CN118203618A - Application of traditional Chinese medicine formula in preparation of medicine for treating uveitis - Google Patents

Abstract

The invention belongs to the field of medicines, and discloses an application of a traditional Chinese medicine formula in preparing a medicine for treating uveitis, wherein the traditional Chinese medicine formula comprises the following components: astragalus root, sinomenine, angelica, tuckahoe, red paeony root, szechuan lovage rhizome, divaricate saposhnikovia root and bupleurum. The traditional Chinese medicine composition suppresses the immune inflammatory reaction of uveitis from relieving microcirculatory hypoxia as a break, has good curative effect on uveitis, can reduce the inflammatory state of the uveitis, promote the regression of inflammation and reduce side effects; the traditional Chinese medicine has the effects of tonifying qi, activating blood, regulating immunity and improving microcirculation, has the effects of eliminating pathogenic factors, strengthening body resistance, removing blood stasis and removing dampness, excretes dampness, eliminates dampness, relieves heat and relieves blood, and provides a new treatment idea for the mechanism of relieving microcirculation hypoxia for uveitis. Can also relieve the side effects of medicines caused by long-term clinical use of glucocorticoid and immunosuppressant, strengthen body resistance and eliminate pathogenic factors, reduce recurrent attacks, and reduce the serious trouble of physiology and psychology of patients.

Description

Application of traditional Chinese medicine formula in preparation of medicine for treating uveitis

Technical Field

The invention belongs to the technical field of uveitis medicines, and particularly relates to application of a traditional Chinese medicine formula in preparation of a medicine for treating uveitis.

Background

Uveitis is an inflammatory disorder involving the uvea, retina, retinal blood vessels and vitreous body, which has serious influence on the visual ability of patients, even causes blindness, and has long disease course, high recurrence rate, and easy occurrence of complications and sequelae, which is not only a common disease species of ophthalmology but also a problematic disease species. The treatment of the traditional Chinese medicine composition mainly comprises glucocorticoid and immunosuppressant, and the side effects of the traditional Chinese medicine composition caused by long-term use cannot be avoided, and the traditional Chinese medicine composition is easy to repeatedly attack, so that great trouble is caused to patients.

The related immune mechanisms of uveitis have been research hotspots in the ophthalmic field, and most of the mechanisms involve types III and IV of hypersensitivity reactions. However, in fact, changes in uveal blood flow and inflammation of the uveal blood vessels are important pathological changes. An important factor in analyzing the pathogenesis of uveitis: the grape membrane is a vascular membrane and a pigment membrane, and has the characteristics of large vascular area and large total blood volume, but the vascular network interweaves with the staggered nodes in the grape membrane, has low blood flow speed, small entrance and exit, is easy to permeate, and simultaneously, the pigment membrane is easy to generate immune response to generate immune complex, and the exogenous immune complex of the eyeball is easy to deposit on the vascular wall when flowing through, so that the limited vasculitis is caused, namely, the Arthus reaction occurs in the grape membrane. When inflammation occurs, the vascular wall permeability of the micro-circulation vascular of the uveal retina is increased, the blood concentration further slows down the blood flow rate and even stagnates, small blood vessels can be observed to dilate, a large number of red blood cells in the lumen are densely blocked, so that local tissue is anoxic, and the anoxic further causes the metabolic, functional and morphological structure changes of the tissue to form a malignant circulation. Therefore, based on the pathological process, besides how to directly inhibit immune response, promote the clearance of immune complex and relieve the adhesion and infiltration of inflammatory cells, relieve the stasis in blood vessels of the grape membrane, improve the state of microcirculation hypoxia, explore the relationship between hypoxia and immune response alleviation, and are also important directions for treating the grape membrane inflammation and relieving the recurrent attacks of the grape membrane inflammation.

Research shows that the auxiliary treatment of the traditional Chinese medicine can relieve symptoms, promote inflammation to subside and reduce side effects. However, basic researches on prevention and treatment of uveitis by traditional Chinese medicine are not seen at present. The traditional Chinese medicine pathogenesis considers that repeated attacks of uveitis belong to deficiency-excess inclusion and rheumatism heat-retention syndrome. The syndrome differentiation analysis shows that the pathogenic wind-damp-heat is serious, stagnates in the middle-jiao and the clear yang is not ascending, so that the eyes are distended and painful; the damp-heat fumigates the liver and gallbladder, so that the white eyes are mixed with red, and the spirit is turbid; swelling of the joints, soreness and pain and the like are caused by damp-heat viscous joints. In the theory of traditional Chinese medicine, the grape film is the place where qi and blood are concentrated, and the theory of Lingqiao, pathogenic qi viscera disease shape is that: twelve main meridians, three hundred and six five collaterals, all of which are on the upper surface and lead to the orifices, and all of which are on the eyes. Qi and blood are the material basis of vital activities of human body, and eye diseases can occur due to blood stagnation, viscera unbalance, essence and qi deficiency and nutrient loss caused by various reasons. In the yellow emperor's interior meridian, "qi is the general of blood, qi is moving and qi stagnation is causing blood stasis, qi deficiency also causes blood stasis. The 'tonifying qi and strengthening the body resistance' are regarded as effective means for regulating the immune function in modern medicine, and eliminating pathogenic factors is regarded as eliminating the damage of pathogenic factors to organisms, thereby protecting the healthy qi. Both of them can eliminate the pathogenic factors from the body resistance and eliminate the pathogenic factors from the body resistance. It is used in clinical practice to strengthen body resistance without keeping pathogenic factors and eliminate pathogenic factors without damaging body resistance.

Therefore, research on a traditional Chinese medicine composition for treating uveitis has very important significance for treating uveitis.

Disclosure of Invention

The invention aims to solve the technical problems and overcome the defects and shortcomings in the background art, and provides application of a traditional Chinese medicine formula in preparation of a medicament for treating uveitis.

In order to solve the technical problems, the technical scheme provided by the invention is as follows:

An application of a traditional Chinese medicine formula in preparing a medicament for treating uveitis, wherein the traditional Chinese medicine formula comprises the following components: astragalus root, sinomenine, angelica, tuckahoe, red paeony root, szechuan lovage rhizome, divaricate saposhnikovia root and bupleurum.

In the application, preferably, the traditional Chinese medicine comprises the following components in parts by weight: 30-50 parts of astragalus membranaceus, 10-15 parts of caulis sinomenii, 15-20 parts of radix rehmanniae, 10-15 parts of radix angelicae sinensis, 15-20 parts of poria cocos, 10-15 parts of radix paeoniae rubra, 10-15 parts of ligusticum wallichii, 10-15 parts of radix sileris and 10-15 parts of radix bupleuri.

Preferably, the traditional Chinese medicine comprises the following components in parts by weight: 30 parts of astragalus, 12 parts of caulis sinomenii, 15 parts of radix rehmanniae, 12 parts of Chinese angelica, 15 parts of poria cocos, 10 parts of red paeony root, 10 parts of szechuan lovage rhizome, 10 parts of divaricate saposhnikovia root and 10 parts of Chinese thorowax root.

Preferably, the uveitis is autoimmune uveitis.

Preferably, the uveitis is autoimmune uveitis induced by a combination of IRBP and TB.

Preferably, the uveitis drug is an oral drug.

Preferably, the uveitis drug is in a solution type or a powder type.

Preferably, the uveitis drug is prepared by a water decoction method.

Compared with the prior art, the invention has the beneficial effects that:

1. The invention discovers that the traditional Chinese medicine formula can inhibit the immune inflammatory reaction of uveitis from relieving microcirculatory hypoxia to break, has good curative effect on uveitis, can relieve the inflammatory state of the uveitis, promote the inflammation to subside and reduce side effects; the traditional Chinese medicine has the effects of tonifying qi, activating blood, regulating immunity and improving microcirculation, has the effects of eliminating pathogenic factors, strengthening body resistance, removing blood stasis and removing dampness, excretes dampness, eliminates dampness, relieves heat and relieves blood, and provides a new treatment idea for the mechanism of relieving microcirculation hypoxia for uveitis.

2. The application of the invention can relieve the side effects of the medicines caused by long-term clinical use of glucocorticoids and immunosuppressants, strengthen body resistance to eliminate pathogenic factors, reduce repeated attacks and reduce the great trouble of physiology and psychology of patients.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a photograph of the anterior ocular segment of each group of mice in example 1; wherein A: blank, normal C57BL/6 (B6) mice; b: blank (post-mydriatic), normal C57BL/6 (B6) mice; c: model group, day 14 post immunization; d: model group (post-mydriasis), day 14 post-immunization; e: compound low dose group, day 7 dosing; f: compound medium dose group, day 7 of dosing; g: compound high dose group, day 7 dosing; h: compound high dose group (post-mydriasis), day 7 of dosing;

FIG. 2 is a graph of clinical scores of anterior ocular segment inflammation in mice in example 1 (P < 0.05);

Fig. 3 is a fundus photographic image of the mouse of example 1, wherein a: blank group, normal C57BL/6 (B6), the artery and vein tube diameter of the fundus of the mouse is even; b: model group, day 14 after immunization, retinal edema, vascular occlusion, appearance of white sheath; c: model group, 14 days after immunization, retinal edema with plaque-like exudation, blood vessel blurring; d: compound low dose group, 7 th day of administration, obvious fundus vasodilation congestion and white sheath of partial blood vessel; e: in the compound medium dose group, on the 7 th day of administration, the occlusion condition of blood vessels is reduced compared with the 14 th day of immunization, partial vascular white sheath and arterial-venous caliber ratio are restored; f, compound high-dose group, on the 7 th day of administration, the refractive medium is slightly turbid, the flocculent exudation of the fundus multiple spots is obviously absorbed before, and the blood vessel congestion and the expansion of the fundus are relieved;

FIG. 4 shows the inflammatory behavior of eyeball pathological tissue of mice in the EAU model group of example 1 (HE staining X400); wherein A: the ciliary body is infiltrated by a large number of inflammatory cells; b: fiber disintegration and edema in the lens cortex; c: vitreous cavity inflammatory cells and flocculent exudation;

FIG. 5 is a graph of comparison of retinal pathological tissues of mice of example 1 (HE staining X400, GCL: ganglion cell layer, IPL: inner network layer, INL: inner particle layer, 0PL: outer network layer, ONL: outer particle layer); wherein A: blank, normal C57BL/6 (B6) mouse retina; b: in the model group, ganglion cell layer telangiectasia congestion is visible on 10 th day after immunization, and inner particle layer is thinned; c: model group, ganglion cell tissue edema, retinal tissue structural disorder seen on day 12 post immunization; d: compound low dose group, day 7 of administration, visible inner and outer reticular layers infiltrated inflammatory cells; e: in the compound medium dose group, inflammatory cells and flocculent exudation appear in the vitreous cavity on day 7 of administration; f: in the compound high-dose group, obvious inflammatory cells are not found in retina and vitreous cavity on the 7 th day of administration, and edema of tissue cells of each group is resolved;

FIG. 6 shows ELISA assay results for serum (MAPK 8, STAT3, IL-10, IL-17, IL-6, TNF-. Alpha.) from each group of mice in example 1 (indicating a difference p <0.05 between the two groups in the line);

FIG. 7 is an analysis of ELISA assay results for each group of mouse retinal homogenates (AhR, HIF-1. Alpha., VEGFA) of example 1 (indicating a difference p <0.05 between the two groups connected);

FIG. 8 is a diagram of the analysis of the pearson correlation coefficients of ELISA detection results for each group of mice AhR, HIF-1α, VEGFA in example 1;

Figure 9 is the proportion of mouse Treg cell subpopulations in example 1;

FIG. 10 is the proportion of Th17 cell subsets in example 1;

FIG. 11 shows the relative expression levels of mRNAs for HIF-1α, VEGF, AHR, MAPK8, MAP2K1, STAT3, NF-kb, TLR4, IL-6 in example 1; wherein a: HRMEC cell groups; b: HRMEC +cocl ₂ group; c: HRMEC +cocl ₂ +15% drug-containing serogroup; d: HRMEC +cocl ₂ +15% normal serogroup; e: HRMEC +cocl ₂ +10% drug-containing serogroup; f: HRMEC +cocl ₂ +10% normal serogroup; * Significant difference p <0.05 from the blank; significant difference p <0.05 from model group, # and; significant differences p <0.05 between groups delta and c;

FIG. 12 shows changes in pathway-related proteins HIF-1α, VEGFA, p38-MAPK, p-STAT3 (# representing statistically significant p <0.05 compared to model group) in the different experimental groups (a, b, c, d, g five groups) of CoCl ₂ treatment HRMEC of example 1.

Detailed Description

The present invention will be described more fully hereinafter with reference to the accompanying drawings, in which preferred embodiments are shown, for the purpose of illustrating the invention, but the scope of the invention is not limited to the specific embodiments shown.

Unless defined otherwise, all technical and scientific terms used hereinafter have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the scope of the present invention.

Unless otherwise specifically indicated, the various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or may be prepared by existing methods.

Example 1:

An application of a traditional Chinese medicine formula in preparing a medicament for treating uveitis is provided, wherein the traditional Chinese medicine formula comprises the following components: 30g of astragalus, 12g of caulis sinomenii, 15g of radix rehmanniae, 12g of Chinese angelica tail, 15g of poria cocos, 10g of red paeony root, 10g of szechuan lovage rhizome, 10g of divaricate saposhnikovia root and 10g of Chinese thorowax root, and is prepared by a traditional Chinese medicine compound water decoction method.

The invention is found in the early research: the clinical curative effect, recurrence condition and average cure days of the uveitis before the traditional Chinese and western combined treatment are superior to those of the pure western medicine treatment. Pupil mental shrinkage, conjunctival congestion, blurred vision, eye pain and the like are the main clinical symptoms of uveitis, and are four types of syndromes of liver and gall fire, liver meridian wind-heat, deficiency fire flaming up and rheumatism and heat according to the differentiation of symptoms of traditional Chinese medicine. The heat, wind and dampness are pathological factors in the acute stage of uveitis, wherein the heat is a basic pathological factor, and the yin deficiency is a key pathological factor in the recurrent chronic stage of uveitis, so in clinical treatment, the acute stage needs to eliminate pathogenic factors, and the recurrent chronic stage needs to take into account the effects of strengthening and protecting yin fluid and regulating and controlling blood and qi. Through network pharmacological research, the treatment mechanism of the prescription for invigorating qi, activating blood, dispelling wind and removing dampness on uveitis is predicted to be not limited to play an anti-inflammatory effect, and the mechanism for improving ischemia and hypoxia and regulating immune balance plays a key role.

In order to prove the application effect of the traditional Chinese medicine composition, the invention provides the effect of the traditional Chinese medicine composition on autoimmune uveitis mice, and the effect research experiment is as follows. The animal modeling method adopted by the invention is a classical modeling method for researching uveitis, and the method can represent the pathological process and pathophysiological manifestations of clinical uveitis.

1. The Chinese medicinal composition acts on the effectiveness research of EAU (experimental autoimmune uveitis) mice

1 Materials and methods

1.1 Experimental animal Source and feeding

SPF-class C57BL/6 (B6) mice 30 (female, 6-8 weeks old) with mass 18-22g (Beijing vitamin Toril Hua laboratory animal technology Co., ltd.) were bred in Hunan university animal experiment center, and the use and feeding process of the laboratory animals were approved by Hunan university animal experiment center and laboratory animal administration and use committee of the institute of Chinese medicine and five sense organs.

1.2 Grouping and treatment of animals

30 Healthy female 6-8 week old (18-22 g in mass) C57BL/6 (B6) mice were selected and randomly divided into 5 groups: blank group, model group, traditional Chinese medicine formula treatment low dose group, traditional Chinese medicine formula treatment medium dose group, traditional Chinese medicine formula treatment high dose group, 6 mice each.

The EAU model was induced by subcutaneous injection of pure antigen protein in the model group and compound group mice. Ocular inflammatory responses were observed under a slit lamp microscope every other day following active immunization, scored 1, 7, 14, 21 days post immunization. The blank group was subjected to equivalent physiological saline lavage treatment (0.3 ml/time/mouse, 2 times/d); when the inflammation reaches the peak period on the 14 th day after immunization, the compound group starts to infuse the mice with the medicine every day, 0.3 ml/time/mouse is infused, 2 times/d (the low, medium and high groups are respectively converted according to the dosage of 1:2:4, and the low dosage group is converted by 12.33 times of the dosage of the human mouse), the eyeball tissues of the mice are taken to prepare pathological sections after the 14 th day of immunization of the mice in the model group, and HE staining is used for observation, and the blank group and the compound group mice are treated the same on the 20 th day after molding (7 days after administration).

1.3 Animal modeling method

30 Mice were weighed and recorded separately, and 3% sodium pentobarbital (1 ml/kg, about 0.2 ml/mouse) was used for intraperitoneal injection anesthesia, and irbp+tb reagent molding (300 ugIRBP/mouse+250 ugTB/mouse) was used instead of the blank mice using an equal amount of physiological saline+pbs mixture. Each mouse was subcutaneously injected with IRBP (inter-photoreceptor vitamin a-binding protein) cocktail containing TB (mycobacterium tuberculosis) using a threaded syringe at 4 injection points: the neck and back (0.05 mL), the ventral rib parts on two sides (0.1 mL in total) and the caudal back (0.05 mL), namely, each mouse is injected with 0.2mL in total, and then BCG vaccine (0.4 mug/mouse) is injected in the abdominal cavity to serve as an additional immune adjuvant for one immunization.

1.4 Observation and clinical scoring of ocular anterior segment and fundus inflammation in EAU mouse model

After immunization of the mice, the anterior ocular segment was observed daily using a microscopic slit lamp, the fundus of the mice was observed using a fundus camera, clinical sign changes were recorded and photographed, and the anterior ocular segment inflammatory manifestations of the mice were scored by referring to the method of Caspi, see table 1.

TABLE 1 Caspi evaluation criteria for the anterior uveal inflammatory response

1.5 Histopathological examination

14D after immunization, the mice were sacrificed under chloral hydrate anesthesia and eyeballs were removed. Conventionally taking 3mm thick tissues, sequentially placing slices into xylene I-xylene II-absolute ethanol I-absolute ethanol II-75% alcohol (20 min, 5min and 5min respectively), and washing with tap water. Hematoxylin staining is carried out for 3-5min, hydrochloric acid aqueous solution is differentiated, ammonia aqueous solution returns to blue, and water washing is carried out. The sections were dehydrated in 85%, 95% gradient alcohol and stained in eosin for 5min. The slices are sequentially put into absolute ethyl alcohol I-absolute ethyl alcohol II-absolute ethyl alcohol III-dimethyl I-xylene II for transparency (each solution time is 5 min), and the neutral resin is sealed. After the manufacture is finished, microscopic examination is started, and image acquisition and analysis are finished.

1.6 Statistical analysis

All data were analyzed and mapped using GRAPHPAD PRIM 9.4.4 statistical software, and the data were measured usingThe variance alignment was checked using level. The statistical difference comparison adopts single-factor analysis of variance, and the comparison between every two groups adopts LSD test, and the test level is as follows: p <0.05 indicates that the difference is statistically significant.

2 Results

2.1 Observations and clinical scores under the Pre-ocular segment slit lamp of mice

The observation of the blank mice under the microscopic slit lamp before and after pupil expansion shows that the cornea is transparent, the iris morphology is normal, the aqueous humor of the anterior chamber is clear, the crystal is transparent, and the fundus has red light reflection. After the mice with the model set are actively immunized, the inflammatory reaction of the anterior ocular segment is observed to be gradually obvious, the iris blood vessel is slightly dilated, the blood vessel of the corneoscleral limbus is engorged, then cornea edema, the iris blood vessel is dilated and engorged forward, and the anterior chamber is narrow and shallow. During the peak period of inflammation (12 d-14 d after immunization), the iris is abnormal in morphology and unclear in texture, and partial atrophy and adhesion are caused. Part of the aqueous humor is shiny, the pupil is closed, and white inflammatory secretion is visible.

The crystal turbidity is gradually increased, and part of fundus red light reflection is weakened or even disappears. Compound mice began 7 days of continuous dosing at day 14 post immunization, with a gradual decrease in inflammatory response, a clear aqueous humor, and a peeking pupil (see fig. 1). Anterior ocular segment inflammation score for each group of mice: inflammation was scored and statistically analyzed based on the anterior ocular segment performance of each group of mice (see fig. 2). The inflammation score of the model group mice on day 14 after immunization is obviously higher than that of the blank group, and the comparison difference of the two groups of inflammation scores has statistical significance (P < 0.05); on day 21 post immunization, the compound high dose group (7 days post dosing) had a lower inflammation score, and the differences were statistically significant (P < 0.05) compared to the model group.

2.2 Fundus photography observations of mice

The fundus disk circle is displayed by photographing and observing the fundus of the mice in the blank group, the boundary is clear, and the color is uniform. The retinal blood vessel has normal trend, uniform diameter of the dynamic and static vessels and normal proportion. The retina was visibly wet silk-like reflected and was not visibly abnormal. In model mice, at peak inflammatory stage (12 d-14 d after immunization), ocular fundus appears with clear optic disc boundary, retinal vessel distention or vessel occlusion or white sheath, peripheral retina is slightly edematous and accompanied by punctiform exudation. The mice in the compound group were continuously administered for 7 days at the peak of inflammation, and after the administration of the high dose group, the eyeground edema was resolved, the arteriovenous vessels were not obviously dilated, and the eyeground exudation was absorbed before (see fig. 3).

2.3 HE staining of eye pathological tissue of mice

HE staining showed that the retinal tissue structure of the blank group was regular, the demarcation of each layer was clear, and no obvious inflammatory cells were seen. After cornea, ciliary body, vitreous cavity and retina of the model group, inflammatory cells infiltrate to different degrees, and fiber disintegrates and oedema in lens cortex. Retinal tissue edema, loose arrangement structure, ganglion cell layers and outer reticular layers with small vasodilation seen, vitreous cavities with inflammatory cells and flocculent exudation. After the traditional Chinese medicine composition acts, the inflammatory cells of the compound composition are obviously reduced, and the retina tissue structure gradually returns to normal. (see FIG. 4, FIG. 5)

3 Knots

The invention adopts a human autoimmune uveitis classical experimental animal model EAU, which is considered as an ideal model for evaluating the degree of uveitis and guiding a drug treatment strategy. The main lesion sites of EAU are retina and choroid, the model has typical inflammation manifestation, good repeatability and stability, convenient quantitative analysis and common onset of the disease in mice in 14-21 days. The IRBP used in this experiment is a common antigen for inducing an EAU model, and is present in the matrix between photoreceptors, and after the IRBP immunization, the symptoms of the experimental animal are obvious on day 13, and inflammatory reactions are visible in iris, ciliary body, choroid and retina. In the experiment, the mice show obvious ocular inflammation signs after 12-14 days after immunization, such as slight expansion of iris blood vessels and congestion of corneoscleral blood vessels, and then corneal edema, iris bulge and narrow and shallow anterior chamber are caused. The iris in peak period has abnormal morphology, unclear texture, partial atrophy and adhesion, irregular pupils and membrane closure, and white inflammatory secretion can be seen. The crystal turbidity is gradually increased, and part of fundus red light reflection is weakened or even disappears. The fundus photography display model group can be described as that fundus blood vessels obviously dilate, partial blood vessels have white sheaths or occlusion, partial omentum edema and plaque-like exudation, and the signs all indicate that the modeling is successful, and the clinical characteristics of uveitis are met. HE slice pathology characteristics are consistent with clinical characteristics. According to the evaluation standard of the grape membrane inflammatory reaction before Caspi, the clinical observation score is subjected to statistical analysis, and obvious differences exist between the model group and the compound high-dose group, so that the method has statistical significance. In clinical observation, the compound low and medium dose groups have reduced clinical manifestation compared with the model group, but have no obvious statistical difference after scoring. Meanwhile, compared with a model group, the compound fundus photography of the low and medium dose groups has less exudation, but the problems of vasodilation, white sheath and the like are serious in the higher dose group. The inflammatory infiltration and the structural damage degree of the pathological tissue section are consistent with the pre-clinical observation result, namely the result shows that the compound high-dose group has the best effect of improving the inflammation of the EAU mice. According to the above, the effect of invigorating qi, activating blood and regulating immunity by using astragalus root is clinically proved in the experimental result. This result also provides a reference for the subsequent animal experiments to set up two groups of low and high doses.

2. Traditional Chinese medicine composition acting on MAPK (MAPK immune regulation) pathway and HIF pathway hypoxia improvement mechanism of EAU (EAU mice)

1 Materials and methods

1.1 Grouping and treatment of animals

24 Healthy female 6-8 week old (18-22 g in mass) C57BL/6 (B6) mice were selected and randomly divided into 4 groups: blank, model, low dose, high dose (only low and high dose groups are reserved, and the low and medium dose groups have significant statistical differences from the high dose treatment groups in the validity evaluation of the first experiment), and 6 mice are treated by the low dose group and the high dose group. The EAU model was induced by subcutaneous injection of pure antigen protein in the model group and compound group mice. After active immunization, ocular inflammatory responses were observed under a slit lamp microscope every other day. The blank group was subjected to equivalent physiological saline lavage treatment (0.3 ml/time/mouse, 2 times/d); at day 14 after immunization, the compound group starts to administer mice with drugs daily for gastric lavage, 0.3 ml/time/mouse, 2 times/d (the low dose group is converted by 12.33 times of the human mouse drug dose, and the ratio of the low group to the high group is 1:4). Determining the expression level of mouse serum MAPK8, STAT3, IL-10, IL-17, IL-6 and TNF-alpha by ELISA; ELISA method is adopted to measure the expression level of AhR, HIF-1 alpha and VEGFA in the mouse retina tissue homogenate; flow cytometry was used to determine mouse spleen tissue Treg and Th17 cells. Blank and compound mice were treated identically on day 20 post-molding (7 days post-dosing).

The blood sampling method comprises the following steps: the experiment adopts the steps of removing eyeballs for blood sampling, taking 0.5-1 ml of blood sampling amount of each mouse, taking lateral position of the mouse, and pressing the skin around the eyes of the mouse to the back of the neck as much as possible so as to make the eyeballs protrude. The eyeball is rapidly clamped or sheared off by the ophthalmic curved forceps, the mouse is inverted, and the blood flowing out is collected by the vacuum blood taking needle. And (5) immediately stopping bleeding by compression with gauze after blood collection. Collecting blood, adding into sterile test tube, standing for 1 hr, centrifuging at 4deg.C and 2500r/min for 10min, collecting supernatant, discarding precipitate, and placing in a refrigerator at-20deg.C for use. Retinal homogenate collection method: after the eyeball is removed rapidly, the eyeball is repeatedly washed by normal saline, cut after the corneoscleral limbus, cornea and crystalline lens are removed, the eyeball wall is turned over to deliver vitreous body, the normal saline is washed from the incision edge to the center of the rear pole part by a syringe until the retina is completely detached, only the optic nerve head is connected, the retina is clamped by an ophthalmic forceps and placed on filter paper, the filter paper is weighed, the filter paper is added into a glass homogenizer according to the proportion of normal saline (V) =1:9 by wet weight (W), ice bath and grinding are carried out for 5min, 10% tissue homogenate can be prepared, a freezing centrifuge is used for centrifuging 3500r/min, supernatant is taken after 5min, and the filter paper is placed in a refrigerator at the temperature of minus 20 ℃ for standby.

Spleen harvesting method: mice were sacrificed by cervical dislocation, whole spleens were dissected and crushed in ice, then filtered through a 70um pore size Falcon cell screen, cell suspensions were collected, red blood cell lysates were added, centrifuged, and the supernatant was discarded and repeated 2 times. Resuspension with MACS buffer, sieving the suspension with a Falcon cell sieve with a 40 μm pore size, collecting the filtered cell suspension, and detecting by flow cytometry.

1.2ELISA detection of MAPK8, STAT3, IL-10, IL-17, IL-6, TNF-alpha expression levels in mouse serum

The ELISA kit is used for detecting the expression level of related proteins and inflammatory factors in the serum of each group of mice. ELISA kits detect the expression levels of MAPK8, STAT3, IL-10, IL-17, IL-6, TNF-alpha in blood. And adding a standard substance, a detection sample and a detection antibody marked by horseradish peroxidase into an ELISA plate hole, and incubating to combine MAPK8, STAT3, IL-10, IL-17, IL-6, TNF-alpha and the like in the sample with corresponding solid-phase antibodies and detection antibodies. After washing to remove unbound material, horseradish peroxidase-labeled streptavidin is added. After washing, the chromogenic substrate TMB is added and developed in the dark. The intensity of the color response is proportional to the concentration of each cytokine in the sample. The reaction was terminated by adding a termination solution, and the absorbance was measured at a wavelength of 450 nm.

1.3ELISA detection of expression levels of AhR, HIF-1. Alpha. And VEGFA in mouse retinal tissue homogenates

The expression level of the relevant protein in the retinal tissue homogenate of each group of mice was detected using an ELISA kit. ELISA kit detects the expression level of AhR, HIF-1 alpha and VEGFA in blood. The standard substance, the detection sample and the detection antibody marked by horseradish peroxidase are added into the holes of the enzyme-labeled plate, and the incubation can lead AhR, HIF-1 alpha, VEGFA and the like existing in the sample to be combined with the corresponding solid phase antibody and the detection antibody. Washing, washing unbound material, and adding horseradish peroxidase-labeled streptavidin. Light protection is required after addition of chromogenic substrate TMB. The shade of color developed is proportional to the concentration of each cytokine in the sample. The reaction was terminated by adding a termination solution, and the absorbance was measured at a wavelength of 450 nm.

1.4 Flow cytometry detection of Treg, th17

Th17 staining: adding 4ulFITC labeled CD4 antibody, incubating at 4deg.C in dark place for 30min, washing twice, adding 2 μLIL-17A antibody, incubating again, washing, and re-suspending. Treg staining: 4ul of FITC-labeled CD4 antibody and 5ul of PE-Cy-labeled CD25 antibody were added sequentially, incubated and washed twice after mixing, 2ulPE of labeled Foxp3 antibody was added, followed by incubation, washing and resuspension. Both were resuspended and the cell percentages were analyzed on a cell flow cytometer using cytpert2.0 software.

1.5 Statistical analysis

All data were analyzed and mapped using graphpadprim9.4 statistical software, and the data were measured usingThe variance alignment was checked using level. The statistical difference comparison adopts two-factor analysis of variance, and the comparison between each two groups adopts LSD test, and the test level is as follows: p <0.05 indicates that the difference is statistically significant. Correlation analysis uses pearson correlation coefficients, correlation strength: the pearson correlation coefficient is between 1 and-1, and the larger the absolute value of the coefficient is, the larger the correlation degree is represented. R is close to 1, indicating that there is a complete association of the two; r is close to 0, indicating that there is no linear correlation (and possibly a nonlinear correlation) between the two.

2 Results

2.1 ELISA detection results of MAPK8, STAT3, IL-10, IL-17, IL-6, TNF-alpha in mouse serum

The Elisa detection result shows that, compared with a blank group, the STAT3, IL-17 and IL-6 of the model group are obviously increased, the IL-10 and TNF-alpha are obviously decreased, and the differences have statistical significance (P < 0.05). Compared with the model group, the compound high-dose groups MAPK8, STAT3, IL-10, IL-6 and TNF-alpha are all remarkably reduced and the differences are all statistically significant (P < 0.05). See table 2, fig. 6.

TABLE 2 comparison of serum MAPK8, STAT3, IL-10, IL-17, IL-6, TNF- α levels in groups of micen＝6)

Note that: * A difference p <0.05 from the blank; * Significant difference p <0.01 from the blank group; # differs from model group by p <0.05; significant differences p <0.01 from model group, #; differences p <0.05 between the delta low and high dose groups; there was a significant difference p <0.01 between the ΔΔ low and high dose groups.

2.2 ELISA detection results of AhR, HIF-1. Alpha., VEGFA in mouse retina tissue homogenate

The Elisa detection result shows that compared with a blank group, the HIF-1 alpha and VEGFA of the model group are obviously increased, the AhR is decreased, and the difference has statistical significance (P < 0.05). Compared with the model group, the HIF-1 alpha and the VEGFA of the compound low-dose group are obviously increased, the AhR is reduced, and the HIF-1 alpha of the compound high-dose group is reduced and the difference has statistical significance (P < 0.05), as shown in table 3 and fig. 7. The three Elisa detection results are used as pearson correlation coefficients, ahR and HIF-1α (r= -0.53), ahR and VEGFA (r= -0.99, |r| is close to 1) are in negative correlation, and HIF-1α and VEGFA are in positive correlation (r=0.48), as shown in FIG. 8.

TABLE 3 comparison of AhR, HIF-1. Alpha. And VEGFA levels in the retinal tissue homogenates of mice of each groupn＝6)

Note that: * A difference p <0.05 from the blank; * Significant difference p <0.01 from the blank group; # differs from model group by p <0.05; significant differences p <0.01 from model group, #; differences p <0.05 between the delta low and high dose groups; there was a significant difference p <0.01 between the ΔΔ low and high dose groups.

2.3 Analysis of results of flow cytometry detection of spleen tissue of mice

In the prior art, we found that the compound high dose group has more obvious effect of regulating EAU inflammation, and in order to further investigate the immune regulation mechanism of the compound in EAU, we collected a mouse spleen sample at the peak of EAU inflammation (14 Th day of the disease course) for flow cell detection of Th17 and Treg. The proportion of the subgroup CD4+CD25+Foxp3+T cells (Treg) in the blank group was significantly increased (P < 0.05) compared with the model group, and the proportion of the subgroup CD4+CD25+Foxp3+T cells (Treg) in the compound group was significantly increased (P < 0.05). The proportion of IL-CD4+IL-17A+T cell (Th 17) sub-population was significantly increased in the model group compared to the blank group. Compared with the model group, the proportion of IL-CD4+IL-17A+T cells (Th 17) sub-population of the compound group is obviously reduced, and the difference has statistical significance (P < 0.05). And (3) separating out the proportion of the Th17 and the Treg cell subsets on the CD4 positive cells, wherein the proportion of the Treg subset of the model group is reduced and the proportion of the Th17 subset is increased compared with that of the blank group. The compound group can effectively twist the unbalanced state of Th17/Treg, compared with the model group, the proportion of the Treg subgroup of the compound group is increased, the proportion of the Th17 subgroup is decreased, but the difference has no statistical significance (P is more than 0.05) (see figure 9, figure 10 and table 4).

TABLE 4 flow cytometric cell subpopulation analysis of micen＝3)

Note that: * Significant difference p <0.05 from the blank group; # was significantly different from model group by p <0.05.

3. Knot (S)

In animal experiments, the invention adopts mouse serum, retina and spleen, and targets and immune cells (screened according to network pharmacological analysis results) of inflammatory and hypoxia related paths are detected by ELISA and flow cytometry methods respectively. According to the ELISA results of the serum of mice, compared with a blank group, the STAT3, IL-17 and IL-6 of the model group are obviously increased, the IL-10 and TNF-alpha are obviously reduced, and the differences are statistically significant (p < 0.05).

Th17 cells are a novel population of pro-inflammatory cells, IL-17 is a marker cytokine for Th17, an important cytokine in the pathogenesis of uveitis disease. High levels of IL-6 have been found to be an independent risk factor for retinal damage. One of the main downstream signal transduction pathways of the IL-6 family is the JAK-STAT signal pathway, and by reducing the concentration of IL-6, abnormal phosphorylation of JAK2/STAT3 is blocked, so that the phosphorylation is reduced or approaches to a normal level, and the aim of reducing inflammation can be fulfilled. The current experimental results prove that when the secretion of IL-6 is increased, the activation of STAT3 is stimulated, and the damage to retina tissues is aggravated. Therefore, IL-17 and IL-6/STAT3 can be considered as important inflammatory factors of retinal injury caused by uveitis, are marks for successful modeling of an EAU model, and are also target targets for inhibiting retinal inflammation.

Compared with the model group, the MAPK8, STAT3, IL-10, IL-6 and TNF-alpha of the compound high-dose group are all remarkably reduced, and the differences are all statistically significant (p < 0.05). MAPK regulates a wide range of cellular processes, has the effects of promoting cell proliferation and resisting apoptosis, and is one of important MAPK protein families, namely MAPK8 and JNK1.MAPK8 may be involved in retinal inflammatory regulation by up-regulating IL-6, and TNF- α as a cytokine secreted by Th1 cells may suggest the extent of the inflammatory response. The compound high-dose group has obvious protection effect on inflammatory injury caused by EAU mice. However, IL-10 is considered as an important anti-inflammatory cytokine, and is a main effector cytokine for regulating T cells to play a role in maintaining autoimmune tolerance and negatively regulating immune response, and the change of IL-10 in the compound high-dose group result does not show obvious anti-inflammatory effect, but rather IL-10 and IL-17 in the compound low-dose group show an increasing trend (p < 0.05). Meanwhile, compared with the model group, the high-dose group IL-17 expression has no obvious statistical difference, and the reference mouse spleen tissue flow cytometry detection result shows that compared with the model group, the proportion of the Th17 cell subset is reduced (p < 0.05), the proportion of the Treg subset is increased (p < 0.05), but the difference of the effect of the compound group in effectively twisting the Th17/Treg imbalance state has no statistical significance. In conclusion, the high-dose compound group has obvious downregulation effect on STAT and MAPK channels, inhibits secretion of IL-6 and TNF-alpha to a certain extent, reduces inflammatory response, can regulate differentiation of Th17 and Treg immune cells, has a certain limitation on the regulating capability of Th17/Treg balance, and can be further explored from the angles of administration of compound dose and treatment course time or combined administration of traditional Chinese medicine and Western medicine of EAU42 mice.

According to the traditional Chinese medicine basis for tonifying qi and activating blood, the study needs to pay attention to the effect of the compound in improving ischemia and hypoxia. In clinical observations, it was found that when EAU enters the peak inflammatory stage, the retina has obvious ischemia and hypoxia, and combined with mouse retina homogenate ELISA results, both HIF-1α and VEGFA in the model group were significantly elevated (p < 0.05). Compared with the model group, the HIF-1 alpha and the VEGFA of the compound low-dose group are obviously increased, the AhR is reduced, and the HIF-1 alpha of the compound high-dose group is reduced and the difference has statistical significance (p < 0.05). The mechanism by which HIF-1 a induces high expression of VEGF is considered to be the main regulatory mechanism in hypoxic retinopathy. VEGF-A is an important member of the VEGF family, which induces differentiation and maturation of vascular endothelial cells, promoting neovascularization and increased vascular permeability. Experiments have shown that inhibiting HIF-1 alpha expression, and thus VEGF expression, inhibits retinal pigment epithelium neovascularization. HIF inhibitor topotecan may have therapeutic potential for optic nerve cell degeneration caused by retinal ischemia or ocular hypertension. After binding to Toll-like receptors, VEGFA activates MAPK1/8, JNK, etc., thereby affecting MAPK signaling pathway. MAPK activated macrophages respond to endotoxin stimulation by decreasing the levels of lytic HIF enzymes and increasing p38-MAPK activity, both of which result in increased stability of HIF-1α and NO production. IL-1 beta, IL-6, IL-8 and TNF-alpha levels in macrophages of patients with active uveitis VKH are increased, the phosphorylation levels of p38 and ERK1/2 are obviously higher than those of control groups, and the inhibition of p38 or ERK1/2 can obviously reduce the expression of IL-1 beta, IL-6, IL-8 and TNF-alpha. Therefore, HIF-1 a is a key transcription factor activated during hypoxia and inflammation, and plays a key role in the regulation of immune and inflammatory responses, affecting inflammatory factor gene expression, phenotype and functional status. Blocking HIF-1 a expression may be a break through that alleviates recurrent episodes of uveitis. The competition between AhR and HIF-1α for dimerization of AhR nuclear translocation proteins (ARNTs) is that ARNTs, also known as HIF-1β, are shared dimerization partners for AHR and other molecular pathways, such as the HIF-1 pathway. Down-regulating the ubiquitination level of AhR, and thus the activation level of AhR downstream pathway, and the expression of HIF-1 alpha, to achieve the effect of inhibiting inflammation [65]. Compared with a blank group, the AhR expression of the invention is obviously reduced (p is less than 0.05) in each group, and compared with a model group, the AhR expression of a high-low compound group has no obvious activation trend, but the AhR expression of a high-dose group is slightly higher than that of a low-dose group. By combining with analysis of pearson correlation coefficients of AhR, HIF-1 alpha and VEGFA results, the expression of AhR and the expression of HIF-1 alpha are found to be in negative correlation, and the expression of HIF-1 alpha and the expression of VEGFA are found to be in positive correlation. The results demonstrate that inflammation can cause retinal ischemia, hypoxia, and that HIF-1 a expression is significantly increased, with a competing relationship with AhR resulting in decreased AhR expression. As described above, in this experiment, both Th17 and Treg were statistically changed, but the Th17/Treg ratio tended to recover, but there was no statistical difference. If hypoxia is not corrected in EAU treatment or AhR activation is insufficient, treg cell proliferation is limited, the effect of inhibiting inflammation and maintaining immune balance is limited, and AhR activation can competitively inhibit HIF-1 alpha expression and prevent retinal related angiogenesis and exudation.

3. Effects of drug-containing serum on CoCl ₂ -induced HRMEC cell hypoxia model

According to the invention, a chemical hypoxia model is established by treating HRMEC cells through cobalt chloride (CoCl ₂), and the change of the drug-containing serum on the relative mRMA and the protein expression quantity of HRMEC intracellular pathways treated by CoCl ₂ is detected by adopting a WesternBlot and real-time fluorescence quantitative PCR method.

1 Material

1.1 Experimental cells

HRMEC cells were purchased from Shanghai, bio-technology Inc. (CellSystems).

1.2 Medium and reagent preparation

1.2.1ECGM complete medium

ECGM basic culture medium 500ml, adding matched 25mlFBS in the suit, cell growth factor ECGS 5ml, antibiotic G/A mixed solution 5ml, mixing well, and standing at 4deg.C for use.

1.2.2 Low serum Medium

500Ml of serum-free basal medium is added into 8ml of Rocker Fuel solution matched with the kit, and the mixture is subpackaged into 50ml centrifuge tubes, and 1ml of fetal bovine serum is added before each use, so that a low serum medium with the concentration of 2% FBS is prepared.

1.2.3 Preparation of cobalt chloride mother liquor

Cobalt chloride is weighed and dissolved in a serum-free culture medium to prepare mother solution with the concentration of 0.5M, and the mother solution is preserved at the temperature of 4 ℃ after filtering and sterilizing by a pinhole filter with the concentration of 0.22 mu M. When in use, the low serum culture medium is used for preparing the required concentration, and the preparation is ready for use.

1.2.4 Preparation and preservation of laboratory animal serum

Preparation of medicated serum: SPF-grade adult male Wister rats (6-8 weeks old, weighing about 200 g) were selected for 10. Rats were kept in an SPF environment at 20-25℃for twelve hours alternating between day and night without restriction of diet and sleep. The Wister male rats were subjected to intragastric administration in the form of 13 g/kg.d of the compound granules (calculated according to 6.3 times the clinical adult dose with reference to the fourth edition of the pharmaceutical experimental methodology), once daily at 9 am and 4 pm. After 5 times of continuous gastric lavage, 2 hours after the last administration, 5% pentobarbital sodium is injected into abdominal cavity for anesthesia, the preparation is carried out according to a standard method, 3000r/min is carried out after abdominal aorta blood sampling for 10min, serum is separated, after inactivation treatment at 56 ℃ for 30min, filtration sterilization is carried out by a 0.22um microporous filter membrane, and the obtained product is preserved in a refrigerator at-80 ℃ for standby within 1 month for use.

1.2.5KC7F2 preparation of solution

DMSO was dissolved in 100mM stock solution and diluted to 20. Mu.M using ECGM complete medium.

2 Method

2.1 Experimental grouping

A) Normal culture group: HRMEC cell group: ECGM the complete medium is normally cultivated, and ECGM the complete medium is replaced simultaneously when other groups are treated differently;

b) Hypoxia model group: HRMEC +cocl ₂ group: after ECGM complete medium is used for normal culture and adherence, the low serum medium is used for diluting the CoCl ₂ mother solution until the cells are treated for 24 hours by using 200 mu M concentration, the CoCl ₂ solution is removed, and the culture is continued for 24 hours by changing to ECGM complete medium;

c) Drug-containing serum intervention group 1: HRMEC +cocl ₂ +15% drug-containing serogroup; after ECGM complete medium is used for normal culture and adherence, the low serum medium is used for diluting the CoCl ₂ mother solution to the concentration of 200 mu M for treating cells for 24 hours, the CoCl ₂ solution is removed, and the final concentration of 15% drug-containing serum prepared by ECGM complete medium is replaced for continuous culture for 24 hours;

d) Normal serum intervention group 1: after HRMEC +CoCl ₂ +15% normal serogroup and ECGM complete culture medium is used for culturing and attaching, the low serum culture medium dilutes the CoCl ₂ mother liquor until the cells are treated for 24 hours by using 200 mu M concentration, the CoCl ₂ solution is removed, and the final concentration prepared by replacing ECGM complete culture medium is 15% normal serum for continuous culture for 24 hours;

e) Drug-containing serum intervention 2 groups: HRMEC +cocl ₂ +10% drug-containing serogroup; after ECGM complete medium is used for normal culture and adherence, the low serum medium is used for diluting the CoCl ₂ mother solution to the concentration of 200 mu M for treating cells for 24 hours, the CoCl ₂ solution is removed, and the final concentration of 10% drug-containing serum prepared by ECGM complete medium is replaced for continuous culture for 24 hours;

f) Normal serum intervention group 2: after HRMEC +CoCl ₂ +10% normal serogroup and ECGM complete culture medium is used for culturing and attaching, the low serum culture medium dilutes the CoCl ₂ mother liquor until the cells are treated for 24 hours by using 200 mu M concentration, the CoCl ₂ solution is removed, and the final concentration prepared by replacing ECGM complete culture medium is 10% normal serum for continuous culture for 24 hours;

g) Inhibitor control group: after HRMEC +CoCl ₂ +KC7F2 (20. Mu.M) was attached to the whole medium by normal culture, ECGM, the low serum medium was used to dilute the CoCl ₂ stock solution to a concentration of 200. Mu.M, and at the same time KC7F2 (20. Mu.M final concentration) was added to treat cells for 24h, the CoCl ₂ solution was removed, and KC7F2 (20. Mu.M final concentration) was prepared by replacing ECGM whole medium.

2.3Real-timeqPCR

Detection of CoCl ₂ treatment HRMEC by Real-timeqPCR method to build chemical hypoxia model and perform different procedures

Expression changes of pathway-associated mRNA (HIF-1. Alpha., VEGF, AHR, MAPK, MAP2K1, STAT3, NF-kb, TLR4, IL-6) in the samples of each experimental group after treatment.

2.3.1HRMEC extraction and separation of RNA from samples prepared from each experimental group

Cells in the logarithmic growth phase HRMEC were collected by digestion, the cell suspension concentration was adjusted to 1X 10 ⁵/ml, 2 ml/well was inoculated into 6-well cell culture plates, 1 well/group was placed in a carbon dioxide incubator at 37℃and incubated overnight (about 18 h) with 5% CO ₂, 100. Mu.l of CoCl ₂ solution (200. Mu.M) prepared with low serum medium after cell attachment was replaced, 37℃and 5% CO ₂ was used for incubation for 24h, the medium was discarded, samples for subsequent treatments were prepared with ECGM complete medium according to the groupings, each group was given different intervention treatments, 37℃and 5% CO ₂ was used for incubation for 24h, and samples were collected.

2.3.2RNA extraction

Directly adding 1mLBufferRZ into culture plate, shaking, mixing, standing at 15-30deg.C for 5min, centrifuging at 12000rpm for 5min, collecting supernatant, adding into new RNase-free centrifuge tube, adding 200 μl chloroform, shaking vigorously for 15S, and standing at room temperature for 3min; centrifuging at 12000rpm for 10min at 4deg.C, separating the sample into three layers, transferring the RNA into a new RNase-free tube mainly in colorless water phase, slowly adding 0.5 times volume of absolute ethanol, mixing, transferring into an adsorption column CR3, and centrifuging at 12000rpm for 30s at 4deg.C; adding 500. Mu.L deproteinized solution RD to an adsorption column CR3, centrifuging at 12,000rpm (13,400 Xg) at 4 ℃ for 30sec, and discarding the waste liquid; placing CR3 into a collecting pipe, adding 500 mu LBufferRW, standing at room temperature for 2min, centrifuging at 12000rpm for 30s at 4 ℃, discarding the waste liquid, and repeating for one time; placing the adsorption column into a 2mL collecting tube, centrifuging at 12000rpm (13,400Xg) for 2min at 4 ℃ to remove residual liquid; uncapping at room temperature, flatly placing on paper, and drying for 5min; transferring the CR3 column into a new RNase-fre1.5 mL centrifuge tube, adding 50 μ LRNase-FreeH O, standing at room temperature for 2min, and centrifuging at 12000rpm for 2min at 4deg.C; the volume of the elution buffer should not be less than 30 mu L, and too small a volume affects recovery efficiency. Taking 2.5 mu L to quantitatively measure the concentration by an enzyme-labeled instrument, carrying out the next experiment on the OD260/OD280 which is 1.6-1.8, subpackaging RNA into multiple tubes, and storing in a low-temperature refrigerator at-80 ℃. 1% agarose gel was prepared, 2 mu LRNA samples (concentration: 80-100 ng/uL) were taken in PCR tubes, 3 mu LRNALoadingBuffer were added, mixed well by shaking, and immediately spotted by instantaneous centrifugation (RNAMARKER: 5 uL), 140V,20min.

2.3.3 Primer design and Synthesis

Inquiring the gene sequence (index) of the index to be detected and the gene sequence of the internal reference gene beta-actin by using software PRIMERPREMIER, designing a real-time fluorescent quantitative PCR experiment primer, and sending the primer to a general company for primer synthesis after the design is finished. The primer sequences are shown in SEQ ID NOs 1 to 18 in sequence.

HIF-1α-F：TGCAACATGGAAGGTATTGCAC；

HIF-1α-R：GCACCAAGCAGGTCATAGGT；

VEGF-F：AGGGCAGAATCATCACGAAGT；

VEGF-R：AGGGTCTCGATTGGATGGCA；

STAT3-F：AGGTCCCTCATCCTGTTTGTTT；

STAT3-R：GTGCTAGGTGTTCCCATACGC；

AHR-F：GCCGGTGCAGAAAACAGTAAAG；

AHR-R：AGCCAAACGGTCCAACTCTG；

MAPK8-F：GGGCTACAAGGAAAACGTTGA；

MAPK8-R：CCTGGGAACAAAACACCACC；

MAP2K1-F：ACATGGATGGAGGTTCTCTGGA；

MAP2K1-R：CTGGAGTCTTTCTGGCGACAT；

TLR4-F：AAGCAGTGAGGATGATGCCA；

TLR4-R：TGGATTTCACACCTCCACGC；

IL-6-F：TCTCCACAAACATGTAACAAGAGT；

IL-6-R：CACAGCTCTGGCTTGTTCCT；

NF-κb-F：AAGGACATGGTGGTCGGCTT；

NF-κb-R：AATAGGCAAGGTCAGGGTGC；

The internal reference primer and the sequence are as follows (shown in SEQ ID NO: 19-20 in sequence):

hsa-β-actin-FP:TTCCTTCCTGGGCATGGAGTC；

hsa-β-actin-RP:TCTTCATTGTGCTGGGTGCC。

2.3.4RNA reverse transcription into cDNA (Synthesis of first strand of cDNA)

MRNA was prepared on ice as follows and operated according to the corresponding reaction conditions:

(1) 800ng Total RNA and 1 mul primer are mixed and added into a nucleic-free-PCR tube, NF-H ₂ O is supplemented to 12 mul, after the mixture is fully mixed, centrifugation is carried out, so that the mixed solution is deposited at the bottom of the PCR tube;

(2) The PCR tube was placed in a 65℃metal bath for 5 minutes and immediately on ice;

(3) A new nucleic-free-PCR tube was used to prepare a reaction mixture according to the following formulation ：5×Reaction Buffer4μL;RiboLock RNase inhibitor 1μL;dNTP mix(10mM)2μL;RevertAid M-MuLV RT(200U/μL)1μL;

(4) Adding the reaction mixture prepared in step 3 to the tube in step 2;

(5) The PCR instrument was set at 25℃for 5min,42℃for 60min, and 70℃for 5min.

2.3.5Real-time qPCR detection

(1) Preparing a primer:

The primer dry powder was centrifuged at 4000rpm for 5min at 4℃before being dissolved. After centrifugation, the dry powder of the upstream and downstream primers is diluted to 100 mu M mother liquor according to the instruction of the kit, the mother liquor of the primers can be packaged into multiple tubes for preservation, and the dissolved primers are preserved at-20 ℃. Before PCR reaction, 5. Mu.l of each upstream primer and each downstream primer are taken, the primer mother solution is diluted to 10. Mu.M in 90. Mu.l of DEPC water, and the mixture is uniformly mixed by vortex and centrifuged for short time for standby. The following reaction system 10 μl was prepared on ice: 2X SuperReal PreMix Plus. Mu.L, primer mix (10. Mu.M) 0.3. Mu.L, cDNA 0.5. Mu.L, H ₂O₄.2. Mu.L.

(2) Setting a Real-time qPCR amplification reaction program: heat denaturation deactivation is carried out for 15min at 95 ℃; amplifying the primer at 95 ℃ for 10s,60 ℃ for 30s (SYBGreen fluorescent detection) and extending the primer at 72 ℃ for 30s and 45 cycles;4 ℃, ++ infinity a. The invention relates to a method for producing a fibre-reinforced plastic composite.

(3) The relative expression level of the gene to be tested is calculated by a double delta Ct value method.

2.4Western Blot detection

The Western Blot method is adopted to detect the expression change of the pathway-related proteins (HIF-1 alpha, VEGFA, P38MAPK and P-STAT 3) in the samples of each experimental group after the CoCl ₂ treatment HRMEC is used for establishing a chemical hypoxia model and different treatments.

2.4.1HRMEC sample preparation for each test group

Cells in the logarithmic growth phase HRMEC were collected by digestion, the cell suspension concentration was adjusted to 1X 105/ml,2 ml/well was inoculated into 6-well cell culture plates, 2 wells/group were placed in a carbon dioxide incubator at 37℃and incubated overnight (about 18 h) with 5% CO2, after cell attachment, 100. Mu.l of CoCl ₂ solution (200. Mu.M) prepared with low serum medium was replaced, after 24h incubation with 5% CO ₂, the medium was discarded, samples for subsequent treatments were prepared with ECGM complete medium according to the group, each group was given different intervention treatments, and samples were collected after 24h incubation with 5% CO ₂ at 37 ℃.

3 Results

3.1RT-qPCR detection of mRNA changes of the pathway-related factors HIF-1. Alpha., VEGF, AHR, MAPK, MAP2K1, STAT3, NF-kb, TLR4, IL-6 in different experimental groups of CoCl ₂ treatment HRMEC

Compared with a blank group, the qPCR detection result shows that the expression quantity of each index is obviously increased under the environment of CoCl ₂ modeling hypoxia, and has statistical significance (p is less than 0.05). Compared with the model group, the expression level of each index is obviously reduced under the action of 15% of drug-containing serogroup except AhR, and the method has statistical significance (p is less than 0.05). Except AhR, compared with 15% of drug-containing serogroup, the normal serogroup has obvious effect of increasing the expression of indexes and has statistical significance (p is less than 0.05). Except STAT3, the effect of 10% drug-containing serogroup on the index was weaker than that of 15% drug-containing serogroup, with statistical significance (p < 0.05). See fig. 11.

3.2WB detection of changes in pathway-related proteins HIF-1α, VEGFA, p38-MAPK, p-STAT3 in different experimental groups treated with CoCl ₂ to HRMEC

Compared with the normal group, the expression of HIF-1 alpha, VEGFA, p38-MAPK and p-STAT3 proteins in the model group, the drug-containing serum group, the normal serum control group and the inhibitor group are up-regulated, and the expression of each protein in the model group and the normal control group is more obvious (p is less than 0.05); compared with the model group, the HIF-1 alpha, VEGFA, p38-MAPK and p-STAT3 protein expression in the drug-containing serogroup and the inhibitor group are reduced, so that the method has statistical significance (p is less than 0.05); compared with the serum group containing medicine, the expression of each protein in the normal serum control group is obviously up-regulated, and the HIF-1 alpha, the p38-MAPK and the p-STAT3 expression have no statistical significance with the difference of the model group. The inhibitor groups showed a more reduced expression of HIF-1α, p38-MAPK, and p-STAT3 (p < 0.05) compared to the drug-containing serogroup, and no statistical difference was observed in the VEGFA expression groups (see FIG. 12 and Table 5).

TABLE 5 relative expression values of pathway-related proteins HIF-1 alpha, VEGFA, p38-MAPK, p-STAT3 in different experimental groups (a, b, c, d, g five groups) of CoCl ₂ treatment HRMECn＝3)

# Represents statistically significant, p <0.05 compared to the model group; * Indicating statistical significance compared to the inhibitor group, p <0.05.

4 Knots

By comparing the literature reference with the RTqPCR result, STAT3mRNA is removed, and compared with 15% drug-containing serogroup, the reduction effect of 10% drug-containing serogroup on indexes is weakened, so that the method has statistical significance (p < 0.05). We selected the trend of CoCl ₂ +15% drug-containing serum treatment group as a statistical comparison. The qPCR detection result shows that compared with a blank group, the expression quantity of each index is obviously increased (p < 0.05) under the environment of CoCl ₂ modeling hypoxia. It shows that under the anoxic state, the MAPK signal pathway, STAT signal pathway, NF-kb signal pathway, VEGF signal pathway, HIF signal pathway and the like are activated to different degrees, and the anoxic state can induce inflammatory environment, and the two signals can not be separated. Compared with the model group, the expression level of each index is obviously reduced (p is less than 0.05) under the action of 15% drug-containing serogroup, and although the hypoxia is the cut-in point modeling, the inflammation pathway effect target has consistency with the inflammation target of the compound action uveitis predicted before. On the basis, the expression of pathway related proteins HIF-1 alpha, VEGFA, p38-MAPK and p-STAT3 in animal experiments is detected mainly through a WB experiment. The research shows that the compound medicine-containing serum has obvious downregulation effect on hypoxia-related protein HIF-1 alpha and VEGFA of HRMEC treated by CoCl ₂, has obvious inhibition effect on inflammation-related proteins p38-MAPK and p-STAT3, and has no statistical difference with the downregulation effect on VEGFA of an inhibitor KC7F2 group (HIF-1 alpha protein translation inhibitor). The normal serogroup, HIF-1 alpha, p38-MAPK and p-STAT3 expression are indistinguishable from the model group, which shows that the medicinal components of the medicated serum play a key role in improving HRMEC hypoxia and controlling inflammation by CoCl ₂ treatment. However, the study did not carry out mass spectrometry analysis on the serum containing the drug, so that the specific components of the serum containing the drug are not displayed.

Claims (8)

1. The application of a traditional Chinese medicine formula in preparing a medicament for treating uveitis is characterized in that the traditional Chinese medicine formula comprises the following components: astragalus root, sinomenine, angelica, tuckahoe, red paeony root, szechuan lovage rhizome, divaricate saposhnikovia root and bupleurum.

2. The application of claim 1, wherein the traditional Chinese medicine composition comprises the following components in parts by weight: 30-50 parts of astragalus membranaceus, 10-15 parts of caulis sinomenii, 15-20 parts of radix rehmanniae, 10-15 parts of radix angelicae sinensis, 15-20 parts of poria cocos, 10-15 parts of radix paeoniae rubra, 10-15 parts of ligusticum wallichii, 10-15 parts of radix sileris and 10-15 parts of radix bupleuri.

3. The application of claim 2, wherein the traditional Chinese medicine composition comprises the following components in parts by weight: 30 parts of astragalus, 12 parts of caulis sinomenii, 15 parts of radix rehmanniae, 12 parts of Chinese angelica, 15 parts of poria cocos, 10 parts of red paeony root, 10 parts of szechuan lovage rhizome, 10 parts of divaricate saposhnikovia root and 10 parts of Chinese thorowax root.

4. The use according to any one of claims 1-3, wherein the uveitis is autoimmune uveitis.

5. The use according to claim 4, wherein the uveitis is autoimmune uveitis induced by a combination of IRBP and TB.

6. The use according to claim 4, wherein the uveitis drug is an oral drug.

7. The use according to claim 6, wherein the uveitis drug is in the form of a solution or powder.

8. The use according to claim 6, wherein the uveitis drug is prepared by a water decoction method.