deletions of the E1 region together with deletions of the E2 or E4 region, or deletions of the entire adenovirus genome except for cis-acting inverted terminal repeats and packaging signals. Such modified vectors are advantageously included in the present invention.

In addition, genetically modified AAV8 with mutated capsid proteins can also be used in order to direct gene expression to specific tissue types, such as auditory cells. For this purpose, AAV8 vectors in which tyrosine residues in the viral envelope are replaced with alanine residues can be used. For example, tyrosine 733 may be substituted with an alanine residue (AAV 8-Y733A). By using AAV8-Y733A, gene transfer can be increased up to 10,000-fold, thereby reducing the amount of AAV required to infect the sensory hair cells of the cochlea. AAV8 vectors in which any tyrosine residue in the viral envelope is replaced with an alanine residue can also be used. Furthermore, the efficacy of AAV8 serotypes can be further enhanced using peptide ligand insertion, as disclosed in MICHELFELDER, PLoS one.2011;6 (8): e23101.

Methods for preparing viruses and virosomes comprising heterologous polynucleotides or constructs are known in the art. In the case of AAV, the cells may be co-infected or transfected with an adenovirus or a polynucleotide construct comprising an adenovirus gene suitable for AAV helper functions. Examples of materials and methods are described, for example, in US 8,137,962 and 6,967,018. Based on the information provided herein and the general knowledge of the skilled artisan, the skilled artisan can routinely produce AAV particles that are critical to the vector systems of the invention.

As used herein, the term "promoter of the present invention" refers to a CMV promoter having SEQ ID NO. 9 and its homologous sequence that retains the promoter function of SEQ ID NO. 9 for an otoxin polypeptide. In practice, any homologous sequence of SEQ ID NO. 9 having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with SEQ ID NO. 9 may be used.

In particular, an intron sequence may be inserted downstream of the CMV promoter to stabilize mRNA, improve cytoplasmic output and thus enhance the efficiency of the CMV promoter. The additional sequence may be, for example, the sequence of SEQ ID NO. 10, which represents a chimera between introns from the human beta-globin and immunoglobulin heavy chain.

The promoter (optionally followed by an intron sequence) may be incorporated into the vectors of the present invention using standard techniques known in the art. The promoter must be located upstream of the first exon of the otoxin gene. In one embodiment, the promoter (and optionally the intron sequence) is positioned at about the same distance from the transcription initiation site as in its natural genetic environment. However, this change in distance is allowed without significantly reducing promoter activity. The transcription initiation site is typically contained in a vector.

The polynucleotide comprised in the vector system of the invention comprises an N-or C-terminal coding portion of an otoxin gene which, when recombined, encodes isoform 5 of the otoxin polypeptide of SEQ ID NO. 5 (corresponding to Genbank accession No. NP-001274418) or a functional fragment and homologous sequence thereof, as defined above.

In a preferred embodiment, the polynucleotide comprised in the vector system of the invention comprises a part of the cDNA sequence NM-001287489.1 (isoform 5 or variant e, SEQ ID NO: 91), more preferably the coding part thereof, the sequence of which is shown on SEQ ID NO: 15.

In another preferred embodiment, the polynucleotides comprised in the vector system of the invention contain a portion of the cDNA sequence of SEQ ID NO. 16, SEQ ID NO. 17 and SEQ ID NO. 18, allowing the expression of three specific homologous proteins of isoform 5 of SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8, respectively (see example 2 and related FIG. 6).

Cleavage site

The two-vector approach advantageously splits the long coding sequence into two parts for easier packaging into virions with limited packaging capacity. When AAV capsids are used herein, it is preferred to use a polynucleotide comprising an OTOF coding sequence containing no more than 5kb, preferably no more than 4.7kb.

Thus, the vector system of the invention should comprise two different polynucleotides, each comprising a partial coding sequence of an otoxin gene encoding an otoxin polypeptide as described above. The coding sequence is, for example, the coding sequence shown in SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17 or SEQ ID NO. 18, or any homologous sequence thereof having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17 or SEQ ID NO. 18.

The partial coding sequences contained in the polynucleotides described herein are designed such that upon delivery of the polynucleotide, the partial coding sequences are linked together, for example by homologous recombination, and form the complete coding sequence (also referred to as an "otoabnormal protein gene") encoding an otoabnormal protein polypeptide as defined above.

In preferred embodiments, the coding sequence (or "otoxin gene") has the sequence shown in nucleotides 186-6179 of SEQ ID NO. 91, or has the sequence shown in SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17 or SEQ ID NO. 18 or a homologous sequence thereof, as defined above.

The coding sequence of the human OTOF gene is preferably cleaved at the native splice site.

For example, human OTOF gene isoform 5 of SEQ ID NO. 15 can be split between exons 18 and 19 into an N-terminal coding portion with nucleotides 1-2214 of SEQ ID NO. 15 and a C-terminal coding portion with nucleotides 2215-5991 of SEQ ID NO. 15.

Alternatively, human OTOF gene isoform 5 of SEQ ID NO. 15 may be split between exons 20 and 21 into an N-terminal coding portion with nucleotides 1-2406 of SEQ ID NO. 15 and a C-terminal coding portion with nucleotides 2407-5991 of SEQ ID NO. 15.

Alternatively, human OTOF gene isoform 5 of SEQ ID NO. 15 may be split between exons 21 and 22 into an N-terminal coding portion with nucleotides 1-2523 of SEQ ID NO. 15 and a C-terminal coding portion with nucleotides 2524-5991 of SEQ ID NO. 15.

Alternatively, human OTOF gene isoform 5 of SEQ ID NO. 15 may be split between exons 22 and 23 into an N-terminal coding portion with nucleotides 1-2676 of SEQ ID NO. 15 and a C-terminal coding portion with nucleotides 2677-5991 of SEQ ID NO. 15.

In addition, human OTOF gene isoform 5 of SEQ ID NO. 15 can be split between exons 24 and 25 into an N-terminal coding portion with nucleotides 1-2991 of SEQ ID NO. 15 and a C-terminal coding portion with nucleotides 2992-5991 of SEQ ID NO. 15.

Finally, human OTOF gene isoform 5 of SEQ ID NO. 15 can be split between exons 25 and 26 into an N-terminal coding portion with nucleotides 1-3126 of SEQ ID NO. 15 and a C-terminal coding portion with nucleotides 3127-5991 of SEQ ID NO. 15.

The same cleavage site can be used to split the novel isoforms of SEQ ID NOS 16-18 into two parts, allowing for easy packaging in the AAV8 capsid and facilitating easy in situ recombination.

In the vector system of the present invention, the N-terminal coding part of the otoxin gene contained in one of the two polynucleotides preferably comprises: nucleotides 1-2214, nucleotides 1-2406, nucleotides 1-2523, nucleotides 1-2676, nucleotides 1-2991 or nucleotides 1-3126 of the otoabnormal protein gene of SEQ ID NO. 15. Thus, the C-terminal coding portion of the otoxin gene contained in the other polynucleotide preferably comprises: nucleotides 2215-5991, nucleotides 2407-5991, nucleotides 2524-5991, nucleotides 2677-5991, nucleotides 2992-5991, or nucleotides 3127-5991 of the otoxin gene of SEQ ID NO. 15.

Exemplary polynucleotides that may be used as first and second polynucleotides in the vector system of the invention are, for example, SEQ ID NO:47&48 or 47&49, 50&51 or 50&52, 53&54 or 53&55, 56&57 or 56&58, 59&60 or 59&61 and 62&63 or 62&64, in a hybrid AP vector, each of which SEQ ID NO: comprises the CMV promoter of SEQ ID NO:9 and sequences encoding the N-and C-terminal portions, respectively, of the above-described otoxin human protein isoform 5. SEQ ID NOS.48, 51, 54, 57, 60 and 63 contain the WPRE sequence of SEQ ID NO. 23, whereas SEQ ID NOS.49, 52, 55, 58, 61 and 64 do not contain the WPRE sequence.

Nucleotides 70-75 of SEQ ID NO. may also be used as the first polynucleotide of the vector system of the present invention, comprising the CMV promoter of SEQ ID NO. 9, the intron sequence SEQ ID NO. 10 and comprising nucleotides 1-2214, nucleotides 1-2406, nucleotides 1-2523, nucleotides 1-2676, nucleotides 1-2991 or nucleotides 1-3126, respectively, of SEQ ID NO. 15, encoding the N-terminal portion of isoform 5 (SEQ ID NO. 15) of human teratogen.

It is also possible to use as the first polynucleotide of the vector system of the invention a polynucleotide having the sequence SEQ ID NO. 73, which comprises the CMV promoter of SEQ ID NO. 9, the intron sequence of SEQ ID NO. 10 and the N-terminal portion of the human protein isoform 5 of the otoabnormal protein, more precisely nucleotides 1 to 2676 of SEQ ID NO. 15.

Also useful as the first polynucleotide of the vector system of the invention are those comprising an AAV cassette of SEQ ID NO. 90, a CMV promoter of SEQ ID NO. 9, an intron sequence of SEQ ID NO. 10, and the N-terminal portion of the human protein isoform 5 of the otoabnormal protein, more precisely nucleotides 1-2676 of SEQ ID NO. 15.

Other exemplary polynucleotides that may be used as first and second polynucleotides in the hybrid AP vector system of the invention in the hybrid AP vector are, for example, the CMV promoter of SEQ ID NO. 79&80,SEQ ID NO:79 comprising SEQ ID NO. 9 and a sequence encoding the N-terminal portion of murine otoxin isoform 1. SEQ ID NO. 80 contains a sequence encoding the C-terminal portion of murine otoxin isoform 1, free of the WPRE sequence.

Other Components of the vector of the invention

As explained in WO 2013/075008, the first and second polynucleotides used in this particular embodiment should comprise specific genome components (inverted terminal repeats, polyadenylation sequences, recombination occurrence regions, etc.) in order to induce proper recombination and expression of the otoabnormal protein in the target cell.

More specifically, these gene components are as follows:

·ITR

The vector systems of the invention may comprise wild-type ITR sequences or engineered ITR sequences. The skilled artisan is familiar with which ITRs can be advantageously used in a dual method AAV system.

If an AAV8 vector is used, the ITR sequences of the polynucleotides described herein can be derived from any AAV serotype (e.g., 1, 2,3, 4, 5, 6, 7, 8, 9, or 10) or can be derived from more than one serotype. In some embodiments of the polynucleotides provided herein, the ITR sequence is derived from AAV8.ITR sequences and plasmids containing ITR sequences are known in the art and are commercially available.

An exemplary AAV8 ITR sequence for flanking the 5' end of the expression construct comprises the sequence SEQ ID NO. 19. An exemplary AAV8 ITR sequence for flanking the 3' end of the expression construct comprises the sequence SEQ ID NO. 20.

Any homologous sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO. 19 and/or SEQ ID NO. 20 may also be used.

Recombination occurrence area (recombinogenic region)

The two polynucleotides (first and second polynucleotides) of the invention also comprise so-called "recombination-generating regions" which, once delivered to a cell, can facilitate recombination between the two polynucleotides, including homologous recombination, to produce the complete coding sequence of the OTOF polypeptide and expression in transfected inner hair cells (see, e.g., ghosh et al hum Gene Ther.201110nn; 22 (l): 77-83).

The recombination-generating region may generally comprise a first region of a first polynucleotide having a region of homology in a second polynucleotide, or vice versa. Preferably, the two regions have a sequence identity threshold level of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to each other, as defined above.

The recombination-generating region is preferably between 50 to 500, 50 to 400, 50 to 300, 100 to 500, 100 to 400, 100 to 300, 200 to 500, 200 to 400, or 200 to 300 nucleotides in size.

In a preferred embodiment, the two regions are identical and have a size of 200 to 300 nucleotides.

These recombination-generating sequences may also have sequences that are sufficiently homologous to allow hybridization to one another under standard stringent conditions and standard methods.

As used herein, "stringent" conditions of hybridization refer to conditions in which hybridization is usually carried out overnight in 6 XSSPE, 5 XDenhardt's solution, 0.1% SDS, 0.1mg/ml denatured DNA at 20-25℃below the melting temperature (T _m) of the DNA hybrid. The melting temperature is described by the formula: tm = 81.5c+16.6log [ na+ ] +0.41 (% g+c) -0.61 (% formamide) -600 per base pair duplex length. Washing is generally performed as follows: (1) At room temperature (low stringency wash) in 1 XSSPE, 0.1% SDS for 15min, 2 times; 2) At Tm-20℃in 0.2 XSSPE, 0.1% SDS (moderately stringent washes), 15min, 1.

In a preferred embodiment, the recombination occurrence sequences present in the two polynucleotides of the vector system of the invention, in particular overlapping recombination occurrence sequences, are exogenous fragments or otoabnormal protein fragments. The recombination-generating sequence may be a fragment of a coding or non-coding exogenous gene, or an ITR present in the polynucleotide. In particular, it may be the sequence SEQ ID NO 69 (gene derived from alkaline phosphatase AP) or a homologous sequence thereof, preferably having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO 69.

Delivery strategy for fragments of OTOF

The inventors herein propose several strategies to deliver two portions of an teratogen polynucleotide and allow for proper recombination in target cells:

"trans-splicing strategy" in which the Splice Donor (SD) signal is placed at the 3 '-end of the 5' -semi-vector and the Splice Acceptor (SA) signal is placed at the 5 '-end of the 3' -semi-vector. When double AAV vectors co-infect the same cell, the Inverted Terminal Repeat (ITR) -mediated head-to-tail ligation of the two halves induces trans-splicing of the two polynucleotides and results in the production of mature mRNA and full-length protein of interest (Duan D.et al Molecular Therapy, 2001, vol.4, N.4, pp.383-391).

"Overlap strategy" wherein the recombination occurrence sequence is part of the otoabnormal protein cDNA itself. In fact, in this case, the two halves of the large transgene expression cassette contained in the double AAV vector comprise homologous overlapping sequences (at the 3 'end of the 5' -half vector and at the 5 'end of the 3' -half vector, see bottom of fig. 4), which will mediate the reconstitution of a single large gene by homologous recombination (see WO 2013/075008). Splice sites are not required in this case (but they can be used to facilitate the recombination process).

"Hybridization strategy" in which a highly recombined occurrence sequence, possibly from a foreign gene (e.g., alkaline phosphatase, AP), is added to the trans-splicing vector disclosed above. For example, the second recombination occurrence sequence was placed downstream of the SD signal in the 5 '-semi-vector and upstream of the SA signal in the 3' -semi-vector to increase recombination between double AAVs (see Ghosh et al, hum Gene Ther.2011.22:77-83).

In the latter strategy, the two exogenous recombination occurrence sequences are preferably identical and more preferably have the sequence SEQ ID NO:69 (gene derived from alkaline phosphatase AP) or a homologous sequence thereof, as defined above.

In trans-splicing and hybridization strategies, the polynucleotides comprised in the dual vector system of the present invention comprise splice donor or splice acceptor sites such that upon recombination in vivo, the exogenous recombination occurrence region can be spliced out. In a preferred embodiment, the splice donor and/or splice acceptor site comprises a splice consensus sequence. In a more preferred embodiment, the splice donor and/or splice acceptor sites carried by the polynucleotides comprised in the vector system of the invention comprise splice consensus sequences derived from alkaline phosphatase (see SEQ ID NO:21 and SEQ ID NO: 22).

In a preferred embodiment, the polynucleotide comprised in the binary vector system of the present invention comprises SEQ ID NO. 21 and/or SEQ ID NO. 22 as splice donor and acceptor sites, respectively, or comprises splice sites having a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO. 21 and/or SEQ ID NO. 22.

The polynucleotides of the invention may comprise a plurality of recombination occurrence sequences, i.e. for example splice donor/acceptor sites and exogenous recombination occurrence sequences. In practice, it is preferable that there are two recombination occurrence regions to ensure accurate and precise recombination in vivo, and not leave any unwanted nucleotides. Any suitable combination or use of other recombination occurrence sequences than those disclosed above is contemplated, provided that they are capable of efficient recombination in a target cell (e.g., an inner hair cell).

The polynucleotide sequences present in the vector system of the invention may comprise other regulatory components that function in the inner hair cells of the vector to be expressed. One of ordinary skill in the art can select regulatory elements for use in human hair cells. Regulatory elements include, for example, internal Ribosome Entry Sites (IRES), transcription termination sequences, translation termination sequences, enhancers, and polyadenylation elements.

The polynucleotide sequences present in the vector systems of the invention may comprise, for example, WHV post-transcriptional regulatory elements (WPREs), which may stabilize mRNA and increase protein production. The WPRE sequence may be SEQ ID NO. 23. It may also comprise a Kozak consensus sequence, such as the sequence GCCGCCACCAUGG (SEQ ID NO: 89), as disclosed in the exemplary sequences set forth herein (SEQ ID NO:47, 50, 53, 56, 59, 62, SEQ ID NO:70-75, SEQ ID NO:81, 82, 85 and SEQ ID NO: 86). Alternatively, a 5'- (gcc) gccRccAUGG-3' sequence (SEQ ID NO: 92) may be used, wherein the uppercase letters represent highly conserved bases, R represents purines (adenine or guanine) always observed at this position (adenine is more common according to Kozak), and the lowercase letters represent the most common base at the position where the base may be changed. Note that the sequence in brackets (gcc) has an indeterminate meaning.

The polynucleotide comprising the C-terminal sequence of the teratogen gene preferably comprises a DNA sequence that directs polyadenylation of the mRNA encoded by the structural gene. The polyadenylation DNA sequence may also be contained in the vector of the present invention. For example, bovine growth hormone polyA (SEQ ID NO: 24) may be used in this regard.

The transcription termination region is typically obtained from the 3' untranslated region of a eukaryotic or viral gene sequence. The transcription termination sequence may be located downstream of the coding sequence to provide for efficient termination. The signal peptide sequence is an amino-terminal sequence that encodes information responsible for repositioning the operably linked polypeptide to a variety of post-translational cellular destinations, ranging from specific organelle compartments to protein sites of action and extracellular environments. Enhancers are cis-acting elements that increase gene transcription and may also be included in vectors of the invention. Enhancer elements are known in the art and include, but are not limited to, the CaMV 35S enhancer element, the Cytomegalovirus (CMV) early promoter enhancer element, and the SV40 enhancer element.

Specific carrier system

The specific carrier system of the present invention will now be described in more detail.

In a preferred embodiment of the invention, the vector system of the invention is a trans-splicing vector system comprising at least two different recombinant AAV8 particles, i.e.:

a) An AAV8 particle comprises a first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: a CMV promoter, optionally followed by a kozak sequence of SEQ ID NO 89 or 92, followed by a partial coding sequence comprising the N-terminal coding part of an otoxin gene and a splice donor site as a recombination sequence, and

B) An AAV8 particle comprises a second polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: as splice acceptor sites for recombination events, a partial coding sequence comprising the C-terminal coding part of an otoxin gene, optionally followed by a polyadenylation sequence (e.g. polyA of bovine growth hormone of SEQ ID NO: 24).

The CMV promoter, preferably the CMV promoter of SEQ ID NO. 9, optionally followed by the intron sequence of SEQ ID NO. 10 and/or the kozak sequence of SEQ ID NO. 89 or 92. In this case, the partial coding sequence encoding the otoxin is located downstream of the additional intron sequence.

Two different types of AAV8 particles may be contained within the same composition or within different compositions, and may be administered together or separately.

The vector system may be used in the trans-splicing strategy described above. The attached list provides preferred vectors (SEQ ID NO:85-SEQ ID NO: 88) that can be used accordingly. SEQ ID NO. 85 and SEQ ID NO. 86 encode the N-terminal portion of otoxin isoform 5 (truncated to amino acid 892), respectively under the control of the CMV promoter or CMV followed by an intron sequence, while SEQ ID NO. 87 and SEQ ID NO. 88 (with and without the WPRE sequence, respectively) encode the C-terminal portion of otoxin isoform 5 (starting from amino acid 893).

In another embodiment, the vector system of the invention is an overlapping vector system comprising at least two different AAV8 particles, namely:

a) An AAV8 particle comprises a first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: a CMV promoter, optionally followed by a kozak sequence of SEQ ID NO 89 or 92, followed by a partial coding sequence comprising the N-terminal coding part of an otoabnormal protein gene, and

B) An AAV8 particle comprises a second polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: a partial coding sequence comprising the C-terminal coding part of an otoabnormal protein gene, optionally followed by a polyadenylation sequence (e.g.polyA of bovine growth hormone of SEQ ID NO: 24),

Wherein the N-terminal and C-terminal coding portions of the otoxin gene comprise homologous portions which can be recombination events.

Such a carrier system may be used for the above described overlapping strategy. The attached list provides preferred overlapping vectors (SEQ ID NO:81-SEQ ID NO: 84). SEQ ID NO. 81 and SEQ ID NO. 82 encode the N-terminal portion of the otoxin isoform 5 (truncated to amino acid 892), under the control of the CMV promoter or CMV followed by an intron, respectively, while SEQ ID NO. 83 and SEQ ID NO. 84 (with and without the WPRE sequence, respectively) encode the C-terminal portion of the otoxin isoform 5 (starting from amino acid 893).

In another preferred embodiment, the vector system of the invention is a hybrid vector system comprising at least two different recombinant AAV8 particles, namely:

a) An AAV8 particle comprises a first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: a CMV promoter, followed by a partial coding sequence comprising the N-terminal coding portion of the otoxin gene, and a splice donor site, and

B) An AAV8 particle comprises a second polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: splice acceptor sites, partial coding sequences comprising the C-terminal coding portion of an otoabnormal protein gene, optionally followed by a polyadenylation sequence (e.g., polyA of bovine growth hormone of SEQ ID NO: 24),

Wherein the first and second polynucleotides further comprise a second recombination occurrence sequence located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide.

Such a vector system may be used in the above-described hybridization strategy. The attached list provides several exemplary vectors (SEQ ID NOS: 47&48 or 47&49, 50&51 or 50&52, 53&54 or 53&55, 56&57 or 56&58, 59&60 or 59&61 and 62&63 or 62& 64) that may be used in this regard, corresponding to cleavage sites between exons 18-19, 20-21, 21-22, 22-23, 24-25 and 26-27 (C-terminal vectors with or without WPRE sequences), respectively. Advantageously, a C-terminal vector of SEQ ID NO. 97 may be used. In addition, N-terminal vectors of SEQ ID NOS 70-75 and 90 may be advantageously used, wherein the CMV promoter is followed by an intron sequence.

In any of these vector systems, the first polynucleotide may comprise nucleotides 1-2214, nucleotides 1-2406, nucleotides 1-2523, nucleotides 1-2676, nucleotides 1-2991 or nucleotides 1-3126 of the otoabnormal protein gene of SEQ ID NO. 15. Thus, the second polynucleotide may comprise nucleotides 2215-5991, nucleotides 2407-5991, nucleotides 2524-5991, nucleotides 2677-5991, nucleotides 2992-5991 or nucleotides 3127-5991 of the otoxin gene of SEQ ID NO. 15.

The otoxin gene can also be split into two parts according to any equivalent cleavage site corresponding to the natural exon junctions in the gene under consideration.

Particularly preferred carrier systems of the invention comprise:

a) A first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide and from 5 'to 3' between the inverted terminal repeat sequences: the CMV promoter of the invention, an optional intron sequence (typically SEQ ID NO: 10), an optional kozak sequence of SEQ ID NO:89 or 92, followed by nucleotides 1-2214, nucleotides 1-2406, nucleotides 1-2523, nucleotides 1-2676, nucleotides 1-2991 or nucleotides 1-3126 of the otoxin gene of SEQ ID NO:15, and a splice donor site, and

B) A second polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide and from 5 'to 3' between the inverted terminal repeat sequences: splice acceptor sites, nucleotides 2215-5991, nucleotides 2407-5991, nucleotides 2524-5991, nucleotides 2677-5991, nucleotides 2992-5991 or nucleotides 3127-5991 of the otoxin gene of SEQ ID NO. 15, optionally followed by a polyadenylation sequence (e.g.polyA of bovine growth hormone of SEQ ID NO. 24),

Each polynucleotide comprises a second recombinant generating sequence of SEQ ID NO. 69 derived from a gene encoding alkaline phosphatase.

Preferably, the first polynucleotide in the vector system is selected from the group consisting of: SEQ ID NOS 47, 50, 53, 56, 59 and 62 (without intron sequences) or SEQ ID NOS 70, 71, 72, 73, 74 and 75 (with intron sequences), said polynucleotides comprising nucleotides 1 to 2214, nucleotides 1 to 2406, nucleotides 1 to 2523, nucleotides 1 to 2676, nucleotides 1 to 2991 or nucleotides 1 to 3126, respectively, of SEQ ID NO. 15, thereby encoding the N-terminal portion of human otoxin isoform 5.

Preferably, the second polynucleotide in the vector system is selected from the group consisting of: 48, 51, 54, 57, 60 and 63 (with enhancer WPRE) or 49, 52, 55, 58, 61 and 64 (without enhancer WPRE), respectively, comprising nucleotides 2215-5991, nucleotides 2407-5991, nucleotides 2524-5991, nucleotides 2677-5991, nucleotides 2992-5991 or nucleotides 3127-5991 of SEQ ID NO. 15, respectively, encoding the C-terminal portion of human teratogen isoform 5.

The construction of these polynucleotides is detailed in example 1 below.

Particularly preferred carrier systems are carrier systems comprising:

a) An AAV8 particle comprising a first polynucleotide, the first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and comprising, from 5 'to 3' between the inverted terminal repeat sequences: the CMV promoter of SEQ ID NO. 9 and optionally the intron sequence of SEQ ID NO. 10 and/or the kozak sequence of SEQ ID NO. 89 or 92, followed by nucleotides 1 to 2214, nucleotides 1 to 2676 or nucleotides 1 to 2991, more preferably followed by nucleotides 1 to 2676, of the otoxin gene of SEQ ID NO. 15, and a splice donor site, and

B) An AAV8 particle comprising a second polynucleotide, said second polynucleotide comprising an inverted terminal repeat sequence at each end of said polynucleotide, and comprising, from 5 'to 3' between said inverted terminal repeat sequences: splice acceptor sites, nucleotides 2215-5991, nucleotides 2677-5991 or nucleotides 2992-5991 (more preferably nucleotides 2677-5991) of the otoxin gene of SEQ ID NO:15, optionally followed by a polyadenylation sequence (e.g.polyA of bovine growth hormone of SEQ ID NO: 24),

Wherein the first and second polynucleotides further comprise an AP recombination occurrence sequence of SEQ ID NO. 69, which is located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide, and

Wherein the second polynucleotide does not comprise the WPRE sequence of SEQ ID NO. 23.

Another particularly preferred carrier system is a carrier system comprising:

a) An AAV8 particle comprising a first polynucleotide, the first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and comprising, from 5 'to 3' between the inverted terminal repeat sequences: the CMV promoter of SEQ ID NO. 9 and optionally the intron sequence of SEQ ID NO. 10, and optionally the Kozak sequence of SEQ ID NO. 89 or 92, followed by nucleotides 1-2214, nucleotides 1-2676 or nucleotides 1-2991, more preferably nucleotides 1-2676, and the splice donor site of the otoxin gene of SEQ ID NO. 15, and

A particularly preferred vector system of the invention comprises SEQ ID NO:56 (without intron sequence) encoding the N-terminal portion of human otoxin isoform 5 and SEQ ID NO:58 (without enhancer WPRE) encoding the C-terminal portion of human otoxin isoform 5.

Pharmaceutical compositions of the invention

In another aspect, the present invention is directed to a pharmaceutical composition comprising the vector system of the present invention as described above (i.e., a virosome comprising a polynucleotide as described above) and a pharmaceutically acceptable carrier.

The present invention also aims at a pharmaceutical composition comprising only one population of viruses of the invention, said viruses comprising the "first" or "second" polynucleotide already described in detail above.

The pharmaceutical composition generally comprises any of the trans-splicing vectors, heterozygous vectors or overlapping vectors disclosed above.

Specifically and by way of example, the composition of the invention comprises particles comprising the hybrid vector of the invention, i.e. any of the following:

-an AAV8 particle comprising a polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: a CMV promoter, optionally a kozak sequence, followed by a partial coding sequence comprising the N-terminal coding portion of an otoxin gene, and a splice donor site as a recombination generating sequence, and a pharmaceutically acceptable carrier;

-or an AAV8 particle comprising a polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: a splice acceptor site as a recombination event, a partial coding sequence comprising the C-terminal coding portion of an otoabnormal protein gene, optionally followed by a polyadenylation sequence (e.g., polyA of bovine growth hormone of SEQ ID NO: 24), and a pharmaceutically acceptable carrier.

In another embodiment, the composition comprises:

a) An AAV8 particle comprising a first polynucleotide, the first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and comprising, from 5 'to 3' between the inverted terminal repeat sequences: a CMV promoter, optionally a kozak sequence, followed by a partial coding sequence comprising the N-terminal coding part of an otoxin gene, and a splice donor site, and

B) An AAV8 particle comprising a second polynucleotide, said second polynucleotide comprising an inverted terminal repeat sequence at each end of said polynucleotide, and comprising, from 5 'to 3' between said inverted terminal repeat sequences: splice acceptor sites, partial coding sequences comprising the C-terminal coding portion of an otoabnormal protein gene, optionally followed by a polyadenylation sequence (e.g., polyA of bovine growth hormone of SEQ ID NO: 24),

In a preferred embodiment, the object of the present invention is also a pharmaceutical composition comprising, in addition to a pharmaceutically acceptable carrier, an AAV8 particle, the AAV8 particle comprising a polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and comprising, between the inverted terminal repeat sequences, from 5 'to 3': a CMV promoter followed by a partial coding sequence comprising an N-terminal coding portion of an otoxin gene, and a splice donor site, wherein the polynucleotide further comprises a second recombination occurrence sequence located after the splice donor site in the polynucleotide.

In another preferred embodiment, the object of the present invention is also a pharmaceutical composition comprising, in addition to a pharmaceutically acceptable carrier, an AAV8 particle, the AAV8 particle comprising a polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and comprising, from 5 'to 3' between the inverted terminal repeat sequences: a splice acceptor site comprising a portion of the coding sequence for the C-terminal coding portion of an otoabnormal protein gene, optionally followed by a polyadenylation sequence (e.g., a polyA of bovine growth hormone of SEQ ID NO: 24), wherein the polynucleotide further comprises a second recombination occurrence sequence preceding the splice acceptor site in the polynucleotide.

All components of such polynucleotides (promoter sequences, translational enhancers, recombination generating sequences, partially coding portions, etc.) have been described in detail above and need not be repeated here. All embodiments of the disclosed vector system of the invention (trans-splicing, hybridization and overlap) are applicable thereto, mutatis mutandis.

As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and the like, and combinations thereof. In many cases, it is preferred to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. The pharmaceutically acceptable carrier may also contain minor amounts of auxiliary substances, such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the carrier system or pharmaceutical composition containing it.

The pharmaceutical composition of the present invention may be in various forms. These include, for example, liquid, semi-solid, and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes, and suppositories. The form of use depends on the intended mode of administration and the therapeutic application. Typical compositions are in the form of injectable or infusible solutions.

Pharmaceutical compositions must generally be sterile and stable under the conditions of manufacture and storage. The pharmaceutical compositions of the present invention are preferably formulated as solutions, microemulsions, dispersions, liposomes or other ordered structures suitable for high drug concentrations. Sterile injectable solutions may be prepared by incorporating the invention in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. In general, dispersions are prepared by incorporating the vectors or viruses of the present invention into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile lyophilized powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and spray drying which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Proper fluidity of the solution may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. Prolonged absorption of the injectable compositions can be brought about by the inclusion in the composition of agents which delay absorption, for example, monostearates and gelatins.

The pharmaceutical compositions of the present invention generally comprise a "therapeutically effective amount" or a "prophylactically effective amount" of the vector or virus of the present invention. By "therapeutically effective amount" is meant an amount of the vector or virus of the invention that is effective to achieve the desired therapeutic result at the necessary dosage and time (in this case, for preventing and treating hearing loss without unacceptable toxicity or undesirable side effects).

In a specific embodiment, the pharmaceutical composition of the invention comprises a therapeutically effective amount of a virus comprising SEQ ID NO:56 (NO intron sequence) encoding the N-terminal portion of human otoxin isoform 5 and SEQ ID NO:58 (NO enhancer WPRE) encoding the C-terminal portion of human otoxin isoform 5.

In a specific embodiment, the pharmaceutical composition of the invention comprises a therapeutically effective amount of a virus comprising SEQ ID NO:56 (NO intron sequence) encoding the N-terminal portion of human otoxin isoform 5 and SEQ ID NO:57 (with enhancer WPRE) encoding the C-terminal portion of human otoxin isoform 5.

In a specific embodiment, the pharmaceutical composition of the invention comprises a therapeutically effective amount of a virus comprising SEQ ID NO 75 (with an intron sequence) encoding the N-terminal portion of human otoxin isoform 5 and SEQ ID NO 57 (with an enhancer WPRE) encoding the C-terminal portion of human otoxin isoform 5.

In a specific embodiment, the pharmaceutical composition of the invention comprises a therapeutically effective amount of a virus comprising SEQ ID NO 75 (with an intron sequence) encoding the N-terminal portion of human otoxin isoform 5 and SEQ ID NO 58 (without enhancer WPRE) encoding the C-terminal portion of human otoxin isoform 5.

In a particularly preferred embodiment, the pharmaceutical composition of the invention comprises a therapeutically effective amount of a virus comprising:

-an AAV8 particle comprising a polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: a CMV promoter followed by the intron sequence of SEQ ID NO. 10, the kozak sequence of SEQ ID NO. 89, the N-terminal coding portion of the human otoxin gene (isoform 5, exons 1-22), the splice donor site, and the recombination event sequence of SEQ ID NO. 69, the polypeptide having the sequence shown, for example, in SEQ ID NO. 73 or SEQ ID NO. 90, and a pharmaceutically acceptable carrier;

And/or

-An AAV8 particle comprising a polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: the recombination event sequence of SEQ ID NO. 69, the splice acceptor site, the C-terminal coding portion of the human otoabnormal protein gene (isoform 5, starting from exon 23) followed by a polyadenylation sequence (e.g., polyA of bovine growth hormone of SEQ ID NO. 24) having the sequence shown, for example, in SEQ ID NO. 97, and a pharmaceutically acceptable carrier.

In a most particularly preferred embodiment, the pharmaceutical composition of the invention comprises a therapeutically effective amount of a virus comprising:

An AAV8 particle comprising a polynucleotide having the sequence set forth in SEQ ID No. 90, and a pharmaceutically acceptable carrier;

And/or

An AAV8 particle comprising a polynucleotide, the sequence of which is shown in SEQ ID No. 97, and a pharmaceutically acceptable carrier.

The therapeutically effective amount of the vector or virus of the invention may vary depending on factors such as the disease state, age, sex and weight of the subject, the ability of the compound to elicit a desired response in the subject, and the like. A therapeutically effective amount may also be an amount in which any toxic or detrimental effect of the claimed compounds does not exceed a therapeutically beneficial effect. "prophylactically effective amount" means an amount effective to achieve the desired prophylactic result at the dosages and for periods of time necessary. In general, since a prophylactic dose can be administered to a subject prior to or at an early stage of a disease, a prophylactically effective amount is typically less than a therapeutically effective amount.

The dosage regimen can be adjusted to provide the best desired response (e.g., therapeutic or prophylactic response). For example, a single bolus may be administered, several separate doses may be administered over time, or the dose may be proportionally reduced or increased depending on the urgency of the treatment. Dosage unit form as used herein refers to physically discrete units suitable as unitary dosages for the mammalian subject to be treated; each unit contains a predetermined amount of the vector or virus of the invention calculated to produce the desired therapeutic or prophylactic effect in combination with the desired pharmaceutical carrier. The specification of a dosage unit form can be determined by and directly dependent on: (a) Unique characteristics of the vector or virus and the particular therapeutic or prophylactic effect to be achieved, and (b) inherent limitations in the art of formulating such vectors or viruses for use in treating or preventing hearing loss in a subject.

In some embodiments, when first and second AAV polynucleotides/particles are used, the first and second AAV polynucleotides/particles may be contained within the same composition or within different compositions, and may be administered together or separately.

In some embodiments, the compositions of the invention comprise 10 ⁶ to 10 ¹⁴ particles/mL or 10 ¹⁰ to 10 ¹⁵ particles/mL, or any value in any range, for example about 10 ⁶、10⁷、10⁸、10⁹、10¹⁰、10¹¹、10¹²、10¹³ or 10 ¹⁴ particles/mL. In one embodiment, the composition of the invention comprises more than 10 ¹³ AAV particles/mL.

In some embodiments, when a first AAV particle comprising a first polynucleotide and a second AAV particle comprising a second polynucleotide are administered, the amount of administration of both particles is the same.

Therapeutic uses and methods of treatment

In another aspect, the invention also relates to a viral or vector system or pharmaceutical composition of the invention as defined above for use in the treatment of a patient suffering from DFNB a deafness or in the prevention of DFNB a deafness in a patient having DFNB a mutation.

The invention also relates to a method of treatment or prophylaxis comprising administering a virus or vector system of the invention or a pharmaceutical composition comprising the same, respectively, to a patient suffering from DFNB a 9 a deafness or a patient having a DFNB mutation.

More generally, these viral or vector systems or pharmaceutical compositions of the invention may be administered to human subjects suffering from congenital hearing loss due to altered DFNB gene expression or defects. For example, the defect may be observed when the teratogen is expressed at normal levels but is not functional.

In other words, the present invention relates to the use of the virus or vector system of the invention as described above for the preparation of a pharmaceutical composition intended for the prevention and/or treatment of a patient suffering from a disorder associated with altered DFNB gene expression or a defect.

As used herein, the term "treating" means administering a therapeutically effective amount of a virus or vector system of the invention to a patient suffering from DFNB a deafness to partially or fully restore the hearing of the patient. The recovery may be assessed by testing Auditory Brainstem Response (ABR) with an electrophysiological device. "treatment of DFNB for deafness" refers in particular to a complete restoration of hearing function, irrespective of the cellular mechanisms involved.

For patients carrying heat-sensitive mutations, the virus or vector system or composition of the invention may also be administered to prevent hearing loss caused by thermoregulation. In the present invention, the term "preventing" means attenuating or delaying hearing loss in the audible frequency range.

In these and other DFNB patients, the virus or vector system or composition of the invention may be administered to prevent hearing loss before it occurs, and to at least partially restore hearing ability when hearing loss has occurred.

In this aspect of the invention, the virus or vector system or composition of the invention is administered to a patient suffering from DFNB deafness. By "patient suffering from DFNB's deafness" is meant herein a patient, especially a human patient, who is considered to have (or has been diagnosed with) a constitutive teratogen gene mutation, which triggers abnormal expression, abnormal function, or both of the teratogen. In a specific embodiment, the mutation may be heat sensitive.

To date, more than 75 pathogenic mutations have been reported in teratogens. Wherein at least 7 heat-sensitive mutations are identified in patients suffering from paroxysmal deafness caused by fever (PQ994VfsX6,P.I515T,p.G541S,PR1607W,pE1804del,c.2975_2978delAG/c.4819C>T,c.4819C>T(c.R1607W)).

These patients may be identified by a skilled physician, for example, using electrophysiological testing of Auditory Brainstem Response (ABR) and/or a combination of genetic tests to identify mutations in the OTOF gene. In some embodiments, the patient has one or more of the following nonsense or missense mutations in the OTOF gene: TYR730TER, GLN829TER, PR01825ALA, PRO50ARG, LEU1011PRO, ILE515THR, ARG1939GLN or GLY541SER. In some embodiments, the patient has an a-to-G conversion at the intron 8/exon 9 junction (IVS 8-2A-G), or a G-to-a conversion at position +1 (the first intron nucleotide in the splice donor of exon 5), or a G-C conversion in the donor splice site of intron 39. Ext> inext> someext> embodimentsext>,ext> theext> patientext> hasext> aext> oneext> baseext> pairext> deletionext> (ext> 1778ext> Gext>)ext> inext> exonext> 16ext>,ext> resultingext> inext> aext> stopext> codonext>,ext> andext> aext> 6141ext> Gext> -ext> aext> changeext>,ext> resultingext> inext> anext> argext> toext> glnext> substitutionext> inext> exonext> 48ext>.ext>

The time of administration of the viruses or viral systems or compositions of the present invention will be within the purview of the skilled artisan having the benefit of the present teachings. The compositions of the invention may be administered up to 12 years old or more, but may also be administered immediately upon detection of a disease or mutation, for example, in an embryo or fetus in utero, or shortly after birth, for example, three months before birth, preferably one month before birth.

Patients to whom the virus or vector system or composition of the invention is administered are preferably patients, especially human patients, whose auditory system, especially cochlea has developed and matured. In this case, these patients, especially human patients, are therefore not human embryos or fetuses. Thus, the subject patient of the present invention is preferably a human infant just born, typically less than 6 months old, or even less than 3 months old, if so small, diagnosed with DFNB s of deafness. Most preferably, these human infants are between 3 months and 1 year old.

Notably, the human cochlea generally reaches adult size between 17 and 19 weeks of gestation and is morphologically fully mature between 30 and 36 weeks (corresponding to 12 days after birth of the mouse). Functional maturation of inner hair cell zona synapses can be assessed by monitoring wave I recorded by ABR, which can be recorded around week 28 of human gestation. Recording and analysis of ABR wave I (reflecting the function of the endocardial synapse with primary auditory neurons) shows that the human infant is fully mature in function at birth (equivalent to 20 days after birth in mice). This is well known in the art (see, e.g., pujol ET LAVIGNE-Rebillard, acta oto-laryngologic. Supplementum, month 2 1991).

The inventors have previously demonstrated that gene therapy with otoxin is effective even though the auditory system has reached maturity (Akil el al 2019,PNAS;Hardelin et al, m decine/sciences 2019; 35:1213-25).

Thus, the vector system of the invention may also be administered to older human patients, such as young children (2-6 years), children (6-12 years), adolescents (12-18 years) or adult humans (18 years and older).

The patient of the invention may be diagnosed with DFNB deaf human children, particularly after language learning.

In another embodiment, the patient of the invention is a human 6 years old and older, i.e., the treatment is administered when their central nervous system is fully mature.

In a specific embodiment, the virus or vector system or composition of the invention is administered to a human patient suffering from DFNB deafness induced by a heat-sensitive mutation, preferably selected from the group consisting of: PQ994VfsX, P.I515T, P.G541S, PR1607W, pE1804del, c.2975_2978delAG/c.4819C > T, c.4819C > T (c.R 1607W), more preferably for adolescents or adults carrying at least one of the above-mentioned heat-sensitive mutations of the teratogen.

In the present invention, typical modes of administration of the pharmaceutical composition of the invention are intrathecal (in the middle ear), intracochlear or parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular, intrathecal). In one example, the pharmaceutical composition of the present invention is administered by intravenous infusion or injection. In another example, the pharmaceutical composition of the invention is delivered to a specific location using stereotactic delivery (stereostatic delivery), particularly to the middle ear via the tympanic membrane or mastoid process.

More precisely, the virus, vector system or pharmaceutical composition of the invention may be administered by one of the following means using a microcatheter: by using laser stapotomy (via the stapes) through oval window (oval window), or via mastoid/transround window (Dai C.et al, JARO,18:601-617,2017).

In a preferred embodiment of the invention, the virus, vector system or pharmaceutical composition of the invention is administered in the human ear by intra-cochlear administration, more precisely by targeting the endolymphatic space in the vestibular system or by the semi-annular method described above (semi-circular approach).

A variety of routes of delivery to the inner ear have been explored. These approaches include injection through the round window membrane (round window membrane, RWM) and through the oval window into the perilymph space, and injection through the cochleostomy into the tympanic or vestibular step. For all these delivery routes, distribution throughout the perilymph space has been demonstrated. Furthermore, advection through the cochlea and vestibular organs has been shown to promote distribution of therapeutic agents from the injection site to more distant regions of the inner ear. Delivery into the endolymphatic space through a cochleostomy into the central step (SCALA MEDIA), through a tube wall ostomy and through injection into the endolymphatic sac has also been explored. These methods also produce a broad distribution but face additional challenges of breaking the barrier between the high potassium endolymph and perilymph. The disruption of the barrier presents two potential problems. First, high potassium leakage into the perilymph space bathing hair cells and the basolateral surface of neurons can depolarize these cells for long periods of time and lead to cell death. Second, disruption of the tight connection between endolymph and perilymph can lead to intra-cochlear potential drops, typically ranging between +80 and +120 mV. The decrease in intra-cochlear potential reduces the driving force for sensory transduction in the hair cells, thus resulting in decreased cochlear sensitivity and increased auditory threshold. Avoiding these complications is particularly challenging for adult cochlea. However, by targeting the endolymphatic space in the vestibular system (which does not have endolymphatic potential but is connected to the intra-cochlear lymphatic space), it is possible to minimize these confounding problems while still providing adequate distribution within the cochlea (AHMED ET AL, JARO 18:649-670 (2017)).

The cochlea is highly compartmentalized and separated from other parts of the body by the Blood Cochlear Barrier (BCB), minimizing therapeutic injection volumes and leakage to the systemic circulatory system of the body to protect cochlear immune privileges (immune privilege) and reduce the chance of systemic adverse immune responses. Since the hair cells and support cells in the cochlea generally do not divide, the cells in the cochlea remain stable, thus enabling the use of non-integrated viral vectors (e.g., AAV) for sustained expression of transgenes.

The semi-annular approach is considered a promising injection route for cochlear gene therapy in future human trials, as the posterior semi-annular tube also appears to be accessible in humans (Suzuki et al, sci. Rep.7:45524 (2017); yoshimura et al, sci. Rep.8:2980 (2018)).

In a preferred embodiment of the invention, the virus or vector system or composition of the invention is administered into the human ear by one of two common and well established techniques conventionally used in clinical otology practice. More precisely, these methods will be adapted to target the perilymph space. For this purpose, injections using microcatheters will be performed using laser stapotomy (via the stapes) through the oval window or via the mastoid/transround window (Dai C.et al, JARO,18:601-617,2017). Systemic administration may also be by intravenous injection or infusion.

The skilled person will readily determine from the target cells whether an enhanced permeability of the round window membrane as proposed in WO 2011/075838 is required prior to administration of the virus or vector or composition of the invention.

Novel isoforms of the invention

In another aspect, the present invention relates to three specific homologous proteins of variant 5 identified by the present inventors (see example 2 below).

These three alternative OTOF isoforms have the amino acid sequences of SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8. They may be encoded by the cDNA sequences of SEQ ID NO. 16, SEQ ID NO. 17 and SEQ ID NO. 18, respectively.

Each of them may have the potential to restore human hearing. Thus, they can be used in gene therapy in place of the commonly used OTOF isoform proteins 1-5 disclosed in the art.

The invention also relates to homologous polypeptides thereof having an amino acid sequence which has at least 70%, at least 75%, even more preferably at least 80%, at least 85% or at least 90% identity and/or similarity to SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8. When the homologous polypeptide is much shorter than SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8, then local alignment can be considered.

The invention also relates to any vector or vector system as defined above encoding SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8 or a homologous polypeptide thereof.

In particular, the invention relates to any vector comprising the cDNA sequence of SEQ ID NO. 16, SEQ ID NO. 17 or SEQ ID NO. 18.

These vectors are preferably useful in gene therapy. They include, but are not limited to, DNA plasmid vectors, and DNA and RNA viral vectors. In the present invention, such vectors may be used to express novel isoforms of OTOF in cells of the auditory pathway, such as cochlear hair cells. Such vectors are well known in the art. They are, for example, viral vectors such as lentiviruses, adenoviruses and adeno-associated viruses (AAV).

Drawings

Fig. 1:

Transduction profile of AAV8-CMV-GFP following cochlear delivery in P12 in wild-type mice. Low-power and high-power microphotographs of P30 coti organs for GFP-immunolabeling after rwm injection. Note that AAV8-CMV-GFP transduced all IHCs. B. Confocal images of the middle cusp wild-type cochlea at P20 by RWM injection of AAV8-GFP, anc80-GFP and AAV 2-GFP. Scale bar: 100 μm; the partial enlargement is 10. Mu.m.

C and d. cochlear cells were transduced in vivo with AAV8 and AAV2 vectors in NHP. Confocal representative images of AAV8- (C) or AAV2-CMV-GFP (D) injected cochlea were performed by RWM in combination with oval window delivery methods. GFP expressing cells along the length of the cochlea (green). Nuclei were stained with DAPI (blue). Red, phalloidin-stained actin. Scale bar: 100 μm; the partial enlargement is 10. Mu.m.

Fig. 2: double AAV8 CMV promoters drive expression of mouse otoxin in Otof ^-/- mouse cochlea

(A) Maximum intensity projection of confocal z-sections of P64 coti organs in P10 injected and immunostained Otof ^-/- mice for teratogen. Almost all IHCs express murine otoxin. (B) ABR recordings at day 42 in Otof ^-/- uninjected mice (black dashed line), wild-type uninjected mice (grey dashed line) and Otof ^-/- mice injected with double AAV encoding the murine otoxin of the present invention at p10 (solid line) in response to 8, 10, 15 and 20kHz tone-burst. Note that the hearing of Otof ^-/- mice treated with AAV otoxin recovered to near normal threshold. (C) After injection of the murine otoxin-encoding bi-vector of the invention in p 10-age treated Otof ^-/- mice, the hearing persistence was recorded for at least 47 weeks at 15kHz frequency at which the optimal hearing threshold was observed. Individual ABR recordings (n=6) in mice not injected Otof ^-/- (dashed line) and in Otof ^-/- mice treated with p10 in response to a 15kHz tone burst for a period of time are shown. (D) ABR recordings between 28 and 319 days in 10-day-old Otof ^-/- mice (n=8, solid line, mean±sem), non-injected wild-type mice (dotted line, mean±sem, n=3), and non-injected Otof ^-/- mice (dash-dot line, mean±sem, n=3) injected intra-cochlear with the inventive murine otoxin-encoding binaural protein vector in response to 5, 10, 15, 20, 32, and 40kHz of the pronunciations. (E) A 21/22 day old Otof ^-/- mouse injected with PBS (dash-dot line, mean±sem, n=5), a wild type 21/22 day old mouse injected with PBS (dashed line, mean±sem, n=6), a non-injected wild type mouse (closed dashed line, mean±sem, n=3), a Otof ^-/- mouse injected with the inventive murine otoxin-encoding diav vector at p21/p22 (dotted line, mean±sem, n=9), a Otof ^-/- mouse #8 injected with the inventive murine otoxin-encoding diad vector at p21/p22 (solid line, n=1), the mouse #8 showed the best recovery of the burst sounds in response to 5, 10, 15, 20, 32 and 40kHz at the ABR record 18 weeks after treatment. (F) Otof ^-/- 18-25 day old mice injected with PBS (dotted line, mean ± SEM, n=5), wild type 18-25 day old mice injected with PBS (dotted line, mean ± SEM, n=7), non-injected wild type 18-25 day old mice (closed dotted line, mean ± SEM, n=3) and Otof ^-/- mice injected with the human teratogen-encoding diaav of the present invention at p18-p25 (dotted line, mean ± SEM, n=4), ABR at 18 weeks post injection, wherein Otof ^-/- mice #3 injected with the inventive bi-vector at p18-p25 (solid line, n=1) shows the best recovery of the burst sounds in response to 5, 10, 15, 20, 32 and 40 kHz. (G) Persistence of hearing recovery at 15kHz in mice treated with double AAV8-CMV-muOTOF (n=8) or AAV8-smCBAmuOTOF (n=15). Mean +/SEM at 15 kHz. dB = decibel; SPL = sound pressure level; khz=kilohertz. (H) Maximum intensity projection of confocal z-sections of the apical, MT and basal corners of the injected left cochlea immunostained (blue) for mouse otoxin from one best-response mouse (# 8). IHC and nuclei were stained with Ribeye (green). Scale bar: 10 μm. (I) Maximum intensity projection of confocal z-sections of the apical, MT and basal corners of the injected left cochlea immunostained (blue) for human otoxin from one best-response mouse (# 3). IHC and nuclei were stained with Ribeye (green). Scale bar: 10 μm.

Fig. 3: schematic representation of the recombination, transcription, splicing and translation processes to produce full-length human teratogens in transduced cells. pa=polyadenylation site, sd=splice donor element, sa=splice acceptor element, ap=alkaline phosphatase recombination occurrence region, itr=inverted terminal repeat.

Fig. 4: schematic representation of a double AAV OTOF vector strategy. pa=polyadenylation site, sd=splice donor element, sa=splice acceptor element, ap=alkaline phosphatase recombination occurrence region, itr=inverted terminal repeat.

Fig. 5: A. in vitro expression protocol of human teratogen driven by ubiquitin CMV promoter following bi-vector delivery using lipofectamine based transfection. B. Efficacy evaluation of 3 different human otoxin cleavage sites in a two plasmid configuration. HEK293 cells were transfected with double OTOF Nter-Cter 738-739 (black), 892-893 (dark grey) and 997-998 (light grey) plasmids and their respective controls (Nter only or Cter only). Experiments were performed 3 times with at least 2 independent wells per condition. Quantification of teratogen positive cells (Nter+ Cter) was performed on at least 3 fields per well (200-300 DAPI positive cells per field).

Fig. 6: summary of exons present in the cochlea of mice, highlighting exons present on the murine transcript (A1-B2-C2) and exons present on the isoform 5 transcript (A2-B1-C2).

Fig. 7: A. RT-PCR analysis of the otoxin transcripts produced from the reconstituted full-length human cDNA in HEK293 cells co-transfected with a pair of recombinant plasmids. The RNA extracts were reverse transcribed and PCR amplified using primers designed to amplify 898 or 946bp fragments containing the ligated otoxin cDNA between Otof Nter and Otof Cter cDNA. Negative (untransfected HEK293 cells) and positive (pcDNA 3 containing HuOTOFcDNA under the control of the CMV promoter) controls are shown. M: DNA molecular weight markers. The positions of the 0.5 and 1.5kb molecular weight markers of the DNA ladder are shown on the left side of the electrophoresis gel.

B. Full length otic protein expression following transfection of HEK293 cells with the double otof plasmid. M: for each double plasmid, the corresponding Nter and Cter or only the Nter or Cter portions were used for transfection. An earabnormal protein specific antibody is used to identify full length earabnormal proteins. HEK293 cells transfected with HuOTOF (Hu cDNA) plasmid were used as positive control. M: pre-stained protein markers. TOT: input (soluble protein extract). IP: immunoprecipitated HEK293 cell extracts using FP2 otoxin antibodies. NT: cell lysates of untransfected cells. ACTB: anti-human beta-actin monoclonal antibodies were used as internal loading controls between the different lanes. The positions of the different molecular weight markers of the protein ladder are shown on the left side of the electrophoresis gel. Asterisks indicate non-specific antibody detection (banding was also observed in untransfected cells).

Examples

Example 1: activity of AAV8 vectors of the invention

1. Materials and methods

AAV vector plasmid production

All AAV otoxin recombinant vectors have been synthesized (Genscript).

To generate the binaural abnormal protein vector construct, the human otoabnormal protein coding sequence (OTOF transcript variant 5; nm_001287489.2) was split at different exon-exon natural junctions: exons 18-19 (nt 1-2214/2215-5991, aa 738-739), exons 20-21 (nt 1-2406/2407-5991), exons 21-22 (nt 1-2523/2524-5991, aa 841-842), exons 22-23 (nt 1-2676/2677-5991, aa 892-893), exons 24-25 (nt 1-2991/2992-5991, aa 997-998) and exons 25-26 (nt 1-3126/3127-5991, aa 1042-1043).

To generate the 5' vector p0101-CMV-NterhuOTOF892 (SEQ ID NO: 56), a synthetic fragment (Genscript) was synthesized and cloned into the p0101_CMV_eGFP plasmid (SEQ ID NO: 77). To generate p0101-CMV-NterhuOTOF1042, a 450bp insert (nucleotides 3617-4066) was synthesized and cloned into plasmid p0101-CMV-NterhuOTOF 892-AP. Plasmids P0101-CMV-huOTOF 738, 841 and 997 were then generated from P0101-CMV-NterhuOTOF1042 Genscript by mutagenesis.

The 5' vector p 0101-CMV-intron-NterhuOTOF 738, 802, 841, 892, 997 and 1042 was generated from the above described p0101-CMV-NterhuOTOF738, 802, 841, 892, 997 and 1042 constructs (Genscript) by mutagenesis.

To generate the 3' vector (human OTOF transcript variant 5; NM_001287689.2), a synthetic fragment (Genscript) was synthesized and cloned into the p0101_CMV_eGFP plasmid (SEQ ID NO: 77) digested with NheI [205] -HindIII [1702] (fragment 4007 bp) or NheI [205] -BglII [2256] (fragment 3453 bp).

The full-length coding sequence of the murine otoxin cDNA sequence (Otof isoform 1; NM-001100395.1) was divided into a 5 'fragment (nucleotides 1-2448) and a 3' fragment (nucleotides 2449-5979) and these fragments were synthesized (Genscript). The 5 'and 3' fragments have been cloned into the p0101_CMV_eGFP plasmid (SEQ ID NO: 77). 5 'vector p0101-CMV-Nter murine OTOF816_AP (SEQ ID NO: 79) and 3' vector Cter OTOF murine 817_AP (SEQ ID NO: 80) were generated (see Akil et al.2019).

The 5' fragment has also been cloned into the p0101_smCBA_eGFP plasmid (SEQ ID NO: 96). The 5' vector p0101-smCBA-Nter murine OTOF816_AP (SEQ ID NO: 95) was generated (see Akil et al 2019).

AAV production

AAV vectors are produced by the university of pennsylvania Vector Core (UPenn) or ETH (Zurich) Vector Core facility. AAV titers were determined in units of viral genome number per milliliter (vg/ml) by ddPCR based methods (UPenn) or fluorometry (ETH). The final concentrated AAV vector stock was stored in PBS (UPenn) containing Pluronic-F68 (0, 001%) or PBS (ETH) containing MgCl2 (1 mM) and KCl (2.5 mM).

Transgenic expression in transfected HEK293 cells

HEK293 cells were cultured at 37 ℃ in a humidification chamber containing 5% co ₂. HEK293 cells were grown in six well plates on polylysine coated coverslips in DMEM/F-12Thermofisher supplemented with 1X nonessential amino acids and 10% FBS (Gibco) and penicillin/streptomycin (Pen/Strep; invitrogen). For immunocytochemistry analysis, cells were grown on polylysine coated coverslips. The next day, cells were pooled at 70-80% with Lipofectamine(Thermofisher) transfection. Briefly,/>3000 Reagent at/>Dilution in Medium-Mix. By at/>The DNA (0.25 to 10. Mu.g) was diluted in the medium to prepare a master mix of DNA, which was then added to the P3000 ^TM reagent. Addition of diluted DNA to per tube dilution/>3000 Reagents (1:1 ratio). After 5 minutes incubation at room temperature, the DNA-lipid complex was added to the cells. The transfection medium was changed the next day. 24-48 hours after transfection, cells were collected for immunocytochemistry and RT-PCR analysis.

OTOF expression as measured by RT-PCR

Transfected HEK293 cells were scraped and total RNA was extracted using Nucleospin RNA kit (MACHEREY NAGEL, 740955) according to the manufacturer's instructions. RNA doses were then assessed using Nanovue Plus spectrophotometry. Reverse transcription PCR of the otoabnormal protein gene was performed on the extracted RNA using a SuperScript ^TM III one-step RT-PCR system (Thermofisher, 12574018) using different primer pairs designed to amplify specific ligation fragments (forward 4F:TGGAGGCCTCAATGATCGAC,SEQ ID NO:45 and reverse 4R:AGCCACAGGGCAGGCCGCAC SEQ ID NO:46 for exon 18-19 ligation, forward 5F GAGCTGAGCTGTGGCTGCTG SEQ ID NO:93 and reverse 5RAGTACGCCTCGTCTGCCATC SEQ ID NO:94 for exon 22-23 and 24-25 ligation. For each RT-PCR reaction, 1. Mu.g RNA extract was used as template. Then the PCR products were migrated onto a 0.8% agarose gel containing ethidium bromide. Sanger sequencing of the PCR products was performed by Transnetyx automated sequencing service.

OTOF expression analysis by immunoblotting

Proteins were extracted by mechanical homogenization in RIPA buffer supplemented with protease inhibitor cocktail. The samples were incubated on ice for 30 minutes while vortexing, and then centrifuged at 12,000Xg for 30 minutes at 4 ℃. The supernatant was collected, frozen in liquid nitrogen and stored at-80 ℃. Protein concentration of each lysate was assessed using a colorimetric BCA protein assay (commercial kit). Immunoprecipitation (IP) was performed using 14CC antibody pre-incubated with protein a-sepharose (Pharmacia). Immunoprecipitates were resuspended in 50 μl of NuPAGE ^TM LDS sample buffer (4X) (Invitrogen) and NuPage sample reducing agent (10X) (Invitrogen) at a 1:1 ratio and then incubated for 10 minutes at 70 ℃. Samples were mixed with NuPAGE ^TM LDS sample buffer (4X) (Invitrogen) and NuPAGE sample reducing agent (10X) (Invitrogen) at a 1:1 ratio and then incubated for 10 minutes at 70 ℃. These denatured proteins were loaded into 3-8% NuPAGE ^TM Tris-Acetate Novex Mini Gels (Invitrogen) (15. Mu.L per well) and run at 150V for 1 hour in NuPAGE ^TM Tris-ACETATE SDS running buffer (1X). According to the commercial protocol, the protein was transferred to nitrocellulose membrane within 15 minutes using a Power Blotter-semi-dry transfer system (Thermofisher). After 1 hour incubation in blocking buffer (PBS-Tween (0.1%) and milk solution (1%)), the membranes were probed with primary antibody (rabbit polyclonal antibody FP2, N-ter portion for teratogen, 1:100 dilution) loaded into blocking buffer overnight at 4 ℃. After washing several times with PBS-Tween (0.1%), the membranes were probed with blocking buffer containing secondary anti-HRP antibody (goat anti-rabbit IgG (H+L) HRP,1:5000 dilution, invitrogen). Chemiluminescence was shown at room temperature for 5 minutes using a Clarity ^TM WESTERN ECL substrate (Biorad) and detected using a ChemiDoc imaging system (Biorad). Transfected otoxin was expected to be-230 kDa. The membranes were then incubated in stripping buffer (STRIPPING BUFFER, thermo Scientific), washed with PBS-Tween (0.1%) and blocked in blocking buffer for 1 hour. The evaluation of housekeeping proteins was performed by blotting using a β -actin monoclonal antibody. Membranes were probed with blocking buffer containing primary antibody (mouse anti- β -actin antibody, 1:5000 dilution, sigma) for 1 hour, then with the same blocking buffer containing anti-mouse HRP antibody (1:5000 dilution, jackson Immunoresearch). Chemiluminescence was shown at room temperature for 5 minutes using ECL substrate and detected using ChemiDoc imaging system (Biorad).

Delivery of vectors to the cochlea of mice

All surgical procedures and virus injections were performed in a biosafety secondary laboratory. C57BL/6 wild-type or Otof ^-/- mice at different postnatal stages (P10 to P25) were anesthetized with isoflurane (4% for induction, 2% for maintenance). To alleviate pain, mice received the subcutaneous analgesic meloxicam at the beginning of surgery0.2 Mg/kg/day) and subcutaneously injecting a local anesthetic in the postaural region (/ >5 Mg/kg). The anesthetized animals were placed on the heat pad throughout the process until the mice were fully awake. Intra-cochlear injections were performed as described by Akil et al (2019). The left ear is accessed through the behind-the-ear incision. After dissection of the neck muscle, the ear bubbles (otic bulla) were exposed and punctured with a 25G needle. Forceps were used to enlarge the opening as necessary to view the stapedial artery and Round Window Membrane (RWM). The RWM was gently spiked centrally with a glass pipette and then a fixed volume (2. Mu.l) of PBS or a viral solution containing the vector pair of AAV8-CMV_GFP (5.6x10 ¹³ vg/ml) of SEQ ID NO:77, or Anc80L65-CMV-GFP (5.5x10 ¹² vg/ml) of SEQ ID NO:77, or AAV2-CMV-GFP (1.2x10 ¹³ vg/ml) of SEQ ID NO:77, or AAV8-CMV-NterOTOFmu816_AP (1.3x10 ¹³ vg/ml) of SEQ ID NO:79 and AAV8-CterOTOFmu817_AP (1.5x10 ¹³ vg/ml) of SEQ ID NO:80, or AAV8-smCBA NterOTOFmu _AP (1.5x ¹³ g/ml) of SEQ ID NO:95 and AAV8-CterOTOFmu _AP (1.5x10 vg/ml) of SEQ ID NO:80, or AAV 8-32816_AP (1.3x10 ¹³ vg/ml) of SEQ ID NO:80, or AAV 8-3476_AP (1.5x10 mg/ml) of SEQ ID NO:80 was injected through the RWM using a pump system connected to the glass micropipette. After the pipette is pulled out, a small drop of biological glue is used3M) a protected small muscle plug is placed over the muscle, the RW niche (RW niche) is sealed quickly to avoid leakage from the round window, and the opening of the large bulb (bulla) is sealed with a small fat plug. GFP or OTOF expression in cochlea was assessed by immunofluorescence.

Delivery of vectors to cochlea of non-human primate animals

After overnight fast, animals were anesthetized and intubated by intramuscular injection of a mixture of ketamine (10 mg/kg) and propofol (5-10 mg/kg), and oxygen and isoflurane were maintained during surgery. Animals received prophylactic injections of antibiotics (Duphamox mg/kg, IM) and anti-inflammatory drugs (tonglidine (tolfedine) 4mg/kg, IM). The round window niche (RW) of the left or right ear is exposed using the ear canal approach. The ear canal is accessed through the pre-aural incision. The skin of the ear canal and tympanic membrane is raised. An otoplasty (canaloplasty) is performed by drilling holes in the posterior and inferior portions of the external auditory canal to access the middle ear and expose the RW niche and stapes. The niche of the round window was drilled to expose its membrane without opening, and then a platinum cut was performed using a diode laser and 300 μm outside diameter fiber (platinotomy). The platinum openings were inspected with a trephine to visualize perilymph leakage from the oval window. The RW membrane was dissected under a binocular surgical microscope using a 25 gauge needle to access the cochlea. A thin catheter (Medel catheter) was inserted through RW, 1mm in length. The total time of surgery for one ear was 1 hour on average. After injection, the openings of the oval and round windows were sealed using a small muscle graft. A viral preparation (30. Mu.L) expressing GFP under the control of the CMV promoter (AAV 8-CMV-GFP 2.8X10 ¹³vg/ml、AAV2-CMV-GFP 1.4x10¹³ vg/ml) was injected using a volume-controlled syringe pump. To avoid overpressure effects in the inner ear, the injection rate and volume were set to 1 μl/5s. The animals were observed for signs of posture imbalance, nystagmus and other vestibular dysfunction for the next 8 hours. Animals were housed at least in pairs except for close monitoring at the hospital room within 3-4 days after surgery. In addition, suitable rich plans are also formulated to limit stress and conduct community monitoring to identify and manage conflicts that may occur in the social community. Animals were anesthetized by ketamine (10 mg/kg; IM) injection and then, after placement of an intravenous catheter (1 ml/kg.h, IV), deep anesthesia was maintained with propofol. Under deep anesthesia (without waking up), the thorax was opened, and then animals received first PBS (200 mL) intracardiac perfusion followed by 4% paraformaldehyde (pH 7.4) (500 mL) under deep anesthesia.

The dissected cochlea was perfused with the same fixative and then transferred to EDTA solution for 10 days of decalcification (Kos microwaves). EDTA was changed twice, and the decalcified bone was trimmed each time. Microdissection of cochlear sensory epithelium (organ of Corti) was performed followed by GFP immunoassay.

Corti organs were pre-incubated in PBS (blocking buffer) containing 20% horse serum, 0.3% Triton X-100 and 0.3% saponins for one hour at room temperature, then incubated overnight at room temperature with diluted blocking buffer (dilution 1:20) containing primary antibody (chicken anti-GFP, invitrogen). The samples were washed 3 times with PBS and incubated with PBS containing the appropriate secondary antibody (Alexa Fluor488 goat anti-chicken IgG, invitrogen) for 1 hour at room temperature. The samples were then stained with phalloidin-Atto 565 (Sigma) and 4', 6-diamidino-2-phenylindole (DAPI) to visualize the nuclei, mounted on a glass slide with a drop Fluorsave of medium and observed with a Zeiss co-Jiao Mianyi fluorescence microscope.

Hearing test

Anesthetized Otof ^+/+、Otof^-/- and rescued Otof ^-/- mice were subjected to hearing tests in a sound-proof chamber at different time points as previously described (akilo et al, 2019). The frequencies of the pure tone stimuli used were 5, 10, 15, 20, 32 and 40kHz. The hearing threshold is defined as the lowest level of stimulation when the ABR peaks of waves I-V are clearly shown and reappear upon visual inspection. ABR was analyzed using Matlab software.

Fluorescence microscopy

In vitro study

Transfected cells grown on polylysine coated coverslips were fixed for 20 min at Room Temperature (RT) using pH 7.4 Phosphate Buffered Saline (PBS) with 4% paraformaldehyde, rinsed 3 times with PBS, and incubated with 0.25% Triton X-100 for 15 min at room temperature. Cells were washed twice with PBS and blocked with PBS containing horse serum (20%) for one hour at room temperature. The cells were then incubated with a mixture of rabbit polyclonal antibody FP2 against the C-terminal portion of the teratogen (institute Pasteur, dilution 1:200) and mouse monoclonal antibody against the N-terminal portion of the teratogen (institute Pasteur, dilution 1:100) for 1 hour at room temperature. Samples were washed twice with PBS and incubated with PBS containing secondary antibodies (AlexaFluor goat anti-rabbit 488, goat anti-mouse 555,Life Technologies,1:500 dilution) for 1 hour at room temperature. The samples were then washed twice in PBS, stained with 4', 6-diamidino-2-phenylindole (DAPI) to visualize the nuclei, mounted on a glass slide with a drop of Fluorsave medium (EMB Millipore) and observed with an Olympus co-Jiao Mianyi fluorescence microscope.

In vivo study

The cochlea of the mice was perfused with 4% paraformaldehyde in 0.1M PBS (pH 7.4) and incubated in the same fixative for 45 minutes at room temperature. Cochlea was washed three times with PBS and decalcified by incubation with 0.5M ethylenediamine tetraacetic acid (EDTA) overnight at 4 ℃. After multiple washings (3 times in PBS), cochlear sensory epithelium (organ of Corti) was microdissected into surface preparations, pre-incubated in PBS (blocking buffer) containing 0.03% triton x100 and 20% horse serum at room temperature for 1 hour, and then incubated with primary antibody overnight at 4 ℃. The following antibodies were used: chicken polyclonal GFP (1:400 dilution, abcam) or rabbit anti-otoabnormal protein (1:100 dilution, institute paste), mouse (IgG 1) anti-CtBP2 (1:200 dilution, millipore) and anti-glutamate receptor subunit A2 (1:2000 dilution; millipore). Samples were washed 3 times in PBS and incubated with the appropriate secondary antibodies: fluor488 conjugated anti-chicken IgY (1:500 dilution; life Technologies) or Atto Fluor 647 conjugated anti-rabbit IgG (1:200 dilution; sigma)), fluor488 conjugated anti-mouse IgG1 and Alexa Fluor 568 conjugated anti-mouse IgG2a (1:500 dilution; life Technologies). Samples were washed 3 times in PBS and incubated with the appropriate secondary antibodies. Samples were washed 3 times in PBS and then mounted in a drop Fluorsave on a slide, and nuclei stained with DAPI (1:7500 dilution). Fluorescence confocal z-stack images of the organ of Corti were obtained using an LSM 700 confocal microscope (Zeiss) equipped with a high resolution objective (63X oil immersed objective). The images were then analyzed using FIJI software.

Transfection efficiency

The proportion of cells expressing the otoxin was calculated as follows: cell number/total number of cells (DAPI stained nuclei) with a detectable green fluorescent signal. This counting was performed on whole coverslips or slides using NIS ELEMENTS 3.1.1 imaging software (Nikon).

2. Results

2.1. In vivo study of the tropism of AAV8 vectors with CMV promoter (WT animals)

2.1.1. First, in C57BL/6 mice, the ability of AAV8-CMV-GFP to transduce inner ear cells was analyzed at maturity stage (P12) following a single intra-cochlear injection. As a result, AAV8-CMV-GFP was found to be mainly targeted to IHC expressing otoxin, with basal and apical transduction rates of 89% and 100%, respectively (FIG. 1A). These results demonstrate the applicability of this AAV capsid/promoter combination to deliver therapeutic genes to IHC.

2.1.2. Inner ear tropism of several AAV serotypes in mice

Several adeno-associated virus (AAV) serotypes (AAV 2, AAV8 and Anc 80) were evaluated for their ability to transduce mature murine hair cells. IHC transduction rates achieved after single intra-cochlear injection of each recombinant vector were examined, with the CMV promoter driving expression of GFP as a reporter gene.

AAV recombinant vector (2 μl) was injected by RWM into C57BL/6 wild-type mice at maturity stage (P20). More specifically, the virus is delivered to the cochlea through the dorsal incision proximate the left ear as described previously in Akil et al (2019). Anesthetized C57BL/6 wild-type or Otof ^-/- mice received 2 μl of viral solution containing AAV8-CMV-GFP (5.6x10 ¹³ vg/ml) containing SEQ ID NO:77, anc80L65-CMV-GFP (5.5x10 ¹² vg/ml) containing SEQ ID NO:77, or AAV2-CMV-GFP (1.2x10 ¹³ vg/ml) containing SEQ ID NO:77, injected through the round window membrane of the cochlea. GFP expression in cochlea was assessed by immunofluorescence (fig. 1B).

Analysis showed that AAV8-CMV-GFP targets primarily IHC in the entire cochlear helix (IHC transduction rate 94%) and not to Outer Hair Cells (OHC) (< 1%). Anc80L65 transduces IHC predominantly in the entire cochlear spiral (97%) and to a lesser extent to OHC (13%). AAV2 transduces not only IHC (95%), but also OHC (60-80%) (see example image in fig. 1B).

Thus, the combination of AAV8 with the ubiquitin CMV promoter is a highly efficient recombinant vector targeting mature IHC in vivo.

Tendency of AAV in the inner ear of non-human primate (NHP)

Several AAV trends tested in mice were further studied in non-human primates. The virus preparation was injected (injection volume 30 μl) into the cochlea of a non-human primate through a round window (via a transluminal tympanostomy method) in combination with a tiny fenestration in the oval window. All cochlea was fixed 3 weeks after transgene delivery and immunolabeling was performed for GFP reporter gene.

Importantly, the results (exemplary images are shown in fig. 1C and 1D) demonstrate that AAV8-CMV-GFP transduction rates and pattern maps are similar to those obtained in mice: AAV8 vectors transduce IHC (up to 95%) efficiently and specifically, while the extent of transduction of support cells injected into the cochlea is lower. None of the OHCs were transduced by AAV8 vector. In contrast, AAV2 is able to transduce OHC (40%) as well as IHC (79%), as observed in mice (see 2.1.1.). This non-specific infectivity can also increase the risk of non-specific expression of therapeutic genes by targeting OHCs, although these cells are not defective in the case of DFNB deafness.

Thus, these results indicate that the AAV8 capsid/CMV promoter combination of the present invention delivered to the cochlea of NHP is very efficient and specific for transducing IHC, but not for transducing OHC (as opposed to AAV 2-CMV-GFP).

2.2. Efficacy assessment of different human otoxin cleavage sites in a two-vector configuration

The inventors used the same strategy as the two-murine otoxin CMV vector and engineered the two AAV vectors expressing human otoxin (fig. 3). Since the efficacy of double AAV can be affected by the cleavage sites within the cDNA, multiple fragments of human otoxin were generated using different cleavage sites and their ability to recombine to reconstruct full length otoxin was compared in vitro.

To generate the double otoxin vector construct, the full length coding sequence of the cochlear isoform of the human otoxin cDNA (transcript variant 5 and the new transcript variant) was divided into different 5 'fragments (nt 1-2214, nt 1-2406, nt 1-2523, nt 1-2676, nt 1-2991 and nt 1-3126) and 3' fragments (nt 2215-5991, nt 2407-5991, nt 2524-5991, nt 2677-5991, nt 2992-5991 and nt 3127-5991). The 5 'construct comprises a 5' fragment of hOTOF cDNA (encoding amino acids (aa) 1-738, aa 1-802, aa 1-841, aa 1-892, aa 1-997 and aa 1-1042) under the control of a CMV promoter, optionally followed by an intron sequence and/or a kozak sequence, then followed by a splice donor Site (SD), while the 3 'construct comprises a 3' portion of hOTOF cDNA (encoding aa 739-1997, aa 803-1997, aa 842-1997, aa 893-1997, aa 998-1997 and aa 1043-1997) and a Splice Acceptor (SA) site (FIG. 3). All fragments containing the alkaline phosphatase recombination-generating bridging sequence (AP) were inserted into the AAV-p0101 plasmid, designated p0101-CMV-Nter huOTOF (738, 802, 841, 892, 997, and 1042) and the p0101-hOTOF Cter huOTOF (739, 803, 842, 893, 998, and 1043) constructs.

The sequences of these constructs are given in the appended list in SEQ ID NOS 47-64 and SEQ ID NOS 70-75, encoding the N-terminal or C-terminal portion of human OTOF isoform 5.

/>

HEK293 cells were transfected with lipofectamine with either p0101 CMV-NTerhuOTOF alone (738, 802, 841, 892, 997, and 1042, left panel), p0101 CTerhuOTOF alone (739, 803, 842, 893, 998, and 1043, right panel), or both p0101 CMV-NTerhuOTOF and p0101 CTerhuOTOF (738-739, 802-803, 892-893, 997-998, and 1042-1043) (FIG. 5A).

Cells were stained for expression of teratogen using the previously characterized mouse monoclonal antibody 10H9 (red) and rabbit polyclonal antibody FP2 (green) against the N-terminal and C-terminal portions of human teratogen, respectively (1:200 dilution) 48 hours after transfection. Actin filaments were labeled with phalloidin (orange) and nuclei were labeled with DAPI (blue) (not shown). Only the results for three cleavage sites are shown.

The results show that all of the tested double plasmid configurations containing links 738-739, 892-893 and 997-998 are capable of reconstructing the teratogen. Although the proportion of cells expressing the otoxin showed variability for a given ligation site, statistical examination showed no significant difference in these proportions, meaning that the recombination efficacy of the 3 different cleavage sites was very similar (fig. 5B).

These results indicate that co-transfection of the double OTOF plasmid, regardless of the ligation site used, results in recombination of the full-length cassette, resulting in expression of human teratogen.

We conclude that reconstitution of the full-length cDNA of the teratogen occurs as long as the DNA fragment provided by the cleavage site remains within the limits of AAV packaging capability.

2.3. In vitro assessment of the recombination efficacy of different double AAV8-CMV-huOTOF constructs

To assess the recombination efficacy of various pairs of double AAV OTOF vectors (examples given are double human OTOF Nter-Cter 738-739, 892-893 and 997-998 vectors comprising CMV promoters), transfected cells were harvested and RNA transcript expression was assessed by RT-PCR using specific primers encompassing splice junctions.

The RNA extracts were reverse transcribed and PCR amplified using primers designed to amplify 898 or 946bp fragments of the cDNA encompassing the otoxin linked between Otof Nter and Otof Cter cDNA. Negative (untransfected HEK293 cells) and positive (pcDNA 3 containing HuOTOFcDNA under the control of the CMV promoter) controls are shown. M: DNA molecular weight markers. The positions of the 0.5 and 1.5kb molecular weight markers of the DNA ladder are shown on the left side of the electrophoresis gel (FIG. 7A).

RT-PCR amplified fragments of the expected sizes, either 946bp (Nter-Cter 738-739) or 898bp (Nter-Cter 892-893 and NTer-Cter 997-998), similar to the fragments amplified from the huOTOF cDNA control (FIG. 7A). When only the 5 'or 3' portion of huOTOF is used as a template, no amplicon is obtained. Purification of the specific amplicon and subsequent Sanger sequencing showed complete sequence alignment of the 738-739, 892-893, or 997-998 ligation portions with the huOTOF native cDNA sequence, confirming recombination of the vector pairs (not shown). More specifically, double AAV OTOF vectors correctly excise Splice Donor (SD), splice Acceptor (SA) and ITR sequences originally contained in the 5 'and 3' vector sequences for recombination events in transfected cells. Sanger sequencing of RT-PCR amplified transcripts showed complete homology of the amplicon to the otoxin exon sequences. These results indicate that accurate homologous recombination and mRNA splicing occurred in HEK293 cells transfected with the double OTOF vector.

Recombination of the full-length huOTOF protein was also assessed by western blotting. The plasmids of double 738-739, 892-893 and 997-998 were transfected into HEK293 cells. Cells were collected for 48 hours, effectively protein extracted and lysed, and then western blotted with anti-teratogen antibodies (fig. 7B). For each pair of double plasmids, transfection was performed using the corresponding Nter and Cter or only the Nter or Cter portions. An earabnormal protein specific antibody is used to identify full length earabnormal proteins. HEK293 cells transfected with HuOTOF (Hu cDNA) plasmid served as positive control.

The results shown in FIG. 7B indicate that all the two plasmid configurations resulted in protein expression of apparent molecular weight 230kDa, comparable to the molecular weight of human teratogen. As predicted, no band of the expected size was observed when transfected with the ster or Cter double plasmids alone.

In summary, the various double OTOF plasmid configurations tested herein all resulted in the assembly of two otoxin cDNA fragments and in vitro expression of full-length human OTOF proteins.

2.4. In vivo validation of double AAV8 huOTOF vectors

The next objective was to investigate the efficacy of gene therapy using double AAV8 vectors with CMV promoters driving human or murine otoabnormal protein expression to rescue hearing in the presence of pre-hearing administration (P10) and to reverse the deafness phenotype of DFNB mice cochlea at the maturation stage (i.e., between P18-P25 after hearing).

In this purpose, the inventive binary vector pair encoding a murine or human otoxin is engineered as disclosed in the materials and methods.

2.4.1. Double AAV8 expression of mice Otof in Otof ^-/- mice cochlea using CMV promoter

AAV8 double murine CMV vector (AAV 8-CMV-NterOTOFmu816_AP (1.3x10 ¹³ vg/ml) of SEQ ID NO:79 and AAV8-CterOTOFmu817_AP (1.5x10 ¹³ vg/ml) of SEQ ID NO:80 were injected on a single side of Otof ^-/- mice at P10, sensory epithelium of the treated cochlea was microdissected and immunolabeled for teratogen at 54 days post injection of recombinant vector pairs to estimate the transduction rate of IHC. Murine protein was detected in nearly all IHC (FIG. 2A.) this result provides evidence that murine teratogen cDNA could be efficiently reconstituted in cochlear sensory cells after co-delivery of both halves of the teratogen cDNA in vivo using the double AAV8 capsid/CMV promoter combination.

ABR recordings 52 days after P10 injection showed significant recovery of hearing thresholds (up to 40 dB) in treated mice (n=6) in response to sudden voice stimuli (5, 10, 15 and 20 kHz), but no recovery in uninjected Otof ^-/- mice (fig. 2B). The long term efficacy of gene therapy was assessed by ABR recording in response to 15kHz tone of the burst at a time point between 4 and 47 weeks (fig. 2C). From week 4 to week 47 post injection, the duration of hearing was comparable in the treated mice (6 out of 8) and in the uninjected WT mice at 15kHz frequency. The long term efficacy of gene therapy in treated mice was also assessed using ABR recordings in response to sudden voice stimuli at other frequencies (5, 10, 15, 20, 32 and 40 kHz) at different time points between 4 weeks and 47 weeks post injection (fig. 2D). ABR analysis showed that the recovered hearing threshold was maintained for a period of time in all responding mice (6 out of 8) and was near wild type levels except for high frequencies (32 and 40 kHz).

The persistence of hearing recovery at 15kHz sound frequency was also tested after intra-cochlear injection of the double AAV8-CMV-muOTOF vector to Otof ^-/- mice with P10, compared to AAV 8-smCBA-muOTOF.

P10 OTOF ^-/- mice were injected with 2. Mu.L of AAV8-smCBA-muOTOF (SEQ ID NO:95 and SEQ ID NO: 80) (n=15; circle) or AAV8-CMV-muOTOF (SEQ ID NO:79 and SEQ ID NO: 80) (n=8; square) at doses of 3.0E+10 and 2.8E+10 total vg (1:1 ratio), respectively, via round window membranes. Auditory Brainstem Response (ABR) thresholds were measured periodically at different frequencies over the year.

From week 4 (ABR 1) to week 40 (ABR 14) after injection, the ABR threshold at 15kHz frequency was higher for mice treated with the double AAV8-smCBA-muOTOF vector compared to mice injected with the double AAV8-CMV-muOTOF vector (fig. 2G).

Vector pairs consisting of AAV8-CMV-NterOTOFmu816_AP (1.3x10 ¹³ vg/ml) encoding the mouse otoxin protein of SEQ ID NO:79 and AAV8-CterOTOFmu817_AP (1.5x10 ¹³ vg/ml) of SEQ ID NO:80 were also used to treat 20 Otof ^-/- mice (between p21-p 22) after hearing. More specifically, these bi-vectors were delivered to the cochlea of DFNB mice after hearing appearance in P21 to 22 day old Otof ^-/- mice (n=20) as described in the materials and methods section.

At 18 weeks post injection, ABR analysis showed robust hearing recovery, which was maintained in all responding treated mice (9 out of 20), with an average threshold of 70dB (fig. 2E). 18 weeks after injection, the hearing of mouse #8 was markedly rescued to wild type levels (fig. 2E).

IHC transduction rates and teratogen expression were next studied in mice treated with double AAV8-CMV-muOTOF vector injection at the maturation stage. These mice were euthanized, their cochlea was microdissected, and immunolabeled for otoxin and ribeye (which is a synaptic marker that also stains IHC nuclei). All the injected cochlea from the responding mice showed different IHC transduction rates. In the cochlea of the best responding mouse (ABR threshold average 40db,15khz frequency), 60% to 81% of IHC is transduced throughout the cochlea spiral (from apex to base, fig. 2H). None of the OHCs in response mice expressed teratogens, confirming the specificity of our therapeutic vector.

These results indicate that the use of double AAV8 vectors and CMV promoters to deliver fragmented murine otoxin cDNA to the cochlea of Otof ^-/- mice before or after hearing appears results in full-length protein production, which is limited to IHC. Despite the differences in transduction rates, AAV gene therapy rescues the hearing of Otof ^-/- mice, which would otherwise remain severely deaf. Importantly, hearing recovery persists for at least nearly one year.

2.4.2. Double AAV8 expression of human Otof in Otof ^-/- mouse cochlea using CMV promoter

Next, gene therapy was tested for efficacy in reversing the deafness phenotype when administered in the maturation stage (between P18-P25 after hearing appearance) into the cochlea of DFNB mice using a dual AAV8 vector with a CMV promoter driving expression of human teratogen.

One of the best performing bipartite plasmids (double OTOF Nter-Cter 892-893) was also tested based on in vitro reconstitution of full-length human teratogen. Vectors consisting of AAV8-CMVNterOTOFhu _AP (1.1x10 ¹³ vg/ml) encoding SEQ ID NO. 56 and AAV8-CterOTOFhu893_AP (0.85x10 ¹³ vg/ml) encoding SEQ ID NO. 57 of full length human teratogen were injected into 17 Otof ^-/- mice after hearing onset (between P18-P25).

More specifically, these bi-vectors were delivered to the cochlea of DFNB mice after the Otof ^-/- mice, P18 to 25 days old, had developed hearing, as described in the materials and methods section.

Eighteen weeks after injection, ABR analysis showed that hearing rescue in responding mice (4 out of 14) was maintained at a threshold of 90dB on average (fig. 2F). However, the ABR threshold of the treated mice did not reach WT levels. At 18 weeks post injection, mice (# 3) recovered significantly to wild type levels (fig. 2F).

IHC transduction rates and otoabnormal protein expression were studied in mice treated with the double AAV8-CMV-huOTOF vector at maturity. These mice were euthanized, their cochlea was microdissected, and immunolabeled for otoxin and ribeye (which is a synaptic marker that also stains IHC nuclei). All of the injected cochlea from the responding mice showed transduced IHCs with different transduction rates. In the cochlea of the best responding mouse (# 3, 60dB average, frequency 15 kHz), 60% to 80% of the IHC is transduced throughout the cochlear spiral (from apex to base, fig. 2I).

Importantly, none of the OHCs of the responding mice expressed human teratogens, further confirming the efficacy of the therapeutic vector of the invention (achieving very high transfection rates in IHC, > 60%) and its favorable specificity.

In summary, delivery of the double AAV8 vector encoding the therapeutic transgene of human teratogen to the mature Otof ^-/- cochlea resulted in significant recovery of hearing in adult Otof ^-/- mice. These results indicate that, as with murine otoxin, the dual AAV8/CMV promoter driving human otoxin restored hearing in the DFNB mouse model and demonstrated that the combination was suitable for delivering therapeutic genes to IHC at the maturation stage.

Example 2: identification of novel isoforms of OTOF in humans

In PNAS publication (Akil et al., PNAS 2019), it has been demonstrated that hearing-restored murine transcripts differ from human isoform 5 transcripts in two ways:

The murine transcript has an additional exon (exon 6 in the mouse sequence), and

Exon 31 in murine transcripts is shorter than human exon 30, which is the equivalent in human isoform 5 transcripts (numbering is related to the deletion of exon 6 reported in humans).

Thus, a similar exon 6 sequence was searched for in the human intron 5 sequence. Almost identical regions were found in human sequences.

Splice donor and acceptor sites were then searched for on both sides of the newly discovered sequence, and as a result they were found to be indeed present. Finally, the amino acid sequences obtained by translation of the identified sequences are aligned, and the sequences are found to be highly conserved between human and mouse:

mouse_ Otof-202_exon 6_genome_seq=SEQ ID NO 65

CAAAGGCAGAGAGAAGACCAAGGGAGGCAGAGATGGCGAGCAC AA 45

Human_OTOF-205_putative_exon 6_genomic_seq=SEQ ID NO:66

CAAAGGCAGAGAGAAGACCAAGGGAGGCAGAGATGACGAGCAC AA 45

All nucleotides are identical except for the underlined nucleotides.

Mouse_ Otof-202_exon 6_protein_seq=SEQ ID NO:67

KGREKTKGGRDGEH 14

Human_OTOF-205_putative_exon 6_protein_seq=SEQ ID NO:68

KGREKTKGGRDDEH 14

All amino acids are identical except for the underlined amino acids.

Together, these factors constitute very strong evidence supporting the presence of exon 6 in the human OTOF gene as well.

Furthermore, the presence of the short form of exon 30 was observed in other human OTOF isoforms reported in the database (e.g., isoforms 2 and 3). Thus, the human therapeutic cDNA may also contain a short form of exon 30 (future exon 31 when complementing exons are considered).

According to the previous publication (Yasunaga et al., J Hum gene t 2000), alternative exon configurations were observed in the cochlea of the mice and involved 3 exons (configurations are shown in fig. 6). C2 is unique to the cochlea, and A1 and A2 and B1 and B2 are also present in the cochlea.

Human functional OTOF may actually be encoded by a cDNA sequence comprising:

-A1-B2-C2 (same as murine transcript): comprising exon 6 and shorter exon 30 (SEQ ID NO: 16), the protein encoding SEQ ID NO:6

-A1-B1-C2: comprising exon 6 and exon 30 of normal size (SEQ ID NO: 17), the protein encoding SEQ ID NO:7

-A2-B2-C2: has NO exon 6 but a shorter exon 30 (SEQ ID NO: 18), encoding the protein of SEQ ID NO: 8.

In addition to the current human isoform 5 transcript, these novel isoforms will encode proteins of SEQ ID No.6, SEQ ID No. 7 and/or SEQ ID No. 8 that have the potential to restore human hearing.

Reference to the literature

Ahmed et al,JARO 18:649-670(2017)

Akil et al.Proc Natl Acad Sci U S A.2019Mar 5；116(10):4496-4501

Dai C.et al,JARO,18:601-617,2017

Delmaghani et al.Cell.2015Nov 5；163(4):894-906

Duan D.et al,Molecular Therapy 2001,vol.4,N°4,pp.383-391

Dulon et al.J Clin Invest.2018Aug 1；128(8):3382-3401

Duman D.&Tekin M,Front Biosci(Landmark Ed)17:2213-2236(2012)

Emptoz et al.Proc Natl Acad Sci U S A.2017Sep 5；114(36):9695-9700

Ghosh et al.Hum Gene Ther.2011 Jan；22(l):77-83

Hardelin et al.,médecine/sciences 2019；35:1213-25

Kral A&O’Donoghue GM N Engl J Med 363(15):1438-1450(2010)

Lock et al.2014 Human Gene Therapy Methods 25:115-125

Marlin S.et al,Biochemical and Biophysical Research Communications,394(2010)737-742

Michalski et al,Elife,2017 Nov 7；6 e31013

Pangrsic T.et al,Trends in Neurosciences,2012,col.35,No.11

Pujol et Lavigne-Rebillard,Acta oto-laryngologica.

Supplementum·February 1991

Roux et al,Cell 127(2):277-89,2006

Starr A.et al,Brain,Volume 119,Issue 3,June 1996,Pages 741–753

Suzuki et al.,Sci.Rep.7:45524(2017)；

Varga R.et al,J.Med.Genet 2006；43:576-581

Yasunaga S et al,J Hum Genet.2000 Sep；67(3):591-600

Yoshimura et al.,Sci.Rep.8:2980(2018)

Zhang et al,Frontiers in Molecular Neuroscience,vol.11,Art.221,2018

Zhang Q.et al,Hearing research,Volume 335,May 2016,Pages 53-63

Claims

1. A vector system comprising at least two different AAV particles, namely:

Wherein the first polynucleotide and the second polynucleotide comprise recombinantly occurring polynucleotide sequences,

And wherein the coding sequences in the first polynucleotide and the second polynucleotide, when combined, encode isoform 5 of the teratogen polypeptide or a functional fragment thereof.

2. The vector system according to claim 1, wherein the otoxin gene has the sequence SEQ ID NO. 15 or a homologous sequence thereof.

3. The carrier system according to any one of claims 1 to 2, comprising:

a) At least one AAV8 particle comprising a first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: CMV promoter followed by a partial coding sequence comprising the N-terminal coding portion of the otoxin gene, and splice donor site, and

B) At least one AAV8 particle comprising a second polynucleotide, the second polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and from 5 'to 3' between the inverted terminal repeat sequences: splice acceptor sites, partial coding sequences comprising the C-terminal coding portion of an otoabnormal protein gene, optionally followed by polyadenylation sequences,

Wherein the first polynucleotide and the second polynucleotide further comprise a second recombination occurrence sequence located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide.

4. A vector system according to claims 1 to 3, wherein the second recombination occurrence sequence is the foreign sequence of SEQ ID No. 69.

5. The vector system of claims 1-4, wherein the CMV promoter has the sequence of SEQ ID No. 9 or a homologous sequence thereof.

6. Vector system according to claims 1 to 5, wherein the CMV promoter is followed by an intron sequence, preferably SEQ ID No. 10, upstream of the N-terminal coding part of the teratogen gene.

7. The vector system according to claims 1 to 6, wherein the second polynucleotide further comprises the WPRE sequence of SEQ ID No. 23.

8. The vector system of any one of claims 1-7, wherein the N-terminal coding portion of the teratogen gene comprises: the sequence is SEQ ID NO. 15, nucleotide 1-2214, nucleotide 1-2406, nucleotide 1-2523, nucleotide 1-2676, nucleotide 1-2991 or nucleotide 1-3126 or homologous sequence thereof.

9. The carrier system according to claim 8, comprising at least:

a) An AAV8 particle comprising a first polynucleotide, the first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and comprising, from 5 'to 3' between the inverted terminal repeat sequences: the CMV promoter of SEQ ID NO. 9 and optionally the intron sequence of SEQ ID NO. 10, followed by nucleotides 1 to 2214, nucleotides 1 to 2406, nucleotides 1 to 2523, nucleotides 1 to 2676, nucleotides 1 to 2991 or nucleotides 1 to 3126, and a splice donor site of the otoxin gene of SEQ ID NO. 15, and

B) An AAV8 particle comprising a second polynucleotide, said second polynucleotide comprising an inverted terminal repeat sequence at each end of said polynucleotide, and comprising, from 5 'to 3' between said inverted terminal repeat sequences: splice acceptor sites, nucleotides 2215-5991, nucleotides 2407-5991, nucleotides 2524-5991, nucleotides 2677-5991, nucleotides 2992-5991 or nucleotides 3127-5991 of the otoxin gene of SEQ ID NO. 15, optionally followed by a WPRE sequence and/or a polyadenylation sequence,

Wherein the first polynucleotide and the second polynucleotide further comprise an AP recombination occurrence sequence of SEQ ID NO. 69, which recombination occurrence sequence is located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide.

10. The carrier system according to any one of claims 8 or 9, comprising at least:

a) An AAV8 particle comprising a first polynucleotide, the first polynucleotide comprising an inverted terminal repeat sequence at each end of the polynucleotide, and comprising, from 5 'to 3' between the inverted terminal repeat sequences: the CMV promoter of SEQ ID NO. 9 and optionally the intron sequence of SEQ ID NO. 10, followed by nucleotides 1 to 2214, nucleotides 1 to 2676 or nucleotides 1 to 2991 of the otoxin gene of SEQ ID NO. 15, and a splice donor site, and

B) An AAV8 particle comprising a second polynucleotide, said second polynucleotide comprising an inverted terminal repeat sequence at each end of said polynucleotide, and comprising, from 5 'to 3' between said inverted terminal repeat sequences: splice acceptor sites, nucleotides 2215-5991, nucleotides 2677-5991 or nucleotides 2992-5991 of the otoxin gene of SEQ ID NO. 15, optionally followed by a polyadenylation sequence,

Wherein the first polynucleotide and the second polynucleotide further comprise an AP recombination occurrence sequence of SEQ ID NO:69, the recombination occurrence sequence being located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide, and

11. A pharmaceutical composition comprising the carrier system of any one of claims 1 to 10 and a pharmaceutically acceptable vehicle.

12. The pharmaceutical composition according to claim 11, for use in the treatment of a patient suffering from DFNB a 9 deafness or for use in the prevention of DFNB a deafness in a patient having a DFNB a 9 mutation.

13. The composition for use according to claim 12, wherein the patient is a human patient diagnosed with DFNB deafness after language learning.

14. The composition for use according to claim 12 or 13, wherein the patient is an adolescent or adult suffering from DFNB s of deafness induced by a thermosensitive mutation.

15. The composition for use according to claim 14, wherein the heat-sensitive mutation is selected from the group consisting of: PQ994VfsX, p.i515T, p.g541s, PR1607W, pE1804del, c.2975_2978delAG/c.4819c > T, c.4819c > T (c.r1607w).