CN118186113A - Method for detecting ST11 type high-toxicity carbapenem drug-resistant klebsiella pneumoniae - Google Patents
Method for detecting ST11 type high-toxicity carbapenem drug-resistant klebsiella pneumoniae Download PDFInfo
- Publication number
- CN118186113A CN118186113A CN202410491364.8A CN202410491364A CN118186113A CN 118186113 A CN118186113 A CN 118186113A CN 202410491364 A CN202410491364 A CN 202410491364A CN 118186113 A CN118186113 A CN 118186113A
- Authority
- CN
- China
- Prior art keywords
- rmpa
- iuca
- virulence
- rmpa2
- klebsiella pneumoniae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000588747 Klebsiella pneumoniae Species 0.000 title claims abstract description 39
- YZBQHRLRFGPBSL-RXMQYKEDSA-N carbapenem Chemical compound C1C=CN2C(=O)C[C@H]21 YZBQHRLRFGPBSL-RXMQYKEDSA-N 0.000 title claims abstract description 35
- 238000000034 method Methods 0.000 title claims abstract description 32
- 239000003814 drug Substances 0.000 title claims abstract description 25
- 229940079593 drug Drugs 0.000 title claims abstract description 25
- 231100000086 high toxicity Toxicity 0.000 title abstract description 11
- 230000001018 virulence Effects 0.000 claims abstract description 54
- 101150110106 rmpA gene Proteins 0.000 claims abstract description 49
- 101150117619 iucA gene Proteins 0.000 claims abstract description 46
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 35
- 238000006243 chemical reaction Methods 0.000 claims abstract description 27
- 238000001514 detection method Methods 0.000 claims description 29
- 238000007403 mPCR Methods 0.000 claims description 19
- 239000000523 sample Substances 0.000 claims description 12
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 4
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 4
- 239000000872 buffer Substances 0.000 claims description 4
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 3
- 238000007400 DNA extraction Methods 0.000 claims description 2
- 238000004458 analytical method Methods 0.000 claims description 2
- 238000013461 design Methods 0.000 abstract description 9
- 208000015181 infectious disease Diseases 0.000 abstract description 6
- 238000012216 screening Methods 0.000 abstract description 5
- 230000007480 spreading Effects 0.000 abstract description 2
- 238000003892 spreading Methods 0.000 abstract description 2
- 230000006806 disease prevention Effects 0.000 abstract 1
- 238000005516 engineering process Methods 0.000 description 13
- 108020004414 DNA Proteins 0.000 description 8
- 238000012408 PCR amplification Methods 0.000 description 8
- 230000035945 sensitivity Effects 0.000 description 7
- 230000003321 amplification Effects 0.000 description 6
- 230000008901 benefit Effects 0.000 description 6
- 238000003745 diagnosis Methods 0.000 description 6
- 238000002474 experimental method Methods 0.000 description 6
- 238000003199 nucleic acid amplification method Methods 0.000 description 6
- 239000000047 product Substances 0.000 description 6
- 238000011160 research Methods 0.000 description 5
- XEEYBQQBJWHFJM-UHFFFAOYSA-N Iron Chemical compound [Fe] XEEYBQQBJWHFJM-UHFFFAOYSA-N 0.000 description 4
- 230000007923 virulence factor Effects 0.000 description 4
- 239000000304 virulence factor Substances 0.000 description 4
- 206010059866 Drug resistance Diseases 0.000 description 3
- 241000282414 Homo sapiens Species 0.000 description 3
- 241001465754 Metazoa Species 0.000 description 3
- 238000000137 annealing Methods 0.000 description 3
- 238000007405 data analysis Methods 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 238000001962 electrophoresis Methods 0.000 description 3
- -1 rmpA2 Proteins 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 238000005491 wire drawing Methods 0.000 description 3
- 108020000946 Bacterial DNA Proteins 0.000 description 2
- 108010014387 aerolysin Proteins 0.000 description 2
- 230000001580 bacterial effect Effects 0.000 description 2
- 238000009835 boiling Methods 0.000 description 2
- 239000002775 capsule Substances 0.000 description 2
- 238000003759 clinical diagnosis Methods 0.000 description 2
- 238000010276 construction Methods 0.000 description 2
- 239000012154 double-distilled water Substances 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 239000000499 gel Substances 0.000 description 2
- 229910052742 iron Inorganic materials 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 238000012257 pre-denaturation Methods 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000012545 processing Methods 0.000 description 2
- 239000000243 solution Substances 0.000 description 2
- 229910021642 ultra pure water Inorganic materials 0.000 description 2
- 239000012498 ultrapure water Substances 0.000 description 2
- 241000894006 Bacteria Species 0.000 description 1
- 101100026178 Caenorhabditis elegans egl-3 gene Proteins 0.000 description 1
- 208000035473 Communicable disease Diseases 0.000 description 1
- 206010011409 Cross infection Diseases 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 206010029803 Nosocomial infection Diseases 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- 239000000589 Siderophore Substances 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 229940124350 antibacterial drug Drugs 0.000 description 1
- 238000013473 artificial intelligence Methods 0.000 description 1
- 244000052616 bacterial pathogen Species 0.000 description 1
- 238000003766 bioinformatics method Methods 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 108010068385 carbapenemase Proteins 0.000 description 1
- 229940041011 carbapenems Drugs 0.000 description 1
- 239000000084 colloidal system Substances 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000011841 epidemiological investigation Methods 0.000 description 1
- 230000006870 function Effects 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 108091008053 gene clusters Proteins 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 230000007614 genetic variation Effects 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 101150043148 iutA gene Proteins 0.000 description 1
- 238000010801 machine learning Methods 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 230000002906 microbiologic effect Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000001823 molecular biology technique Methods 0.000 description 1
- 210000003097 mucus Anatomy 0.000 description 1
- 230000036457 multidrug resistance Effects 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 230000007918 pathogenicity Effects 0.000 description 1
- 239000013610 patient sample Substances 0.000 description 1
- 238000010837 poor prognosis Methods 0.000 description 1
- 230000008092 positive effect Effects 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 239000013615 primer Substances 0.000 description 1
- 239000002987 primer (paints) Substances 0.000 description 1
- 238000004393 prognosis Methods 0.000 description 1
- 230000005180 public health Effects 0.000 description 1
- 239000011535 reaction buffer Substances 0.000 description 1
- 210000002345 respiratory system Anatomy 0.000 description 1
- 101150031313 rmp gene Proteins 0.000 description 1
- 210000004872 soft tissue Anatomy 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 210000003708 urethra Anatomy 0.000 description 1
- 238000012070 whole genome sequencing analysis Methods 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of genes, and discloses a method for detecting ST11 high-virulence carbapenem drug-resistant klebsiella pneumoniae, which comprises the following steps: aiming at virulence genes rmpA, rmpA2 and iucA in main carbapenem-resistant Klebsiella pneumoniae (CRKP) ST11 type as molecular markers; downloading virulence genes rmpA, rmpA2 and iucA in CR-hvKp from NCBI database; designing primers based on the genes, and constructing a specific reaction system; and (3) detecting ST11 carbapenem drug-resistant klebsiella pneumoniae (CRKP) carrying virulence genes rmpA, rmpA2 and iucA by using the constructed reaction system. The invention designs a specific primer so as to distinguish high-toxicity carbapenem drug-resistant klebsiella pneumoniae (CR-hvKp) carrying rmpA/rmpA and iucA virulence genes from traditional carbapenem drug-resistant klebsiella pneumoniae, establishes a quick screening method of ST11 type CR-hvKp, and provides a convenient and effective thought for infection disease prevention and control and regional spreading tracking.
Description
Technical Field
The invention belongs to the technical field of genes, and particularly relates to a detection method of ST11 high-virulence carbapenem drug-resistant klebsiella pneumoniae.
Background
Carbapenem-resistant klebsiella pneumoniae (CRKP) is a multiple pathogenic bacterium and can cause infection in urethra, respiratory tract, blood, human skin and soft tissue. The ST11 clone producing carbapenemase KPC-2 is the main clone of China CRKP, which can spread rapidly and cause high mortality and morbidity. CRKP can be converted into high-toxicity carbapenem drug-resistant klebsiella pneumoniae (CR-hvKp) by carrying a virulence factor coding gene, so that invasive transfer is often caused at multiple positions or occurs, no relatively effective treatment means exists at present, and a great threat is formed to public health of human beings. The genes rmpA, rmpA2, and the gene iucA for aerolysin synthase are often used as genetic markers for virulent strains.
In the prior art, screening of ST11 type CR-hvKp is mainly carried out in a whole genome sequencing and sequence analysis mode, and the screening is carried out by adopting the method, so that the method is high in price, long in period and not convenient enough, and the analysis can be carried out only by providing a bioinformatics analysis basis.
Disclosure of Invention
Aiming at the problems existing in the prior art, the invention provides a method for detecting ST11 type high-toxicity carbapenem drug-resistant Klebsiella pneumoniae.
The invention is realized in such a way that the method for detecting the ST11 type high-toxicity carbapenem drug-resistant klebsiella pneumoniae comprises the following steps:
S1: aiming at virulence genes rmpA, rmpA2 and iucA in main carbapenem-resistant Klebsiella pneumoniae (CRKP) ST11 type as molecular markers;
S2: downloading virulence genes rmpA, rmpA2 and iucA in CR-hvKp from NCBI database;
s3: designing primers based on the genes, and constructing a specific reaction system;
S4: and (3) detecting ST11 carbapenem drug-resistant klebsiella pneumoniae (CRKP) carrying virulence genes rmpA, rmpA2 and iucA by using the constructed reaction system.
Further, the virulence genes rmpA, rmpA2 and iucA are specifically:
>iucA
GCTTTATCGACTAAATTCTCATTAGCATAACGAGTGAGATCTGTTTGACTATGACT
TTGCCAACTAAAAC
CTCAACCTTGGATGTGGCTGCTCAGTGCTTCCTTAATTCCCTAGTTCGTGAAACCA
AAGACTGGCGGCTG
ACGGAATACCAGCCAACCCAATTGATCATCCCGCTGGGCGAACAGCAGGCGCTCC
ATTTCAGAGTGGCTT
ATTTCTCCCCAACCCAGCATCACCGCTTTGAATTTCCGGCGCGTCTGGTCACAGCA
TCCGGCAGTCACCC
CATCGATTTCACCACCCTCTCCCGGCTTATTGTTGATAAGCTCCAGCACCAACTCT
CGCTGCCCGCGACC
AGTTGCGAAACCTTCCACCAGCGCGTGATGGAAAGCCACGCCCATACGCAGCAAG
CGATTGATGCCCGCC
ATGACTGGGCAGCCCTGCGTGAAAAAGCGTTGAACTTTGGCGAGGCGGAGCAGGC
TCTGCTGGTCGGGCA
CGCCTTCCACCCGGCGCCTAAGTCTCATGAACCGTTTAACCAGCAGGAGGCCGAA
CGCTACCTGCCGGAC
TTCGCGCCCCACTTCCCGCTACAGTGGTTTGCGGTGGACAAAACGCAGATCGCCG
GTGAAAGCCTGCATC
TCAACCTGCAACAGCGGTTGACGCGATTTGCCGCAGAGAATGCGCCGCAGTTACT
CAATGAATTAAGCGA
CAATCAATGGCTATTCCCGCTGCACCCGTGGCAGGGGGAGTATCTGTTGCAGCAG
GAGTGGTGCCAGGAG
CTTGTCGCTAAAGGGCTGATTAAAGATTTAGGCGAAGCCGGCGCGCCGTGGCTAC
CGACCACCTCTTCCC
GCTCGCTCTACTGCGCCACCAGCAGCGACATGATCAAATTCTCCCTGAGCGTGCGC
CTGACCAACTCCGT
CCGTACCCTGTCAGTGAAAGAAGTGAAGCGTGGAATGCGCCTGGCGCGCCTGGCG
CAAACCGACGACTGG
CAGACGCTACAGGCTCGCTTCCCGACTTTCCGGGTGATGCAGGAAGACGGTTGGG
CCGGGCTGCGCGATC
TCCACGGCAACATCATGCAGGAAAGCCTGTTTGCCCTGCGTGAAAACCTGCTGGT
GGATCAGCCGCAAAG
CCAGACTAACGTACTGGTCTCCCTGACCCAGGCCGCACCGGATGGCGGTGATTCG
CTGCTGGTTGCGGCG
GTAAAACGTCTGAGCGATCGCCTCGGCATCACTGCGCAACAGGCCGCCCACGCAT
GGGTCGATGCTTACT
GTCAGCAGGTGCTGAAGCCGCTGTTTACGGCTGAAGCGGATTACGGCCTGGTGCT
GCTGGCGCATCAGCA
AAATATTCTGGTTCAGATGCTTGGGGATCTGCCGGTCGGGCTTATCTACCGTGACT
GTCAGGGCAGCGCG
TTTATGCCTCACGCGGCAGGCTGGCTCGACACCATTGGCGAGGCGCAGGCGGAAA
ACGTCTTCACCCGTG
AGCAGTTGCTGCGCTACTTCCCTTATTACCTGCTGGTTAACTCCACTTTTGCCGTGA
CCGCCGCGCTGGG
CGCCGCCGGGCTGGACAGTGAAGCGAATCTGATGGCTCGCGTACGAACCTTGCTG
GCTGAAGTGCGTGAT
CAGGTGACTCATAAAACCTGTCTCAACTACGTGCTGGAAAATCCGTACTGGAACG
TAAAAGGTAACTTTT
TCTGTTATCTGAACGACCACAACGAGAACACCATCGTCGATCCCTCGGTGATCTAC
TTCGATTTCGCCAA
CCCGCTGCTGGCTCAGGAGGGCTAAATGTCTAAGGCAAACATCGTTCACAGCGGA
TATGGACTACGCTGT
GAAAAACTCGACAAGCCTCTGAATCTTAGCT
>rmpA
TTGACTGATGATTATTTTTTTTATTATGGCCTAAAGCAGTTAACTGGACTACCTCTG
TTTCATATTACAT
ATGAAGGAGTAGTTAATAAATCAATAGCAATTAAGCACAAAAGAAACATAAGAG
TATTGGTTGACAGCAG
GATTTTTTATTCAGGGAAATGGGGAGGGTACAAAATGTTAAGGGGATCATTAAAT
ATGATAAGCCAATGG
ATGTGGCTTGACGTTTCGGGGGGGGGGCGGTTTTATCCTAAAGGGTGTGATTATGA
CATCTATGTTAACA
TGCAAGGAAATGTAAAAAATAATATTGAAAAACTATATTTTGCATTCTTAAAGAA
AAATGTTAGCCGAAT
TGTAAACCATTATCCACGGCTAACAAAAAAGGAACAAGCAGTGCTGCAATGCCTA
CTGAAAAATGGGGGC
ATTAATGAAATAAAAAGTCAACTAAAAATTGAAGAAAAAACGCTATCATGCTACC
AAAGCAAAATAACAA
GAAAATTTGGCTGCAAAAGGTACATAAGGTTTATGTATCTTTACAGCCTTAATAAA
GAAATGGTTGATGA
AAGATGGCTCATGCCAAGTATTTAG
>rmpA2
ATGGAAAAATATATTTACTTTATGTGCAATAAGGATGTTACATTAGTGTTAACTGA
TGATTATTATTTTT
ATTTCGGCCTAAAGCAGTTAACTGGACTACCTCTGGTTTATATTACGTATGAAGGC
TCGATGGATAAACC
AATAGTTATTAAGCAGAAAAGAAATATAAGAGTATTGGTTGATAGCCGGATTTTT
TATTCAGGGAAATGG
GATGGTTATAAAATGTTAAGGAAAACATTAAATATGATAAGTCAATGGATGTGGC
TTGACATTTCGGGGG
GGGGGGAGAAGTTTTATCCTCAAGGGTGTGATTATGACATCTATGTCAACATGCA
AGGAAATTTAAAAAA
AAACATTGAAGAGCTATATTATGCATACTTAAAGAAAAATGTTAGCCGGATTGGA
AATCATTACCCACAA
CTAACAAAAAAAGAACAAATCATTCTACAATGCTTACTCTCCAGGAGGGAGGGCA
TCCATGAATTAAAAA
GCCGTCTAAAAATTGAAGAGAAAACACTATCGTGTCACAGATGTAAAATAACAAG
AAAATTTGGTTGTAA
AAGATTCATAAGATTTATGTATCTTTACAACTTAAATAAAGAAATAACTGATGAA
AAATGGTGCACATCA
AATACCTAG
Further, the primer specifically comprises:
iucA-F:AGTTGGTGCTGGAGCTTATC
iucA-R:TTCCTTAATTCCTTGGTTCG
rmpA-F:GACGGCTTTTTAATTCATGG
rmpA-R:TATTGGTTGATAGCCGGATT
rmpA2-F:TTATTCAGGGAAATGGGATG
rmpA2-R:GACGGCTTTTTAATTCATGG。
in combination with the technical scheme and the technical problems to be solved, the technical scheme to be protected has the following advantages and positive effects:
The first, the invention provides a method for detecting ST11 type high-toxicity carbapenem drug-resistant klebsiella pneumoniae (CR-hvKp), which can rapidly distinguish high-toxicity carbapenem drug-resistant klebsiella pneumoniae (CR-hvKp) carrying rmpA, rmpA2 and iucA virulence genes and classical carbapenem drug-resistant klebsiella pneumoniae by identifying whether the ST11 type carbapenem drug-resistant klebsiella pneumoniae has rmpA, rmpA2 and iucA genes, so as to shorten the screening period and provide another convenient thought for prevention and control of nosocomial infection and epidemiological investigation.
Secondly, the invention aims to design specific primers by using virulence genes rmpA, rmpA2 and iucA as molecular markers, so as to distinguish high-virulence carbapenem-resistant klebsiella pneumoniae (CR-hvKp) carrying rmpA/rmpA and iucA virulence genes from traditional carbapenem-resistant klebsiella pneumoniae, establish a quick screening method of ST11 type CR-hvKp, and provide a convenient and effective idea for preventing and controlling infectious diseases and tracking regional spreading.
Thirdly, as inventive supplementary evidence of the claims of the present invention, the following important aspects are also presented:
(1) The expected benefits and commercial values after the technical scheme of the invention is converted are as follows:
ST11 is the most popular klebsiella pneumoniae in China, and CR-hvKp brings great challenges to clinic due to limited treatment means and poor prognosis. The invention solves the problems of inaccuracy and the like of judging bacterial strain virulence only by phenotype (wiredrawing experiment) through designing specific primers of virulence genes rmpA, rmpA2 and iucA. The invention can obviously improve the accuracy of identifying ST11 type CR-hvKp by combining with a medical diagnosis technology, provides early intervention treatment targets and prognosis judgment basis for the ST11 type CR-hvKp, and has great commercial value.
(2) The technical scheme of the invention fills the technical blank in the domestic and foreign industries:
hvKp are numerous types of virulence factors, with capsules and siderophores being recognized as the primary virulence factor for hvKP. The rmpA gene is closely related to the high-viscosity phenotype of the capsule; iucA is the most representative gene of the aerolysin gene cluster. The most commonly used identification methods for the present hvKp are a wiredrawing experiment (i.e. a colony can be stretched by at least 5mm by using an inoculation ring to stick) and an animal experiment, but more and more researches in recent years find that the non-high virulence klebsiella pneumoniae can also have a high mucus phenotype, and the animal experiment is regarded as a gold standard, but is time-consuming and labor-consuming. Researches show that combining rmpA genes with iucA genes and other virulence genes to identify hvKp and non-hvKp, the accuracy can reach more than 95%, so that the invention can realize rapid and accurate identification of ST11 type CR-hvKp.
(3) The technical scheme of the invention solves the technical problems that people are always desirous of solving but are not successful all the time:
due to the wide use of antibacterial drugs, hvKp has a higher and higher drug-resistant rate, and more carbapenems hvKp (CR-hvKp) have appeared, and the infection caused by these drugs has caused great difficulty in clinical treatment. The hvKp strain with multi-drug resistance, especially CR-hvKp, has a need to find a new strategy to cope with the infection caused by the high-toxicity and high-drug resistance CR-hvKp, and most importantly, hvKp has to be rapidly and effectively identified clinically, so as to provide basis for clinical diagnosis and treatment. The invention provides feasibility for rapid and accurate identification of CR-hvKp.
Fourth, the remarkable technical progress of the invention is embodied in the following aspects in the detection method of ST11 type high-virulence carbapenem drug-resistant klebsiella pneumoniae:
1. advances in molecular biology techniques
Gene sequencing technology: with the advent of new generation sequencing technology, we were able to more rapidly and accurately obtain genomic information from klebsiella pneumoniae. This allows us to accurately identify and locate genes associated with virulence and drug resistance.
Primer design: with the development of computational biology and bioinformatics, we can design specific primers more accurately, and improve the sensitivity and specificity of PCR detection.
2. Application of multiplex PCR technology
The multiplex PCR technology allows that after PCR amplification is carried out on a plurality of specific fragments, the existence of the target gene can be detected through agarose gel electrophoresis, and the detection sensitivity is improved.
3. Advances in data analysis and processing technology
Big data analysis: with the development of big data technology, we were able to process and analyze larger scale genome data from which genetic variations and expression patterns associated with virulence and drug resistance were found.
Artificial intelligence and machine learning: the techniques can be used for optimizing PCR primer design, improving sensitivity and specificity of PCR detection, reducing human error and improving detection efficiency.
The remarkable technical progress of the invention is mainly embodied in the development and application of molecular biology technology, multiplex PCR technology, and data analysis and processing technology in the detection method of ST11 high-toxicity carbapenem drug-resistant klebsiella pneumoniae. Advances in these technologies have helped to increase the sensitivity, specificity and efficiency of detection, providing more accurate and rapid information for clinical diagnosis and treatment.
Drawings
FIG. 1 is a flow chart of a detection method of ST11 type high-toxicity carbapenem drug-resistant klebsiella pneumoniae provided by the embodiment of the invention;
FIG. 2 is a diagram showing virulence genes rmpA, rmpA2, iucA and a blank for CR-hvKp according to an example of the present invention.
Detailed Description
The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
As shown in fig. 1, the embodiment of the invention provides a method for detecting ST11 type high-virulence carbapenem-resistant klebsiella pneumoniae, which comprises the following steps:
S1: aiming at virulence genes rmpA, rmpA2 and iucA in main carbapenem-resistant Klebsiella pneumoniae (CRKP) ST11 type as molecular markers;
S2: downloading virulence genes rmpA, rmpA2 and iucA in CR-hvKp from NCBI database;
s3: designing primers based on the genes, and constructing a specific reaction system;
S4: and (3) detecting ST11 carbapenem drug-resistant klebsiella pneumoniae (CRKP) carrying virulence genes rmpA, rmpA2 and iucA by using the constructed reaction system.
The detection method of the ST11 type high-virulence carbapenem drug-resistant klebsiella pneumoniae (CRKP) provided by the embodiment of the invention is based on the detection of specific virulence genes, and the working principle is as follows:
S1: selection of molecular markers
Virulence gene selection: rmpA, rmpA2 and iucA were chosen as molecular markers. These genes are highly conserved in ST11 type CRKP, and correlate with virulence of the strain. The rmpA and rmpA genes are associated with the colloid forming capacity of the strain, while the iucA gene is associated with the iron uptake system, these functions being critical for the pathogenicity of the strain.
S2: gene information acquisition
Database retrieval: sequence information for rmpA, rmpA2 and iucA genes was downloaded from NCBI database. This step provides an accurate gene sequence as a basis for subsequent primer design.
S3: primer design and reaction system construction
Primer design: specific primers were designed using bioinformatics software based on the downloaded virulence gene sequences. These primers are specific to the rmpA, rmpA2 and iucA genes and ensure the specificity of PCR amplification.
And (3) constructing a reaction system: and constructing a specific PCR reaction system comprising a designed primer, a proper PCR reaction buffer solution, dNTPs, taq enzyme and the like. Reaction conditions (e.g., annealing temperature, extension time, etc.) are optimized for the primer and target gene to ensure high efficiency and high specificity of amplification.
S4: ST11 type CRKP detection:
sample DNA extraction: total DNA is extracted from clinical or environmental samples and used as a template for PCR reactions.
And (3) PCR amplification: and adding the extracted DNA into a constructed specific reaction system for PCR amplification. The PCR procedure includes the steps of pre-denaturation, annealing, extension, etc., and is specifically performed for the rmpA, rmpA2 and iucA genes.
And (3) detecting a product: PCR amplification products are detected by electrophoresis or the like. The specifically amplified product indicates the presence of ST11 type CRKP in the sample.
Significant technical progress:
compared with the prior art, the invention has the technical advantages that:
high specificity: by precisely designing primers for rmpA, rmpA2 and iucA genes, the method can specifically detect ST11 type CRKP, and reduce false positive results.
High sensitivity: the optimized PCR reaction conditions can effectively detect the target gene even under the condition of low copy number, and the detection sensitivity is improved.
Rapid diagnosis: compared with the traditional bacterial culture and identification method, the invention provides a rapid and direct detection means, and the diagnosis time is greatly shortened.
The embodiment of the invention provides a rapid, specific and sensitive ST11 type high virulence CRKP detection method, which has important significance for clinical rapid diagnosis and epidemiological research.
The virulence genes rmpA, rmpA2 and iucA are specifically:
>iucA
GCTTTATCGACTAAATTCTCATTAGCATAACGAGTGAGATCTGTTTGACTATGACT
TTGCCAACTAAAAC
CTCAACCTTGGATGTGGCTGCTCAGTGCTTCCTTAATTCCCTAGTTCGTGAAACCA
AAGACTGGCGGCTG
ACGGAATACCAGCCAACCCAATTGATCATCCCGCTGGGCGAACAGCAGGCGCTCC
ATTTCAGAGTGGCTT
ATTTCTCCCCAACCCAGCATCACCGCTTTGAATTTCCGGCGCGTCTGGTCACAGCA
TCCGGCAGTCACCC
CATCGATTTCACCACCCTCTCCCGGCTTATTGTTGATAAGCTCCAGCACCAACTCT
CGCTGCCCGCGACC
AGTTGCGAAACCTTCCACCAGCGCGTGATGGAAAGCCACGCCCATACGCAGCAAG
CGATTGATGCCCGCC
ATGACTGGGCAGCCCTGCGTGAAAAAGCGTTGAACTTTGGCGAGGCGGAGCAGGC
TCTGCTGGTCGGGCA
CGCCTTCCACCCGGCGCCTAAGTCTCATGAACCGTTTAACCAGCAGGAGGCCGAA
CGCTACCTGCCGGAC
TTCGCGCCCCACTTCCCGCTACAGTGGTTTGCGGTGGACAAAACGCAGATCGCCG
GTGAAAGCCTGCATC
TCAACCTGCAACAGCGGTTGACGCGATTTGCCGCAGAGAATGCGCCGCAGTTACT
CAATGAATTAAGCGA
CAATCAATGGCTATTCCCGCTGCACCCGTGGCAGGGGGAGTATCTGTTGCAGCAG
GAGTGGTGCCAGGAG
CTTGTCGCTAAAGGGCTGATTAAAGATTTAGGCGAAGCCGGCGCGCCGTGGCTAC
CGACCACCTCTTCCC
GCTCGCTCTACTGCGCCACCAGCAGCGACATGATCAAATTCTCCCTGAGCGTGCGC
CTGACCAACTCCGT
CCGTACCCTGTCAGTGAAAGAAGTGAAGCGTGGAATGCGCCTGGCGCGCCTGGCG
CAAACCGACGACTGG
CAGACGCTACAGGCTCGCTTCCCGACTTTCCGGGTGATGCAGGAAGACGGTTGGG
CCGGGCTGCGCGATC
TCCACGGCAACATCATGCAGGAAAGCCTGTTTGCCCTGCGTGAAAACCTGCTGGT
GGATCAGCCGCAAAG
CCAGACTAACGTACTGGTCTCCCTGACCCAGGCCGCACCGGATGGCGGTGATTCG
CTGCTGGTTGCGGCG
GTAAAACGTCTGAGCGATCGCCTCGGCATCACTGCGCAACAGGCCGCCCACGCAT
GGGTCGATGCTTACT
GTCAGCAGGTGCTGAAGCCGCTGTTTACGGCTGAAGCGGATTACGGCCTGGTGCT
GCTGGCGCATCAGCA
AAATATTCTGGTTCAGATGCTTGGGGATCTGCCGGTCGGGCTTATCTACCGTGACT
GTCAGGGCAGCGCG
TTTATGCCTCACGCGGCAGGCTGGCTCGACACCATTGGCGAGGCGCAGGCGGAAA
ACGTCTTCACCCGTG
AGCAGTTGCTGCGCTACTTCCCTTATTACCTGCTGGTTAACTCCACTTTTGCCGTGA
CCGCCGCGCTGGG
CGCCGCCGGGCTGGACAGTGAAGCGAATCTGATGGCTCGCGTACGAACCTTGCTG
GCTGAAGTGCGTGAT
CAGGTGACTCATAAAACCTGTCTCAACTACGTGCTGGAAAATCCGTACTGGAACG
TAAAAGGTAACTTTT
TCTGTTATCTGAACGACCACAACGAGAACACCATCGTCGATCCCTCGGTGATCTAC
TTCGATTTCGCCAA
CCCGCTGCTGGCTCAGGAGGGCTAAATGTCTAAGGCAAACATCGTTCACAGCGGA
TATGGACTACGCTGT
GAAAAACTCGACAAGCCTCTGAATCTTAGCT
>rmpA
TTGACTGATGATTATTTTTTTTATTATGGCCTAAAGCAGTTAACTGGACTACCTCTG
TTTCATATTACAT
ATGAAGGAGTAGTTAATAAATCAATAGCAATTAAGCACAAAAGAAACATAAGAG
TATTGGTTGACAGCAG
GATTTTTTATTCAGGGAAATGGGGAGGGTACAAAATGTTAAGGGGATCATTAAAT
ATGATAAGCCAATGG
ATGTGGCTTGACGTTTCGGGGGGGGGGCGGTTTTATCCTAAAGGGTGTGATTATGA
CATCTATGTTAACA
TGCAAGGAAATGTAAAAAATAATATTGAAAAACTATATTTTGCATTCTTAAAGAA
AAATGTTAGCCGAAT
TGTAAACCATTATCCACGGCTAACAAAAAAGGAACAAGCAGTGCTGCAATGCCTA
CTGAAAAATGGGGGC
ATTAATGAAATAAAAAGTCAACTAAAAATTGAAGAAAAAACGCTATCATGCTACC
AAAGCAAAATAACAA
GAAAATTTGGCTGCAAAAGGTACATAAGGTTTATGTATCTTTACAGCCTTAATAAA
GAAATGGTTGATGA
AAGATGGCTCATGCCAAGTATTTAG
>rmpA2
ATGGAAAAATATATTTACTTTATGTGCAATAAGGATGTTACATTAGTGTTAACTGA
TGATTATTATTTTT
ATTTCGGCCTAAAGCAGTTAACTGGACTACCTCTGGTTTATATTACGTATGAAGGC
TCGATGGATAAACC
AATAGTTATTAAGCAGAAAAGAAATATAAGAGTATTGGTTGATAGCCGGATTTTT
TATTCAGGGAAATGG
GATGGTTATAAAATGTTAAGGAAAACATTAAATATGATAAGTCAATGGATGTGGC
TTGACATTTCGGGGG
GGGGGGAGAAGTTTTATCCTCAAGGGTGTGATTATGACATCTATGTCAACATGCA
AGGAAATTTAAAAAA
AAACATTGAAGAGCTATATTATGCATACTTAAAGAAAAATGTTAGCCGGATTGGA
AATCATTACCCACAA
CTAACAAAAAAAGAACAAATCATTCTACAATGCTTACTCTCCAGGAGGGAGGGCA
TCCATGAATTAAAAA
GCCGTCTAAAAATTGAAGAGAAAACACTATCGTGTCACAGATGTAAAATAACAAG
AAAATTTGGTTGTAA
AAGATTCATAAGATTTATGTATCTTTACAACTTAAATAAAGAAATAACTGATGAA
AAATGGTGCACATCA
AATACCTAG
The primer specifically comprises the following components:
iucA-F:AGTTGGTGCTGGAGCTTATC
iucA-R:TTCCTTAATTCCTTGGTTCG
rmpA-F:GACGGCTTTTTAATTCATGG
rmpA-R:TATTGGTTGATAGCCGGATT
rmpA2-F:TTATTCAGGGAAATGGGATG
rmpA2-R:GACGGCTTTTTAATTCATGG。
As shown in FIG. 2, virulence genes rmpA, rmpA2, iucA in CR-hvKp and a blank map are shown.
Wherein, ol840289.1iuca; nc_005249.1rmpA; nc_005249.1rmpa2; high virulence WCHKP030775gca_002852065.1; non-high virulence 135080gca_0244044495.1.
The invention provides a detection method for ST11 type high-virulence carbapenem drug-resistant klebsiella pneumoniae (CRKP). The method uses specific virulence genes as molecular markers, and uses a multiplex PCR technology to rapidly and accurately identify and detect. The following is a detailed working principle:
s1: determination of molecular markers
A selection marker: virulence genes rmpA, rmpA2 and iucA in ST11 type CRKP were selected as molecular markers. These genes are associated with CRKP virulence, rmpA and rmpA2 are associated with mucosal production of the strain, while iucA genes are associated with iron uptake, which together increase virulence and transmissibility of klebsiella pneumoniae.
S2: primer design and System construction
Downloading a gene sequence: sequences related to virulence genes rmpA, rmpA2 and iucA were downloaded from NCBI (national center for biotechnology information) database.
Designing a primer: specific primers are designed based on the downloaded virulence gene sequences. These primers are designed to specifically amplify the target gene fragment in a multiplex PCR reaction.
And (3) constructing a reaction system: and constructing a specific reaction system according to the designed primer and related multiplex PCR reaction conditions. The system includes all necessary components such as DNA polymerase, dNTPs, buffers, primers, probes, and the like.
S3: multiplex PCR detection
Sample preparation: DNA was extracted from patient samples suspected of infection CRKP as templates for multiplex PCR.
Multiplex PCR amplification and detection: the extracted DNA is added into a multiplex PCR reaction system constructed before, and a specific primer is utilized to amplify a target virulence gene, so that the detection of ST11 type CRKP is realized.
S4: quick identification ST11 type CRKP
And (3) quick identification: through the steps, ST11 type CRKP carrying virulence genes rmpA, rmpA2 and iucA can be rapidly and accurately identified, and an important microbiological basis is provided for clinical treatment.
The detection efficiency is improved: compared with the traditional bacteria culture and identification method, the detection method provided by the invention has the advantages that the detection time is greatly shortened, and the detection efficiency and accuracy are improved.
The invention realizes the rapid and accurate detection of the strain by using the virulence genes rmpA, rmpA2 and iucA of ST11 type high virulence CRKP as molecular markers and combining with a multiple PCR technology. The application of the method not only can effectively improve the diagnosis efficiency of high virulence CRKP, but also provides a powerful tool for further epidemiological research and infection control. Application example one: the application of specific primers of virulence genes rmpA, rmpA2 and iucA in the identification of ST11 type CR-hvKp clinical strain is disclosed. Sample collection: from among the clinically isolated ST 11-type CRKP strains, 20 strains were randomly selected, which had completed the second generation sequencing.
The experimental process comprises the following steps:
S1: extracting bacterial DNA by a boiling method: mu.l of ultrapure water was aspirated and placed in a 1.5ml EP tube, and a single colony was picked up with a sterile gun head and blown into ultrapure water. Placing in a constant temperature intervener, boiling at 100deg.C for 12min, centrifuging at 12000rpm for 1min, and collecting supernatant which is the bacterial DNA extracted.
S2: PCR amplification is carried out by utilizing the rmpA, rmpA2 and iucA gene specific primers designed by the invention:
the reaction system: 2X TAQ MASTER Mix 12.5. Mu.L; ddH2O (double distilled water) 10.5. Mu.L; 1ul of an upstream primer; 1ul of a downstream primer; 1ul of DNA template.
Reaction conditions: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s; annealing at 55 ℃ for 30s; extending at 72 ℃ for 30s; and then the mixture is extended for 5min at 72 ℃. For a total of 30 cycles.
S3: mu.l of PCR product, negative control and DNA LADDER MARKER were added to the spotting wells of 1% agarose gel using a micropipette, electrophoresis was switched on, the voltage was set at 180V, and the time was set at 15min. The gel was removed and the results were observed on a gel imager.
S4: according to the PCR and electrophoresis results, the accuracy of the positive result is 100 percent together with the genome virulence factor detection result and clinical data.
At present, hvKp is not routinely screened and identified in a clinical laboratory, and an accurate etiology diagnosis basis cannot be provided for clinic. The most commonly used identification methods in clinical researches are wiredrawing experiments and animal experiments, but the former has low reliability of experimental results, and the latter has higher requirements on time, facilities, economic conditions and the like, and has no popularization. The rmp gene and iutA gene specific primers are used as the standard for identifying hvKp, so that the accuracy is high, the result can be obtained rapidly, and the method has the advantages of time and labor saving, low cost and high efficiency for clinical application.
The following are two specific examples of methods for detecting ST 11-type high virulence carbapenem-resistant klebsiella pneumoniae:
example 1: PCR-based ST11 type CRKP detection
Step 1: sequence information of virulence genes rmpA, rmpA2 and iucA of ST11 type CRKP was downloaded from NCBI database.
Step 2: based on these sequence information, specific primers were designed. These primers should be able to bind specifically to the genes of interest (rmpA, rmpA2, iucA) and be used for subsequent PCR amplification.
Step 3: a PCR reaction system was constructed comprising specific primers, PCR buffer, dNTPs, DNA template (sample to be detected) and thermostable DNA polymerase.
Step 4: the samples were PCR amplified. The amplification conditions should be optimized to ensure specific amplification of the gene of interest.
Step 5: the PCR products were analyzed. The presence or absence of the PCR product can be detected by gel electrophoresis, multiplex PCR or the like, thereby judging whether the sample contains the virulence gene of ST11 type CRKP.
Example 2: ST11 type CRKP detection based on multiplex PCR
Step 1: sequence information for virulence genes rmpA, rmpA2 and iucA of ST11 type CRKP was also downloaded from NCBI database.
Step 2: specific primers were designed.
Step 3: a multiplex PCR reaction system is constructed comprising specific primers, PCR buffers, dNTPs, DNA templates (samples to be detected) and thermostable DNA polymerase.
Step 4: multiplex PCR amplification was performed. After PCR amplification, specific bands can be observed by agarose gel electrophoresis.
Step 5: multiplex PCR results were analyzed. By analyzing the results of multiplex PCR amplification, it can be judged whether the sample contains the virulence gene of ST11 type CRKP.
The above two examples are based on conventional PCR and multiplex PCR techniques, respectively, and demonstrate how to detect whether a sample contains the virulence gene of ST11 type CRKP. Both methods have the characteristics of high sensitivity, high specificity and rapidness, and are suitable for clinical and laboratory detection requirements.
The foregoing is merely illustrative of specific embodiments of the present invention, and the scope of the invention is not limited thereto, but any modifications, equivalents, improvements and alternatives falling within the spirit and principles of the present invention will be apparent to those skilled in the art within the scope of the present invention.
Claims (6)
1. The method for detecting the ST11 type high-virulence carbapenem drug-resistant klebsiella pneumoniae is characterized by comprising the following steps:
S1: aiming at virulence genes rmpA, rmpA2 and iucA in main carbapenem-resistant Klebsiella pneumoniae (CRKP) ST11 type as molecular markers;
S2: downloading virulence genes rmpA, rmpA2 and iucA in CR-hvKp from NCBI database;
s3: designing primers based on the genes, and constructing a specific reaction system;
S4: and (3) detecting ST11 carbapenem drug-resistant klebsiella pneumoniae (CRKP) carrying virulence genes rmpA, rmpA2 and iucA by using the constructed reaction system.
2. The method according to claim 1, wherein the step of downloading from the public database is to download sequence information related to virulence genes rmpA, rmpA2 and iucA by accessing an NCBI (national center for biotechnology information) database.
3. The method according to claim 1, wherein the step of constructing a multiplex PCR specific reaction system comprises selecting a suitable DNA polymerase, dNTPs, a buffer, and primers and probes designed based on the virulence gene to ensure specificity and efficiency of the reaction.
4. A system for carrying out the detection method according to claim 1, comprising a DNA extraction module for extracting DNA from a sample, and judging whether the sample is ST11 type high-virulence carbapenem-resistant Klebsiella pneumoniae by a specific multiplex PCR reaction and agarose gel electrophoresis result analysis.
5. The method for detecting ST 11-type high-virulence carbapenem-resistant klebsiella pneumoniae according to claim 1, wherein the virulence genes rmpA, rmpA2 and iucA are specifically:
>iucA
GCTTTATCGACTAAATTCTCATTAGCATAACGAGTGAGATCTGTTTGACTATGACTTTGCCAACTAAAAC
CTCAACCTTGGATGTGGCTGCTCAGTGCTTCCTTAATTCCCTAGTTCGTGAAACCAAAGACTGGCGGCTG
ACGGAATACCAGCCAACCCAATTGATCATCCCGCTGGGCGAACAGCAGGCGCTCCATTTCAGAGTGGCTT
ATTTCTCCCCAACCCAGCATCACCGCTTTGAATTTCCGGCGCGTCTGGTCACAGCATCCGGCAGTCACCC
CATCGATTTCACCACCCTCTCCCGGCTTATTGTTGATAAGCTCCAGCACCAACTCTCGCTGCCCGCGACC
AGTTGCGAAACCTTCCACCAGCGCGTGATGGAAAGCCACGCCCATACGCAGCAAGCGATTGATGCCCGCC
ATGACTGGGCAGCCCTGCGTGAAAAAGCGTTGAACTTTGGCGAGGCGGAGCAGGCTCTGCTGGTCGGGCA
CGCCTTCCACCCGGCGCCTAAGTCTCATGAACCGTTTAACCAGCAGGAGGCCGAACGCTACCTGCCGGAC
TTCGCGCCCCACTTCCCGCTACAGTGGTTTGCGGTGGACAAAACGCAGATCGCCGGTGAAAGCCTGCATC
TCAACCTGCAACAGCGGTTGACGCGATTTGCCGCAGAGAATGCGCCGCAGTTACTCAATGAATTAAGCGA
CAATCAATGGCTATTCCCGCTGCACCCGTGGCAGGGGGAGTATCTGTTGCAGCAGGAGTGGTGCCAGGAG
CTTGTCGCTAAAGGGCTGATTAAAGATTTAGGCGAAGCCGGCGCGCCGTGGCTACCGACCACCTCTTCCC
GCTCGCTCTACTGCGCCACCAGCAGCGACATGATCAAATTCTCCCTGAGCGTGCGCCTGACCAACTCCGT
CCGTACCCTGTCAGTGAAAGAAGTGAAGCGTGGAATGCGCCTGGCGCGCCTGGCGCAAACCGACGACTGG
CAGACGCTACAGGCTCGCTTCCCGACTTTCCGGGTGATGCAGGAAGACGGTTGGGCCGGGCTGCGCGATC
TCCACGGCAACATCATGCAGGAAAGCCTGTTTGCCCTGCGTGAAAACCTGCTGGTGGATCAGCCGCAAAG
CCAGACTAACGTACTGGTCTCCCTGACCCAGGCCGCACCGGATGGCGGTGATTCGCTGCTGGTTGCGGCG
GTAAAACGTCTGAGCGATCGCCTCGGCATCACTGCGCAACAGGCCGCCCACGCATGGGTCGATGCTTACT
GTCAGCAGGTGCTGAAGCCGCTGTTTACGGCTGAAGCGGATTACGGCCTGGTGCTGCTGGCGCATCAGCA
AAATATTCTGGTTCAGATGCTTGGGGATCTGCCGGTCGGGCTTATCTACCGTGACTGTCAGGGCAGCGCG
TTTATGCCTCACGCGGCAGGCTGGCTCGACACCATTGGCGAGGCGCAGGCGGAAAACGTCTTCACCCGTG
AGCAGTTGCTGCGCTACTTCCCTTATTACCTGCTGGTTAACTCCACTTTTGCCGTGACCGCCGCGCTGGG
CGCCGCCGGGCTGGACAGTGAAGCGAATCTGATGGCTCGCGTACGAACCTTGCTGGCTGAAGTGCGTGAT
CAGGTGACTCATAAAACCTGTCTCAACTACGTGCTGGAAAATCCGTACTGGAACGTAAAAGGTAACTTTT
TCTGTTATCTGAACGACCACAACGAGAACACCATCGTCGATCCCTCGGTGATCTACTTCGATTTCGCCAA
CCCGCTGCTGGCTCAGGAGGGCTAAATGTCTAAGGCAAACATCGTTCACAGCGGATATGGACTACGCTGT
GAAAAACTCGACAAGCCTCTGAATCTTAGCT
>rmpA
TTGACTGATGATTATTTTTTTTATTATGGCCTAAAGCAGTTAACTGGACTACCTCTGTTTCATATTACAT
ATGAAGGAGTAGTTAATAAATCAATAGCAATTAAGCACAAAAGAAACATAAGAGTATTGGTTGACAGCAG
GATTTTTTATTCAGGGAAATGGGGAGGGTACAAAATGTTAAGGGGATCATTAAATATGATAAGCCAATGG
ATGTGGCTTGACGTTTCGGGGGGGGGGCGGTTTTATCCTAAAGGGTGTGATTATGACATCTATGTTAACA
TGCAAGGAAATGTAAAAAATAATATTGAAAAACTATATTTTGCATTCTTAAAGAAAAATGTTAGCCGAAT
TGTAAACCATTATCCACGGCTAACAAAAAAGGAACAAGCAGTGCTGCAATGCCTACTGAAAAATGGGGGC
ATTAATGAAATAAAAAGTCAACTAAAAATTGAAGAAAAAACGCTATCATGCTACCAAAGCAAAATAACAA
GAAAATTTGGCTGCAAAAGGTACATAAGGTTTATGTATCTTTACAGCCTTAATAAAGAAATGGTTGATGA
AAGATGGCTCATGCCAAGTATTTAG
>rmpA2
ATGGAAAAATATATTTACTTTATGTGCAATAAGGATGTTACATTAGTGTTAACTGATGATTATTATTTTT
ATTTCGGCCTAAAGCAGTTAACTGGACTACCTCTGGTTTATATTACGTATGAAGGCTCGATGGATAAACC
AATAGTTATTAAGCAGAAAAGAAATATAAGAGTATTGGTTGATAGCCGGATTTTTTATTCAGGGAAATGG
GATGGTTATAAAATGTTAAGGAAAACATTAAATATGATAAGTCAATGGATGTGGCTTGACATTTCGGGGG
GGGGGGAGAAGTTTTATCCTCAAGGGTGTGATTATGACATCTATGTCAACATGCAAGGAAATTTAAAAAA
AAACATTGAAGAGCTATATTATGCATACTTAAAGAAAAATGTTAGCCGGATTGGAAATCATTACCCACAA
CTAACAAAAAAAGAACAAATCATTCTACAATGCTTACTCTCCAGGAGGGAGGGCATCCATGAATTAAAAA
GCCGTCTAAAAATTGAAGAGAAAACACTATCGTGTCACAGATGTAAAATAACAAGAAAATTTGGTTGTAA
AAGATTCATAAGATTTATGTATCTTTACAACTTAAATAAAGAAATAACTGATGAAAAATGGTGCACATCA
AATACCTAG。
6. The method for detecting ST 11-type high-virulence carbapenem-resistant klebsiella pneumoniae according to claim 1, wherein the primer is specifically:
iucA-F:AGTTGGTGCTGGAGCTTATC
iucA-R:TTCCTTAATTCCTTGGTTCG
rmpA-F:GACGGCTTTTTAATTCATGG
rmpA-R:TATTGGTTGATAGCCGGATT
rmpA2-F:TTATTCAGGGAAATGGGATG
rmpA2-R:GACGGCTTTTTAATTCATGG。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410491364.8A CN118186113A (en) | 2024-04-23 | 2024-04-23 | Method for detecting ST11 type high-toxicity carbapenem drug-resistant klebsiella pneumoniae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410491364.8A CN118186113A (en) | 2024-04-23 | 2024-04-23 | Method for detecting ST11 type high-toxicity carbapenem drug-resistant klebsiella pneumoniae |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN118186113A true CN118186113A (en) | 2024-06-14 |
Family
ID=91396923
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410491364.8A Pending CN118186113A (en) | 2024-04-23 | 2024-04-23 | Method for detecting ST11 type high-toxicity carbapenem drug-resistant klebsiella pneumoniae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN118186113A (en) |
-
2024
- 2024-04-23 CN CN202410491364.8A patent/CN118186113A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5317430B2 (en) | Probe set, probe carrier, and fungal discrimination identification method | |
| CN112501268B (en) | Nanopore sequencing-based primer group and kit for rapidly identifying respiratory microorganisms and application of primer group and kit | |
| KR20090031716A (en) | Identification of pathogens | |
| CN102703587B (en) | Loop-mediated isothermal amplification method for detecting lyme disease spirochete | |
| CN113481311B (en) | SNP molecular marker for identifying Brucella vaccine strain M5 and application thereof | |
| CN111793704B (en) | SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof | |
| CN103060455A (en) | Detection gene chip for helicobacter pylori infection individualized treatment and application of gene chip | |
| JP6160015B2 (en) | Genotyping method of Acinetobacter spp. And primer set used therefor | |
| CN113862393A (en) | Method for rapidly detecting cryptococcus gatherensis | |
| CN108531627A (en) | One kind is for detecting the streptococcic RPA fluorescent quantitations primer pair of B races, probe, kit and detection method | |
| WO2012087135A1 (en) | Genetic markers specific for clostridium difficile ribotypes 027 (nap01/b1; rt 027) and 078 (nap7/8; rt 078) and their use | |
| CN109735645B (en) | Real-time fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting Sporothrix globosum | |
| CN115786541B (en) | SNP molecular marker, primer probe, kit, method and application for identifying Brucella vaccine strain A19 | |
| KR101166781B1 (en) | Specific primer for strain discrimination of Pleurotus spp. by analysis of mitochondria DNA polymorphism and uses thereof | |
| CN114134218B (en) | Fluorescent detection method based on CRISPR-Cas12a | |
| CN113136443B (en) | Nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis | |
| CN118186113A (en) | Method for detecting ST11 type high-toxicity carbapenem drug-resistant klebsiella pneumoniae | |
| CN104087661A (en) | Method for detecting B. bacilliformis by uxing TaqMan real-time fluorescence quantification PCR | |
| JP5707641B2 (en) | Genotyping method of Pseudomonas aeruginosa and primer set used therefor | |
| CN115976237B (en) | Specific new molecular target for identifying aeromonas and rapid detection method thereof | |
| CN110501414B (en) | Identification model, construction method and application of VIM type and SPM type metalloenzyme pseudomonas aeruginosa | |
| KR102091282B1 (en) | Method for Deciding Pathogen of Species-Specific Red Rot Disease Using Restriction Fragment Length Polymorphism | |
| CN109609668B (en) | Detection primer group and kit for MLVA typing of salmonella typhimurium and application of detection primer group and kit | |
| CN118222732A (en) | LAMP primer probe set for detecting Ballthrough and detection method | |
| CN115678896A (en) | Isolated nucleic acid and application thereof, primer group, reagent, kit and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination |