CN118185931A - RNA editing system for activating Wnt signal path - Google Patents

Abstract

The application relates to the field of gene editing, in particular to an RNA editing system for activating a Wnt signal channel. The application provides an RNA editing element, which comprises an RNA fragment targeting Axin1 and an RNA fragment targeting Axin 2. The construction of the gRNA targeting Axin1 and Axin2 simultaneously can obviously up-regulate Wnt activity compared with the gRNA targeting Axin1 or Axin2 independently. The AAV6 vector is obtained by screening AAV vectors of three different serotypes, has high expression intensity and efficiency, has high infection efficiency on airway epithelial cells and alveolar epithelial cells, and has low infection efficiency on immune cells and endothelial cells. AAV vectors, by assembly with the Cre-LoxP recombinase system, co-infect host cells, facilitating detection of the knockdown efficiency of Cas13d by fluorescent markers.

Description

RNA editing system for activating Wnt signal path

Technical Field

The application relates to the field of gene editing, in particular to an RNA editing system for activating a Wnt signal channel.

Background

The CRISPR system is one of the acquired immune defense mechanisms found in bacteria, in which Cas13 proteins specifically target RNAs. 3 in 2018, yan et al, salk institute Konermann and Arbor Biotechnologies isolated a novel Cas13 protein, called Cas13d, from different species, respectively. Cas13d functions by acting synergistically with gRNA. The gRNA consists of two parts, a Spacer sequence (about 30nt in length) that can be transcribed to specifically recognize the target gene and a DR sequence for binding to Cas13d protein. After the Spacer sequence recognizes the target RNA by base-pairing, the Cas13d protein is recruited to a specific location, exerting cleavage activity, allowing the RNA to be degraded. Because Cas13d is smaller in volume, only about 930 amino acids, it is easier to deliver by a viral vector. In 2020, zhou Haibo et al used Cas13d to specifically knock down Ptbp gene expression in retinal muller glia cells and used AAV vectors to achieve ganglion cell regeneration in adults, confirming the feasibility of Cas13d for RNA editing in vivo.

On the other hand, in the case of lung tissue, alveoli are important sites where gas exchange occurs, but they are easily damaged by close contact with the external environment. The alveoli have two types of epithelial cells, type I (Type I alveolar EPITHELIAL CELLS) and type II (Type II alveolar EPITHELIAL CELLS), respectively, the former being responsible for gas exchange, and the latter reducing the alveolar surface tension by secreting surfactants. Under normal conditions, the lung is a highly quiescent tissue, but studies have shown that there are different epithelial stem/progenitor cells in various areas of the lung, which can rapidly respond after lung injury, and are involved in the repair of injury to the trachea and alveoli by proliferation and differentiation. These stem/progenitor cells include type II alveolar epithelial cells located in the alveoli, with the potential to differentiate into type I alveolar epithelial cells; basal cells (basal cells) located in the trachea, which differentiate to produce various airway epithelial cells; club cells on the airways, which differentiate to produce ciliated cells; bronchioalveolar STEM CELLS (BASCs) at bronchoalveolar junctions, which differentiate to produce alveolar and airway epithelial cells; stem/progenitor cells located in the distal airways, termed lineage negative epithelial stem/progenitor cells (LINEAGE NEGATIVE EPITHELIAL Progenitors, LNEPs), have the potential to differentiate towards type II alveolar epithelial cells and basal-like cells; in addition, type II alveolar epithelial cells (AT 2 s) in the alveoli have the potential to differentiate into type I alveolar epithelial cells (AT 1 s).

The differentiation fate of these epithelial stem/progenitor cells is closely related to the microenvironment in which they are located, with Wnt/β -catenin signaling pathways involved in the proliferation and differentiation of stem/group cells. In the influenza model, activating the Wnt/β -catenin signaling pathway of LNEPs can promote its differentiation towards AT 2; in addition, wnt/β -catenin signaling maintains AT2 stem cell activity, promotes AT2 proliferation, and studies have been made to activate Wnt/β -catenin activity in AT2 cells by developing antibodies specific for Frizzled5, which can be seen in organoid systems and bleomycin-damaged mouse models.

The Wnt signaling pathway is a highly conserved signaling pathway in organisms and functions in cell proliferation, differentiation, and migration. Studies have shown that activation of Wnt signaling pathway plays a role in diverse tissue regeneration, such as promoting liver injury repair and skin epidermis renewal. However, how to safely and effectively activate the Wnt signaling pathway in adults is an unsolved problem, and conventional small molecule inhibitors such as CHIR99021 and LiCl can activate the Wnt signaling pathway by inhibiting the activity of gsk3β, but small molecule inhibitors cannot act on specific tissues or cells, and the safety and the drug effectiveness of the small molecule inhibitors are not guaranteed.

Disclosure of Invention

In view of the above-mentioned drawbacks of the prior art, in order to solve the technical problem that the Wnt signaling pathway cannot be activated safely and effectively in the prior art, the present application aims to provide an RNA editing system for activating the Wnt signaling pathway, which is a transient control mode with better safety because RNA has many copies and is continuously updated in cells because only RNA levels are changed and DNA sequences are not changed as compared with DNA editing based on RNA editing of Cas13 protein CasRx. Cas13d is selected, gRNA sequences of specific targeting beta-Catenin degradation complex members Axin1 and Axin2 are designed, and beta-Catenin is stabilized and a Wnt signal path is activated by instantaneously reducing the expression of mRNA levels of Axin1 and Axin 2. In another aspect, the application also provides for selection of AAV vector delivery editing elements, by screening for different AAV serotypes, screening for AAV serotypes that have optimal infection efficiency for a particular cell. The editing element is packed into AAV vector for further delivery into adult, and the safe and effective mRNA level regulation of specific cells is finally realized, so that Wnt signal channel is activated.

To achieve the above and other related objects, a first aspect of the present application provides an RNA editing element comprising an Axin 1-targeting RNA fragment and an Axin 2-targeting RNA fragment.

In a second aspect, the application provides a biomaterial selected from any one of the following:

1) The biological material is a polynucleotide, and the polynucleotide encodes the RNA editing element;

2) The biological material is a nucleic acid construct comprising the polynucleotide of 1);

3) The biological material is a host cell comprising the construct or genome of 2) integrated with the polynucleotide of 1).

A third aspect of the present application provides a gene editing system comprising: an RNA editing element as described above or a gene encoding the same; and, a nuclease or a gene encoding the same, or a complex of said RNA editing element and a nuclease.

In a fourth aspect, the application provides a pharmaceutical composition comprising the gene editing system as described above, and a pharmaceutically acceptable carrier.

In a fifth aspect the application provides the use of the RNA editing element, the biomaterial, the gene editing system or the pharmaceutical composition described above for the preparation of a product having any one or more of the following functions:

a) Activating the Wnt pathway;

b) Treating a lung injury-related disorder;

c) Promoting lung regeneration;

d) Promote proliferation and differentiation of type II alveolar epithelial cells.

The sixth aspect of the present application provides a gene editing method, wherein the aforementioned gene editing system is brought into contact with Axin1 and Axin2 genes to effect editing of Axin1 and Axin2 genes.

A seventh aspect of the present application provides a cell obtained by gene editing by the aforementioned gene editing method; preferably, the cell is a mammalian cell; more preferably, the cells are lung epithelial stem cells.

Compared with the prior art, the application has the beneficial effects that:

1. The construction of the gRNA targeting Axin1 and Axin2 simultaneously can obviously up-regulate Wnt activity compared with the gRNA targeting Axin1 or Axin2 independently.

2. The AAV6 vector is obtained by screening AAV vectors of three different serotypes, the expression intensity and the infection efficiency are high, the infection efficiency on airway epithelial cells and alveolar epithelial cells is high, and the infection efficiency on immune cells and endothelial cells is low.

3. AAV vectors, by assembly with the Cre-LoxP recombinase system, co-infect host cells, facilitating detection of the knock-in efficiency of Cas13d by fluorescent labeling.

Drawings

FIG. 1 shows the principle of action of Cas13d and the structure of gRNA (Konermann S et al. Cell,2018,173 (3): 665-676).

FIG. 2 is a schematic representation of the sequence of example 3 screening for gRNAs targeting Axin1 and Axin 2. The gRNAs CasRx and targeting Axin1 and Axin2 were overexpressed in mouse cell lines and the knockdown effects of different gRNAs on Axin1 and Axin2 were detected by qRT-PCR and Western Blot.

FIG. 3 is a graph showing the effect of example 3 knockdown of Axin1 and Axin2 on the activation of the Wnt pathway. The effect of knockdown Axin1 and Axin2 on Wnt pathway activity was probed by a luciferase reporter system with a single gRNA or a combination of grnas. The results indicate that when Axin1 and Axin2 are knocked down simultaneously, wnt signaling pathway activity can be significantly up-regulated.

Fig. 4 is a view of AAV structure of example 4.

FIG. 5 is a graph of the ratio of AAV-infected cells in each cell population detected by the flow assay of example 4. The different AAV serotypes expressing GFP were delivered to the lung tissue of mice by means of tracheal intubation, the infection intensity of the different AAV and the infection efficiency on the different cell types were compared by flow analysis, and the AAV6 serotype was finally selected.

FIG. 6 is a schematic diagram of the ratio of AAV co-infection detection of the same cells by the flow assay of example 5.

FIG. 7 is a graph of the recombination efficiency of the Split-Cre enzyme system detected by the flow assay of example 6 in mice.

FIG. 8 is an AAV vector packaging strategy according to example 6.

Fig. 9 is AAV 6-mediated activation of Wnt signaling pathways in vivo of example 6.

Fig. 10 is a graph showing that activation of Wnt signaling pathway inhibits progression of pulmonary fibrosis in the prophylactic panel of example 7.

Fig. 11 is a graph showing that activation of Wnt signaling pathway inhibits progression of pulmonary fibrosis in the therapeutic panel of example 7.

Detailed Description

In order to make the objects, technical solutions and advantageous effects of the present application clearer, the present application will be further described with reference to examples. It is to be understood that the examples are provided for the purpose of illustrating the application and are not intended to limit the scope of the application. The test methods used in the following examples are conventional, and other advantages and effects of the present application will be readily apparent to those skilled in the art from the disclosure herein.

Through a great deal of research and study, the application discovers an RNA editing system for activating a Wnt signal channel, and the application is completed on the basis.

In one aspect, the application provides an RNA editing element comprising an Axin 1-targeting RNA fragment and an Axin 2-targeting RNA fragment. The RNA editing element is gRNA. Axin1 and Axin2 are used as beta-Catenin degradation complex, and degradation of Axin1 and Axin2 can influence the stability of beta-Catenin and activate Wnt signal channels, so that the regeneration process of lung cells is influenced.

In the RNA editing element provided by the application, axin1 and Axin2 both comprise Exon. Exon is a gene sequence that is preserved in the splicing of pre-mRNA and eventually appears in mature mRNA and can be encoded and translated into protein.

In the RNA editing element provided by the application, the RNA editing element comprises an RNA fragment targeting an Axin1Exon region and an RNA fragment targeting an Axin2Exon region. Preferably, the Axin1Exon region is selected from Exon2, exon6, exon9 or Exon10 of Axin1, and the Axin2Exon region is selected from Exon2, exon6, exon10 or Exon11 of Axin 2. More preferably, the Axin1Exon region is selected from Exon9 of Axin1 and the Axin2Exon region is selected from Exon10 of Axin 2.

In the RNA editing element provided by the application, the coding gene of the spacer of the RNA fragment of the targeting Axin1 comprises SEQ ID NO：2、SEQ ID NO：3、SEQ ID NO：4、SEQ ID NO：5、SEQ ID NO：6、SEQ ID NO：7、SEQ ID NO：8、SEQ ID NO：10、SEQ ID NO：11、SEQ ID NO：12、SEQ ID NO：13、SEQ ID NO：14、SEQ ID NO：15 or SEQ ID NO:16.

In some embodiments, the spacer sequence encoding gene of Exon2 targeting Axin1 comprises SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. SEQ ID NO: 6. SEQ ID NO:7 or SEQ ID NO:8. specifically, it is:

atcagtgaacaatgagcgctgca(g11，SEQ ID NO：2)；

atcttggtcatccagtaaggaatgcagtga(g1，SEQ ID NO：3)；

ctcctgcttcaggaaagtcctgaacaggct(g2，SEQ ID NO：4)；

gtcacagggctcaagcttcctgaagccact(g3，SEQ ID NO：5)；

gctcttagtggctggcttggtttgtctgga(g4，SEQ ID NO：6)；

ataaatgtcagacttaagaaaggaagggta(g5，SEQ ID NO：7)；

cggccatcatcctcatctgcatcttggt(g13，SEQ ID NO：8)；

gacacaatgccattgctatccag(g12，SEQ ID NO：9)。

In some embodiments, the Axin 1-targeting spacer sequence encoding gene of Exon6 comprises SEQ ID NO:10 or SEQ ID NO:11. specifically, it is:

gaccctttgcacgtgctcatccaggatgct(g6，SEQ ID NO：10)；

tagcactgcagtcttagccacatgcccact(g7，SEQ ID NO：11)。

In some embodiments, the spacer sequence encoding gene of Exon9 that targets Axin1 comprises SEQ ID NO: 12. SEQ ID NO:13 or SEQ ID NO:14. specifically, it is:

cccacagaaatagtaggccacaacaatgct(g8，SEQ ID NO：12)；

ggttagcagctccttgaactggcccagggt(g9，SEQ ID NO：13)；

ccacagaaatagtaggccacaac(g14，SEQ ID NO：14)。

in some embodiments, the Axin 1-targeting spacer sequence encoding gene of Exon10 comprises SEQ ID NO:15 or SEQ ID NO:16. specifically, it is:

actcactttcttaaagtagtatctgtagct(g10，SEQ ID NO：15)；

acatgtacaatatatagaggccc(g15，SEQ ID NO：16)。

the coding gene of the spacer of the RNA fragment targeting Axin2 comprises SEQ ID NO: 17. SEQ ID NO: 18. SEQ ID NO: 19. SEQ ID NO:20 or SEQ ID NO: 21.

In some embodiments, the Axin 2-targeting spacer sequence encoding gene of Exon2 comprises SEQ ID NO:17. specifically, it is:

acaagcaaaccagaagtccagcg(g21，SEQ ID NO：17)。

in some embodiments, the Axin 2-targeting spacer sequence encoding gene of Exon6 comprises SEQ ID NO:18. specifically, it is:

caataataatctgttcccccagg(g25，SEQ ID NO：18)。

In some embodiments, the Axin 2-targeting spacer sequence encoding gene of Exon10 comprises SEQ ID NO:19. specifically, it is:

cagaaaaagtaggtgacaaccag(g22，SEQ ID NO：19)。

in some embodiments, the Axin 2-targeting spacer sequence encoding gene of Exon11 comprises SEQ ID NO:20 or SEQ ID NO:21. specifically, it is:

ttagtctatgaatttcagaaccc(g24，SEQ ID NO：20)；

attaacttaacacaaacccgagc(g23，SEQ ID NO：21)。

preferably, the coding gene of the spacer targeting the RNA fragment of Axin1 comprises SEQ ID NO:14 (g 14) the sequence shown in SEQ ID NO:19 (g 22) the sequence shown in (d).

In the RNA editing element provided by the application, the RNA fragment targeting Axin1 and the RNA fragment targeting Axin2 also comprise DR sequences. Preferably, the coding gene for the DR sequence comprises the amino acid sequence as set forth in SEQ ID NO:1, and a sequence shown in 1. Specifically, it is:

caagtaaacccctaccaactggtcggggtttgaaac(SEQ ID NO：1)。

The 5 'and 3' ends of the gRNA targeting Axin1 and the gRNA targeting Axin2 both contain DR sequences, and one or more spacer sequences are connected between the two DR sequences; multiple spacer sequences are linked by a DR sequence.

CRISPR sequences consist of a differential sequence (known as a spacer sequence) into which phage gene fragments are integrated and a forward repeat Scaffold sequence (known as scanfold or DR, direct Repeat) for binding to Cas proteins. CRISPR sequences are transcribed into guide RNA (gRNA) precursor sequences (pre-gRNA) and, after processing into mature gRNA, the gRNA specifically recognizes the foreign sequence with which pairing can occur by base complementary pairing and mediates cleavage by Cas proteins, thus protecting against re-infection by the same phage.

The principle of action of Cas13d is shown in fig. 1A. The application constructs gRNA into a plasmid vector capable of being expressed by mammalian cells, and the specific structure is that a 23nt spacer sequence capable of specifically targeting Axin is inserted between two DR sequences, wherein the two DR sequences are mainly used for simulating a gRNA precursor sequence which is not processed and mature, as shown in figure 1B.

In the RNA editing element provided by the application, the coding genes of the RNA fragment targeting Axin1 comprise the nucleotide sequence shown in SEQ ID NO：22、SEQ ID NO：23、SEQ ID NO：24、SEQ ID NO：25、SEQ ID NO：26、SEQ ID NO：27、SEQ ID NO：28、SEQ ID NO：29、SEQ ID NO：30、SEQ ID NO：31、SEQ ID NO：32、SEQ ID NO：33、SEQ ID NO：34 or SEQ ID NO: 35.

In some embodiments, the gene encoding the Axin 1-targeted Exon2 gRNA comprises SEQ ID NO: 22. SEQ ID NO: 23. SEQ ID NO: 24. SEQ ID NO: 25. SEQ ID NO: 26. SEQ ID NO:27 or SEQ ID NO:28. specifically, it is:

CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACATCAGTGAACAATGAGCGCTGCACAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC (g 11), SEQ ID NO: 22;

caagtaaacccctaccaactggtcggggtttgaaacatcttggtcatccagtaaggaatgcagtgacaagtaaacccctaccaactggtcggggtttgaaac(g1 Is encoded by the gRNA of SEQ ID NO:23 A) is provided;

caagtaaacccctaccaactggtcggggtttgaaacctcctgcttcaggaaagtcctgaacaggctcaagtaaacccctaccaactggtcggggtttgaaac(g2 Is encoded by the gRNA of SEQ ID NO:24 A) is provided;

caagtaaacccctaccaactggtcggggtttgaaacgtcacagggctcaagcttcctgaagccactcaagtaaacccctaccaactggtcggggtttgaaac(g3 Is encoded by the gRNA of SEQ ID NO:25 A) is provided;

caagtaaacccctaccaactggtcggggtttgaaacgctcttagtggctggcttggtttgtctggacaagtaaacccctaccaactggtcggggtttgaaac(g4 Is encoded by the gRNA of SEQ ID NO:26 A) is provided;

caagtaaacccctaccaactggtcggggtttgaaacataaatgtcagacttaagaaaggaagggtacaagtaaacccctaccaactggtcggggtttgaaac(g5 Is encoded by the gRNA of SEQ ID NO:27 A) is provided;

caagtaaacccctaccaactggtcggggtttgaaaccggccatcatcctcatctgcatcttggtcaagtaaacccctaccaactggtcggggtttgaaac(g13 Is encoded by the gRNA of SEQ ID NO:28 A) is provided;

CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACGACACAATGCCATTGCTATCCAGCAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC (gRNA coding gene of g12, SEQ ID NO: 29).

In some embodiments, the gene encoding the Axin 1-targeted Exon6 gRNA comprises SEQ ID NO:30 or SEQ ID NO:31. specifically, it is:

caagtaaacccctaccaactggtcggggtttgaaacgaccctttgcacgtgctcatccaggatgctcaagtaaacccctaccaactggtcggggtttgaaac(g6 Is encoded by the gRNA of SEQ ID NO:30 A) is provided;

caagtaaacccctaccaactggtcggggtttgaaactagcactgcagtcttagccacatgcccactcaagtaaacccctaccaactggtcggggtttgaaac(g7 Is encoded by the gRNA of SEQ ID NO: 31).

In some embodiments, the gene encoding the Axin 1-targeted Exon9 gRNA comprises the sequence of SEQ ID NO: 32. SEQ ID NO:33 or SEQ ID NO:34. specifically, it is:

caagtaaacccctaccaactggtcggggtttgaaaccccacagaaatagtaggccacaacaatgctcaagtaaacccctaccaactggtcggggtttgaaac(g8 Is encoded by the gRNA of SEQ ID NO:32 A) is provided;

caagtaaacccctaccaactggtcggggtttgaaacggttagcagctccttgaactggcccagggtcaagtaaacccctaccaactggtcggggtttgaaac(g9 Is encoded by the gRNA of SEQ ID NO:33 A) is provided;

caagtaaacccctaccaactggtcggggtttgaaacccacagaaatagtaggccacaaccaagtaaacccctaccaactggtcggggtttgaaacttttt(g14 Is encoded by the gRNA of SEQ ID NO: 34).

In some embodiments, the gene encoding the Axin 1-targeted Exon10 gRNA comprises SEQ ID NO:35 or SEQ ID NO:36. specifically, it is:

caagtaaacccctaccaactggtcggggtttgaaacactcactttcttaaagtagtatctgtagctcaagtaaacccctaccaactggtcggggtttgaaac(g10 Is encoded by the gRNA of SEQ ID NO:35 A) is provided;

CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACACATGTACAATATATAGAGGCCCCAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC (gRNA coding gene of g15, SEQ ID NO: 36).

In the RNA editing element provided by the application, the coding genes of the RNA fragments of the targeting Axin2 comprise the sequences shown in SEQ ID NO: 37. SEQ ID NO: 38. SEQ ID NO: 39. SEQ ID NO:40 or SEQ ID NO: 41.

In some embodiments, the gene encoding the Axin 2-targeted Exon2 gRNA comprises SEQ ID NO:37. specifically, it is:

CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACACAAGCAAACCAGAAGTCCAGCGCAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC (gRNA coding gene of g21, SEQ ID NO: 37).

In some embodiments, the gene encoding Axin 2-targeted Exon6 gRNA comprises SEQ ID NO:38. specifically, it is:

CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACCAATAATAATCTGTTCCCCCAGGCAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC (gRNA coding gene of g25, SEQ ID NO: 38).

In some embodiments, the gene encoding the Axin 2-targeted Exon10 gRNA comprises SEQ ID NO:39. specifically, it is:

caagtaaacccctaccaactggtcggggtttgaaaccagaaaaagtaggtgacaaccagcaagtaaacccctaccaactggtcggggtttgaaacttttt(g22 Is encoded by the gRNA of SEQ ID NO: 39).

In some embodiments, the gene encoding Axin 2-targeted Exon11 gRNA comprises SEQ ID NO:40 or SEQ ID NO:41. specifically, it is:

CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACTTAGTCTATGAATTTCAGAACCCCAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC (gRNA coding gene of g24, SEQ ID NO: 40);

CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACATTAACTTAACACAAACCCGAGCCAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC (gRNA coding gene of g23, SEQ ID NO: 41).

Preferably, the coding gene of the RNA fragment targeting Axin1 comprises SEQ ID NO:34, the coding gene of the RNA fragment targeting Axin2 comprises the sequence shown in SEQ ID NO: 39.

In the RNA editing element provided by the application, the coding gene comprises the sequence shown in SEQ ID NO: 42.

In a specific embodiment of the application, the gRNA coding genes for simultaneously targeting Axin1 and Axin2 comprise a DR sequence, a g14 sequence, a DR sequence, a g22 sequence and a DR sequence which are sequentially connected from the 5' end, and the coding genes are shown as SEQ ID NO:42, is shown as:

caagtaaacccctaccaactggtcggggtttgaaacccacagaaatagtaggccacaaccaagtaaacccctaccaactggtcggggtttgaaaccagaaaaagtaggtgacaaccagcaagtaaacccctaccaactggtcggggtttgaaacttttt(SEQ ID NO：42).

in another aspect, the application provides a biomaterial selected from any one of the following:

1) The biological material is a polynucleotide, and the polynucleotide encodes the RNA editing element;

2) The biological material is a nucleic acid construct comprising the polynucleotide of 1);

3) The biological material is a host cell comprising the construct or genome of 2) integrated with the polynucleotide of 1).

Constructs may generally be obtained by inserting the polynucleotide fragment into a suitable expression vector, which one of skill in the art would select. Expression vectors include, but are not limited to, viral vectors (e.g., vaccinia virus-based viral vectors, polio virus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retrovirus vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retrovirus such as Rous sarcoma virus, harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus), and the like.

Any cell suitable for expression of the expression vector may be used as a host cell, and may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Preferably, the host cell is selected from the group consisting of a mouse cell, a human cell.

In another aspect, the present application provides a gene editing system comprising: the aforementioned RNA editing element or a gene encoding the same; and, a nuclease or a gene encoding the same, or a complex of the aforementioned RNA editing element and a nuclease.

In the gene editing system provided by the application, the nuclease is CRISPR nuclease. Preferably, the nuclease is selected from Cas9, cas12, cas13 protein family or variants thereof. Further preferred, the nuclease is selected from Cas13d.

In a specific embodiment of the application, cas13d, casRx, is from enterococcus flavus (Ruminococcus flavefaciens) XPD3002, shows stronger specificity and higher knockout efficiency in the RNA lysis process of mammalian cells in vitro and in vivo, and CasRx is much smaller than Cas13 protein found before, and is easier to package into AAV vectors for in vivo delivery, thus having great application prospects in RNA editing.

In the gene editing system provided by the application, the gene editing system further comprises a vector, wherein the vector comprises the RNA editing element coding gene and/or the nuclease coding gene. The vector is an AAV vector.

As shown in fig. 1A, the spacer sequence in the gRNA specifically recognizes the target sequence with which pairing can occur by means of base complementary pairing, and the Cas13d protein is recruited to a specific position, exerting cleavage activity, so that the RNA is degraded. Since Cas13d is small in volume, only about 930 amino acids, it is easier to deliver by AAV vectors.

Adeno-Associated Virus (AAV) is a small DNA-containing particle isolated from simian adenovirus that can replicate only when co-cultured with adenovirus, and is about 25nm in diameter, consisting of capsid protein and a single-stranded DNA genome of 4.7kb in length, without an envelope. Has good infection effect on skeletal muscle, retina, liver cells, heart smooth muscle cells, neuron cells, islet B cells, joint synovial cells and the like.

The wild AAV genome consists of two open reading frames, which respectively encode Rep and Cap proteins, the Rep proteins are related to virus replication and are divided into Rep78, rep68, rep52 and Rep40, and the Cap proteins participate in the assembly of capsid proteins; the genome open reading frame is flanked by 145bp long Inverted Terminal Repeats (ITRs) which are the only cis-acting elements required for viral genome replication and packaging.

As shown in FIG. 3, AAV vectors used in the present application are engineered on wild-type AAV vectors, with the AAV genome itself (i.e., the portion encoding the Rep and Cap proteins) between the IRT sequences at both ends replaced with a promoter and a delivery gene. Promoters include one or more of CMV, PGK, CAG, EF a, AFP, U6. Preferably, the promoter regulating nuclease expression is CMV and the promoter regulating RNA editing element is U6.AAV vectors also include WPRE elements that enhance the stability of mRNA after transcription of the vector, and increase mRNA splicing efficiency.

In a specific embodiment of the application, the delivery gene in the AAV vector may be GFP, RFP.

In a particular embodiment of the application, the delivery gene in the AAV vector may also be a combination of one or more of Cas13d, ncre, CCre, gRNA, cre.

The AAV vector of the application is selected from AAV5, AAV6 or AAV9 serotype vectors. The infection efficiency and the diffusion capability of different serotypes at different parts of an organism are different, and the proper serotypes are important in selecting the proper AAV serotypes by combining factors such as characteristics of cells and each AAV serotype, whether genes can realize efficient and stable expression or not, and even the final research result.

The injection mode of AAV vectors greatly affects the infection efficiency in animals, and common injection modes are as follows: tracheal intubation, tail intravenous injection, intraperitoneal injection, enema, brain stereotactic injection, in-situ injection, etc. Tissue-specific gene regulation can be achieved by selecting an appropriate injection mode, and for a specific part, a local in-situ injection mode is generally adopted, such as brain stereotactic injection, muscle site-specific injection, liver parenchymal injection, myocardial in-situ injection, original eye injection, intra-articular injection and the like. In a specific embodiment of the application, the AAV vector is injected into the lung tissue of an animal via an endotracheal tube.

In the gene editing system provided by the application, the gene editing system also comprises a Cre enzyme for tracing or a coding gene thereof. In one embodiment of the application, the Cre enzyme is assembled with a fluorescent gene, such as RFP, which recognizes the loxP site when the gene editing system successfully infects a cell with loxP, and RFP is normally expressed.

In some embodiments, the AAV vector is generally used in conjunction with the Cre-LoxP recombinase system. AAV vectors, by assembly with the Cre-LoxP recombinase system, co-infect host cells, facilitating detection of the knockdown efficiency of Cas13d by fluorescent markers.

In the gene editing system provided by the application, the RNA editing element coding gene and the nuclease coding gene are positioned in the same vector. The Cre enzyme encoding gene is not located in the same vector as the RNA editing element encoding gene and the nuclease encoding gene.

In one embodiment of the application, as shown in FIG. 8, the reporter gene is RFP, the genome length of the reporter gene is limited to AAV itself and is not more than 4.7kb, if the packaged element is required to be packaged into one AAV vector, the length limit of the AAV vector is exceeded, so that the element is split into two AAV vectors for packaging respectively, one AAV vector is provided with a CMV promoter and a Cas13d, U6 promoter and a gRNA which are started by the CMV promoter, and Cre which is started by the CMV promoter, and the other AAV vector is provided with a CMV promoter and Cre which is started by the CMV promoter is used for identifying loxp sites and expressing RFP. When both vectors are injected into a host, the infection of one vector can be judged by the RFP expression of the other vector.

In another aspect, the application provides a pharmaceutical composition comprising the gene editing system described above, and a pharmaceutically acceptable carrier.

The pharmaceutically acceptable carrier should be compatible with the gene editing system, i.e., capable of blending therewith without substantially reducing the efficacy of the pharmaceutical composition. Materials that can be used as carriers include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium methyl cellulose, ethyl cellulose and methyl cellulose; tragacanth powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols such as malondiol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifying agents, such as Tween; wetting agents, such as sodium lauryl sulfate; a colorant; a flavoring agent; tabletting, stabilizing agent and antioxidant; a preservative; non-thermal raw water; isotonic saline solution; and phosphate buffer, etc. These materials can be used as needed to aid stability of the formulation, to enhance activity or to produce acceptable mouthfeel and odor in the case of oral administration.

In a further aspect the application provides the use of the RNA editing element, the biomaterial, the gene editing system or the pharmaceutical composition as defined above for the preparation of a product having any one or more of the following functions:

a) Activating the Wnt pathway;

b) Treating a lung injury-related disorder;

c) Promoting lung regeneration;

d) Promote proliferation and differentiation of type II alveolar epithelial cells.

In the use of the application, which includes pulmonary fibrosis, the application can down-regulate pulmonary fibrosis genes, such as Fn1, col1a2 and Col3a1; pulmonary fibrosis protein levels, such as fibratectin, may also be down-regulated. In some embodiments, the application can reduce the area of the fibrotic region in immunofluorescent staining, e.g., myofibroblast ACTA2 ⁺ and fibroblast PDGFRb ⁺ have decreased areas, and alveolar type II epithelial cell SPC ⁺ and alveolar type I epithelial cell RAGE ⁺ have increased areas (FIGS. 10H-M, 11H-M), suggesting that activation of Wnt signaling pathways in epithelial cells promotes alveolar regeneration repair to some extent, inhibiting the development of pulmonary fibrosis.

In another aspect of the present application, a method for editing a gene is provided, wherein the gene editing system is contacted with Axin1 and Axin2 genes to edit Axin1 and Axin2 genes.

In another aspect, the present application provides a cell obtained by gene editing by the aforementioned gene editing method. Preferably, the cell is a mammalian cell; more preferably, the cells are lung epithelial stem cells. Specifically, by degrading Axin1 and Axin2, β -catenin can be stabilized, thereby activating the Wnt signaling pathway. Wnt signaling affects a variety of physiological and biochemical functions of cells, including lung regeneration in lung injury diseases. Pulmonary regeneration functions include promoting proliferation and differentiation of type II alveolar epithelial cells.

The application is further illustrated by the following examples, which are not intended to limit the scope of the application.

Unless otherwise indicated, the practice of the present invention employs conventional techniques of molecular biology, microbiology, cell biology, biochemistry, and immunology, which are within the understanding of the skilled artisan. These techniques are widely used and can be fully described in the following documents, such as ："Molecularcloning:A Laboratory Manual,Fourth edition"(M.R.Green,et al.2014);"Oligonucleotide Synthesis"(M.J.Gait,et al.1984);"Polymerase Chain Reaction:Principles,Applications and Troubleshooting"(M.E.Babar,et al.2011);"Short Protocols in Molecular Biology,Fifth edition"(F.M.Ausubel,et al.2002);"Methods in Molecular Biology"(Humana Press);"Gene Transfer Vectors for Mammalian Cells"(J.H.Miller and M.P.Calos.1987);"Culture of Animal Cell"(R.I.Freshney,et al.2010);"Methods in Enzymology"(Academic Press,Inc);"Using Antibodies:A Laboratory Manual"(E.Harlow and D.Lane.1999);"Handbook of Experimental Immunology"(L.A.Herzenberg,et al.1997);"Current Protocols in Immunology"(J.E.Coligan,et al.2002).

Example 1

In this embodiment, different spacer sequences are designed for different exon positions of Axin1 and Axin2, and the lengths are 23nt, so that the spacer sequences are obtained as follows:

The coding gene of the spacer targeting the RNA fragment of Axin1 comprises SEQ ID NO：2、SEQ ID NO：3、SEQ ID NO：4、SEQ ID NO：5、SEQ ID NO：6、SEQ ID NO：7、SEQ ID NO：8、SEQ ID NO：10、SEQ ID NO：11、SEQ ID NO：12、SEQ ID NO：13、SEQ ID NO：14、SEQ ID NO：15 or SEQ ID NO: 16.

The coding gene of the spacer of the RNA fragment targeting Axin2 comprises SEQ ID NO: 17. SEQ ID NO: 18. SEQ ID NO: 19. SEQ ID NO:20 or SEQ ID NO: 21.

Example 2

This example constructs a vector containing gRNA and a vector containing Cas13 d.

The 5 'end and the 3' end of the gRNA targeting Axin1 or Axin2 respectively contain DR sequences, and one or more spacer sequences are connected between the two DR sequences; multiple spacer sequences are linked by a DR sequence.

The coding gene of the obtained gRNA is as follows:

Coding genes for Axin 1-targeting grnas include, for example, SEQ ID NO：22、SEQ ID NO：23、SEQ ID NO：24、SEQ ID NO：25、SEQ ID NO：26、SEQ ID NO：27、SEQ ID NO：28、SEQ ID NO：29、SEQ ID NO：30、SEQ ID NO：31、SEQ ID NO：32、SEQ ID NO：33、SEQ ID NO：34、SEQ ID NO：35 or SEQ ID NO:36, a sequence shown in seq id no.

The coding gene of the gRNA targeting Axin2 comprises a sequence shown in SEQ ID NO: 37. SEQ ID NO: 38. SEQ ID NO: 39. SEQ ID NO:40 or SEQ ID NO: 41.

The coding genes of Exon9 of the targeting Axin1 and Exon10 of Axin2 are SEQ ID NO: 42.

The gRNA and Cas13d are respectively constructed into two vectors which can be expressed by mammalian cells, wherein the vector containing the gRNA comprises a U6 promoter, a gRNA sequence, an EF1a promoter and mCherry of which the EF1a promoter is used for initiating expression, which are connected in sequence.

Wherein, the U6 promoter sequence is:

gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggac(SEQ ID NO：43).

The EF1a promoter sequence is:

aaggatctgcgatcgctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaacgggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagctgaagcttcgaggggctcgcatctctccttcacgcgcccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcctgaccctgcttgctcaactctacgtctttgtttcgttttctgttctgcgccgttacagatccaagctgtgaccggcgcctac(SEQ ID NO：44).

the sequence of mCherry is:

atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagct(SEQ ID NO：45).

The vector containing Cas13d comprises a CAG promoter, SV40 NLS-1, cas13d, SV40 NLS-2, P2A and EGFP connected in sequence.

Wherein the sequence of the CAG promoter is:

gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgttgccttcgccccgtgccccgctccgcgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttggtttaatgacggctcgtttcttttctgtggctgcgtgaaagccttaaagggctccgggagggccctttgtgcgggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggcccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcgtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcgggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcggcggtcgggctgtaacccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtgcggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctggcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcgggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccatctccagcctcggggctgccgcagggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagatcc(SEQ ID NO：46).

The sequence of SV40 NLS-1 is:

ttaattaagcacgcgtgcgggatccgctcaattcgccgccaccatgcctaaaaagaaaagaaaggtgggttctggt(SEQ ID NO：47)。

The sequence of Cas13d is:

atcgagaagaagaagagcttcgccaagggcatgggagtgaagagcaccctggtgtccggctctaaggtgtacatgaccacatttgctgagggaagcgacgccaggctggagaagatcgtggagggcgatagcatcagatccgtgaacgagggagaggctttcagcgccgagatggctgacaagaacgctggctacaagatcggaaacgccaagttttcccacccaaagggctacgccgtggtggctaacaacccactgtacaccggaccagtgcagcaggacatgctgggactgaaggagacactggagaagaggtacttcggcgagtccgccgacggaaacgataacatctgcatccaggtcatccacaacatcctggatatcgagaagatcctggctgagtacatcacaaacgccgcttacgccgtgaacaacatctccggcctggacaaggatatcatcggcttcggaaagttttctaccgtgtacacatacgacgagttcaaggatccagagcaccaccgggccgcttttaacaacaacgacaagctgatcaacgccatcaaggctcagtacgacgagttcgataactttctggataaccccaggctgggctacttcggacaggctttcttttctaaggagggcagaaactacatcatcaactacggaaacgagtgttacgacatcctggccctgctgagcggactgaggcactgggtggtgcacaacaacgaggaggagtctcggatcagccgcacctggctgtacaacctggacaagaacctggataacgagtacatctccacactgaactacctgtacgacaggatcaccaacgagctgacaaacagcttctccaagaactctgccgctaacgtgaactacatcgctgagaccctgggcatcaacccagctgagttcgctgagcagtacttcagattttccatcatgaaggagcagaagaacctgggcttcaacatcacaaagctgagagaagtgatgctggacagaaaggatatgtccgagatcaggaagaaccacaaggtgttcgattctatcagaaccaaggtgtacacaatgatggactttgtgatctacaggtactacatcgaggaggatgccaaggtggccgctgccaacaagagcctgcccgacaacgagaagtctctgagcgagaaggatatcttcgtgatcaacctgagaggctcctttaacgacgatcagaaggacgctctgtactacgatgaggccaacaggatctggagaaagctggagaacatcatgcacaacatcaaggagttccggggaaacaagacccgcgagtacaagaagaaggacgctccaaggctgcctaggatcctgcctgctggaagggacgtgagcgccttcagcaagctgatgtacgccctgacaatgtttctggacggaaaggagatcaacgatctgctgaccacactgatcaacaagttcgacaacatccagtcttttctgaaagtgatgcctctgatcggcgtgaacgctaagttcgtggaggagtacgccttctttaaggacagcgccaagatcgctgatgagctgcggctgatcaagtcctttgccaggatgggagagccaatcgctgacgctaggagagctatgtacatcgatgccatccggatcctgggaaccaacctgtcttacgacgagctgaaggctctggccgacaccttcagcctggatgagaacggcaacaagctgaagaagggcaagcacggaatgcgcaacttcatcatcaacaacgtgatcagcaacaagcggtttcactacctgatcagatacggcgacccagctcacctgcacgagatcgctaagaacgaggccgtggtgaagttcgtgctgggacggatcgccgatatccagaagaagcagggccagaacggaaagaaccagatcgaccgctactacgagacctgcatcggcaaggataagggaaagtccgtgtctgagaaggtggacgctctgaccaagatcatcacaggcatgaactacgaccagttcgataagaagagatctgtgatcgaggacaccggaagggagaacgccgagagagagaagtttaagaagatcatcagcctgtacctgacagtgatctaccacatcctgaagaacatcgtgaacatcaacgctagatacgtgatcggcttccactgcgtggagcgcgatgcccagctgtacaaggagaagggatacgacatcaacctgaagaagctggaggagaagggctttagctccgtgaccaagctgtgcgctggaatcgacgagacagcccccgacaagaggaaggatgtggagaaggagatggccgagagagctaaggagagcatcgactccctggagtctgctaaccctaagctgtacgccaactacatcaagtactccgatgagaagaaggccgaggagttcaccaggcagatcaacagagagaaggccaagaccgctctgaacgcctacctgaggaacacaaagtggaacgtgatcatccgggaggacctgctgcgcatcgataacaagacctgtacactgttccggaacaaggctgtgcacctggaggtggctcgctacgtgcacgcctacatcaacgacatcgccgaggtgaactcctactttcagctgtaccactacatcatgcagaggatcatcatgaacgagagatacgagaagtctagcggcaaggtgtctgagtacttcgacgccgtgaacgatgagaagaagtacaacgatagactgctgaagctgctgtgcgtgcctttcggatactgtatcccacggtttaagaacctgagcatcgaggccctgttcgaccgcaacgaggctgccaagtttgataaggagaagaagaaggtgagcggcaactcc(SEQ ID NO：48).

The sequence of SV40 NLS-2 is:

ggttctggtctcgagcccaagaagaagaggaaagtcctcgag(SEQ ID NO：49)。

the sequence of P2A is:

gctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct(SEQ ID NO：50)。

The sequence of EGFP is:

atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa(SEQ ID NO：51).

Example 3

This embodiment screens the space sequence for optimal knockdown efficiency.

Knockdown efficiency of Axin1 or Axin 2-targeted gRNA alone was first screened, and the results are shown in fig. 2C and fig. 2D. The vector containing the gRNA and the vector containing the Cas13d were transfected into the mouse cell line (Neuro-2 a, N2 a) by means of Lipofectamine 2000, invitrogen,11668019, respectively, and the specific experimental procedure was to spread the cells in 24-well plates after the N2a cells in a 10cm dish were digested and counted one day before transfection, the cell density was about 70%, and the cell transfection was performed after overnight culture until the cell density was as long as 80%. Transfection procedure taking a single 24-well example, 50ul Opti-MEM I (Invitrogen, 31985062) was added with 650ng of the Cas13d expressing vector and 350ng of the gRNA expressing vector of example 2; and adding 1.5ul Lipofectamine 2000 ul of Opti-MEM I into the cell, mixing the transfection reagent added 50ul of Opti-MEM I into the vector added Opti-MEM I, incubating for 15min at room temperature, adding 100ul of the transfection reagent into the cell uniformly in a hanging drop manner, culturing for 72h, obtaining cells, and detecting the knocking-down effect of different gRNAs on Axin1 and Axin2 through qRT-PCR.

QRT-PCR screening steps were as follows: cells cultured for 72h were subjected to RNA extraction by RNA extraction kit (Zymo Research, R2062), RNA was reverse transcribed into cDNA (Vazyme, R222-01) by reverse transcription reagent, and qRT-PCR system was prepared by adding qRT-PCR enzyme (Vazyme, Q711-03), primers (Axin 1, axin2 and reference gene HPRT) and cDNA.

The upstream primer of Axin1 is: TGTCCAGTGATGCTGACACG (SEQ ID NO: 52), the downstream primer is: AAGTGCGAGGAATGTGAGGTA (SEQ ID NO: 53).

The upstream primer of Axin2 is: AACCTATGCCCGTTTCCTCTA (SEQ ID NO: 54), the downstream primer is: GAGTGTAAAGACTTGGTCCACC (SEQ ID NO: 55).

The upstream primers of HPRT were: CTGGTGAAAAGGACCTCTCG (SEQ ID NO: 56), the downstream primer is: TGAAGTACTCATTATAGTCAAGGGCA (SEQ ID NO: 57).

After qRT-PCR reaction is finished, the threshold Cycle number (Ct value) of each reaction can be obtained, and the Ct value of the target gene and the Ct value of the reference gene are normalized and then the expression level of the same target gene between different samples is compared. The specific calculation process is that the Ct value of the target gene is subtracted from the Ct value of the reference gene and then recorded as delta Ct, the average value of the delta Ct of the control group is taken, the average value of the delta Ct of the experimental group minus the delta Ct of the control group is recorded as delta Ct, and the expression quantity of the target gene of the experimental group compared with the control group is 2-delta Ct. That is, the expression level of the target gene in the control group is 1, and the expression level of the target gene in the experimental group is higher than that in the control group.

FIGS. 2C and 2D show that Axin1 knockdown efficiency is 70% -80%, axin2 knockdown efficiency is 60% -70%, and that significant decreases in protein levels of Axin1 and Axin2 can also be seen (FIGS. 2E-F). Screening to obtain a spacer sequence with optimal gRNA knocking down efficiency, which is independently targeted to Axin1 or Axin2, wherein the spacer sequence is g14 targeted to Axin1 and g22 targeted to Axin2 respectively.

The effect of knockdown Axin1 and Axin2 on Wnt pathway activity was then investigated by a dual luciferase reporter system (Promega, E1910) with a single gRNA or a combination of grnas. When Wnt signaling is activated, wnt ligands bind to the seven transmembrane proteins Frizzled (Fz), low-density Lipoprotein Receptor-associated protein (LRP), activate downstream cell signaling factor DISHEVELLED (DVL), further phosphorylate gsk3β, inhibit the phosphorylation of β -catenin by the degradation complex formed by CK1, gsk3β, axin and APC, allowing β -catenin in the cytoplasm to accumulate and transport to the nucleus, bind to TCF/LEF transcription factors, and activate expression of downstream target genes.

The double luciferases are Renilla luciferase expressed by a Renilla plasmid vector and firefly luciferase which can be expressed in an 8XTOP plasmid vector respectively, and the Renilla luciferase expressed by the Renilla plasmid vector serves as an experimental internal reference. In the 8XTOP plasmid vector, firefly luciferase expression is activated by starting with 8 repeated TCF/LEF fragments before the firefly luciferase element, i.e., when Wnt signals are activated, β -catenin accumulates and is transported to the nucleus and then binds to the TCF/LEF transcription factor. CasRx and pre-gRNA were overexpressed in N2a cells, and after 24h of transfection, 8XTOP and Renilla plasmids were transfected, the transfection procedure was as described above. Obtaining cells after 48 hours, lysing the cells by lysate in a kit, adding a luciferin substrate, reading a chemiluminescence value by an enzyme-labeling instrument to be recorded as Luciferase, adding Stop & Glo Reagent (Promega, E1910), stopping the Luciferase reaction and starting the Renilla Luciferase reaction, reading a chemiluminescence value by the enzyme-labeling instrument to be recorded as Renilla, wherein the ratio of Luciferase/Renilla is the intensity of Wnt signal activity in each sample, taking the average value of the ratio of Luciferase/Renilla in a control group, comparing the average value of the ratio of Luciferase/Renilla in an experimental group with the ratio of Luciferase/Renilla in a control group to be the intensity of Wnt signal activity in the experimental group, and recording the intensity of Wnt signal activity in the control group as 1.

Positive control: after mutation of serine at position 33, serine at position 37 and 45 and threonine at position 41 in beta-Catenin to alanine (SEQ ID NO: 58), beta-Catenin could not be degraded, as a positive control for the experiment.

The sequence of the mutated beta-Catenin is as follows:

atggctactcaagctgacctgatggagttggacatggccatggagccggacagaaaagctgctgtcagccactggcagcagcagtcttacttggatgctggaatccatgctggtgccaccgccacagctcctgccctgagtggcaagggcaaccctgaggaagaagatgttgacacctcccaagtcctttatgaatgggagcaaggcttttcccagtccttcacgcaagagcaagtagctgatattgacgggcagtatgcaatgactagggctcagagggtccgagctgccatgttccctgagacgctagatgagggcatgcagatcccatccacgcagtttgacgctgctcatcccactaatgtccagcgcttggctgaaccatcacagatgttgaaacatgcagttgtcaatttgattaactatcaggatgacgcggaacttgccacacgtgcaattcctgagctgacaaaactgctaaacgatgaggaccaggtggtagttaataaagctgctgttatggtccatcagctttccaaaaaggaagcttccagacatgccatcatgcgctcccctcagatggtgtctgccattgtacgcaccatgcagaatacaaatgatgtagagacagctcgttgtactgctgggactctgcacaacctttctcaccaccgcgagggcttgctggccatctttaagtctggtggcatcccagcgctggtgaaaatgcttgggtcaccagtggattctgtactgttctacgccatcacgacactgcataatctcctgctccatcaggaaggagctaaaatggcagtgcgcctagctggtggactgcagaaaatggttgctttgctcaacaaaacaaacgtgaaattcttggctattacaacagactgccttcagatcttagcttatggcaatcaagagagcaagctcatcattctggccagtggtggaccccaagccttagtaaacataatgaggacctacacttatgagaagcttctgtggaccacaagcagagtgctgaaggtgctgtctgtctgctctagcaacaagccggccattgtagaagctggtgggatgcaggcactggggcttcatctgacagacccaagtcagcgacttgttcaaaactgtctttggactctcagaaacctttcagatgcagcgactaagcaggaagggatggaaggcctccttgggactctagtgcagcttctgggttccgatgatataaatgtggtcacctgtgcagctggaattctctctaacctcacttgcaataattacaaaaacaagatgatggtgtgccaagtgggtggcatagaggctcttgtacgcaccgtccttcgtgctggtgacagggaagacatcactgagcctgccatctgtgctcttcgtcatctgaccagccggcatcaggaagccgagatggcccagaatgccgttcgccttcattatggactgcctgttgtggttaaactcctgcacccaccatcccactggcctctgataaaggcaactgttggattgattcgaaaccttgccctttgcccagcaaatcatgcgcctttgcgggaacagggtgctattccacgactagttcagctgcttgtacgagcacatcaggacacccaacggcgcacctccatgggtggaacgcagcagcagtttgtggagggcgtgcgcatggaggagatagtagaagggtgtactggagctctccacatccttgctcgggacgttcacaaccggattgtaatccgaggactcaataccattccattgtttgtgcagttgctttattctcccattgaaaatatccaaagagtagctgcaggggtcctctgtgaacttgctcaggacaaggaggctgcagaggccattgaagctgagggagccacagctcccctgacagagttactccactccaggaatgaaggcgtggcaacatacgcagctgctgtcctattccgaatgtctgaggacaagccacaggattacaagaagcggctttcagtcgagctgaccagttccctcttcaggacagagccaatggcttggaatgagactgcagatcttggactggacattggtgcccagggagaagcccttggatatcgccaggatgatcccagctaccgttcttttcactctggtggatacggccaggatgccttggggatggaccctatgatggagcatgagatgggtggccaccaccctggtgctgactatccagttgatgggctgcctgatctgggacacgcccaggacctcatggatgggctgcccccaggtgatagcaatcagctggcctggtttgatactgacctg(SEQ ID NO：58).

The results are shown in FIG. 3: compared to the control, axin1 and Axin2 knockdown alone up-regulated Wnt activity by approximately 2-3 fold, but Axin1 and Axin2 knockdown simultaneously up-regulated Wnt activity significantly by approximately 250 fold (fig. 3A). Positive controls can significantly up-regulate Wnt activity, approximately 800-fold (fig. 3A). Protein levels it can also be seen that when Axin1 and Axin2 were knocked down simultaneously, the protein levels of β -Catenin were significantly higher than when Axin1 or Axin2 were knockdown alone (fig. 3B).

Example 4

This example screens AAV serotypes. Serotypes include AAV5, AAV6, and AAV9.

As shown in FIG. 4, the specific AAV structure is composed of EGFP initiated by CMV promoter packed between ITR sequences at both ends, and AAV of different serotypes is delivered to lung tissue of mice by means of trachea cannula at an injection dose of 10 ¹¹ vg/mouse. On day 14 of infection, mouse lung tissue was taken and the intensity of infection of AAV of different serotypes and the efficiency of infection on different cell types were determined by flow analysis, the different cell types distinguished by flow antibodies including immune cells of CD45 ⁺ (BD, 564279), endothelial cells of CD31 ⁺ (Biolegend, 102449), and airway epithelial cells of CD104 ⁺ and alveolar epithelial cells of CD104 ^- (Biolegend, 123610) in epithelial cells of CD326 ⁺ (Biolegend, 118225).

As a result, as shown in FIG. 5, AAV 6-infected mice were found to have the highest GFP expression intensity and positive cell ratio, and had high infection efficiency on airway epithelial cells and alveolar epithelial cells, while having low infection efficiency on immune cells and endothelial cells (FIG. 5C). The present invention contemplates the activation of Wnt signaling pathway activity of lung epithelial cells by AAV delivery, so AAV6 serotypes were selected as vectors for subsequent experiments.

Example 5

This example explores the proportion of co-infection of two AAV vectors with the same cell.

Since the packaging size of AAV vectors is limited to 4.7kb, the components to be packaged are considered to be split into two AAV vectors, AAV6-GFP and AAV6-Cre can be packaged by a company (PackGene, pai Zhen) respectively by adopting a conventional method, the GFP and Cre are respectively expressed by starting from CMV promoters, and after being mixed in equal quantity, the components are injected into lung tissues of mice with loxp-Stop-loxp-tdTomato in a mode of trachea cannula, and the injection dose is 2X 10 ¹¹ vg/mouse. After 14 days of infection, mouse lung tissue was harvested and digested into single cell suspensions by DISPASE II (Invitrogen, 17105041) and analyzed by flow through for co-expression of GFP ⁺ cells and RFP ⁺ cells.

The results are shown in FIG. 6: the ordinate is GFP and the abscissa is RFP. GFP ⁺ cells account for about 13% (Q1+Q2) of the living cells, RFP ⁺ cells account for about 19% (Q2+Q3) of the living cells, wherein GFP ⁺ cells are RFP ⁺ and about 68% (Q2/(Q2+Q3)) of RFP ⁺ cells express GFP. GFP and RFP have higher co-expression ratio, indicating that AAV co-transfects the same cell more efficiently.

Example 6

This embodiment employs two different packaging strategies.

First packaging strategy: as shown in FIG. 7A, the editing element was combined with the Split-Cre enzyme system and then packaged in two AAV vectors by conventional means (PackGene, pai Zhen Bio), and after mixing the two AAV vectors, the trachea cannula was injected into the lung tissue of mice with loxp-stop-loxp-tdTomato at a dose of 2X 10 ¹¹ vg/mouse, and only after recombination of n-Cre and c-Cre, the Cre enzyme recognizes the loxp site, tdTomato was expressed normally. After 14 days of infection, mouse lung tissue was taken and digested into single cell suspension, cells of PE ⁺ in epithelial cells were sorted by flow sorting, and knock down efficiency was detected by qRT-PCR.

The flow results are shown in fig. 7B: the proportion of cells of PE ⁺ to living cells was only 1.44%, indicating that the Split-Cre enzyme system was not efficient in vivo in assembling the complete Cre enzyme and generating loxp recombination. Cells of PE ⁺ were sorted out and qRT-PCR was used to detect knockdown efficiency, which was found not to be high. It is therefore considered not feasible to use the editing element in combination with the Split-Cre enzyme system to achieve both in vivo tracking and knockdown.

Second packaging strategy: as shown in FIG. 8, the AAV itself is limited to a genome length of no more than 4.7kb, and two AAV vectors are packaged, one of which (AAV-Cre) is provided with a CMV promoter and its initiated Cre for recognizing the loxp site. Another AAV vector has the following 4 packaging modes:

1. The Non-specific Targeting gRNA harboring the CMV promoter and its promoted CasRx, U6 promoter and its promoter (Non Targeting, NT:

caagtaaacccctaccaactggtcggggtttgaaacgggtcttcgagaagacctcaagtaaacccctaccaactggtcggggtttgaaacTTTTT,SEQ ID NO：59);

2. the CasRx and U6 promoters which are provided with a CMV promoter and a promoter thereof and gRNAs which are targeted to Axin1 and Axin2 and are started by the promoters;

3. A GFP provided with a CMV promoter and a promoter thereof;

4. is provided with a CMV promoter and its promoted mutated beta-Catenin as described in example 3.

5 AAV were packaged separately, AAV-Cre was mixed with four other viruses separately and injected into mice with a genotype of loxp-stop-loxp-tdTomato.

After packaging, the subsequent steps are the same as the first packaging strategy, PE+ cells in alveolar epithelial cells are sorted, and activation of in vivo Wnt signals is verified by qRT-PCR and Western Blot. The results indicate that CasRx-mediated knockdown of Axin1 and Axin2 transcript levels was about 50% (FIG. 9A), with elevated protein levels of β -Catenin and decreased phosphorylated β -Catenin levels (FIG. 9B) after knocking down Axin1 and Axin2, indicating that decreased Axin1 and Axin2 transcript levels can stabilize β -Catenin levels. Over-expression of β -Catenin (S > a) compared to GFP can be seen with an up-regulation of Ctnnb1 mRNA levels around 50-fold (fig. 9C), as well as an increase in β -Catenin protein levels (fig. 9D).

According to the application, casRx is adopted to knock down mRNA levels of Axin1 and Axin2, beta-Catenin is stabilized, a Wnt signal path is activated, the influence of the knockdown Axin1 and Axin2 on Wnt activity is explored in a mouse cell line through a dual-luciferase reporter gene system, and the effect of effective activation of the Wnt signal path when Axin1 and Axin2 are knockdown simultaneously is proved. The packed AAV is injected into mice, and the AAV can stabilize beta-Catenin and activate Wnt signal channels when Axin1 and Axin2 are knocked down.

Example 7

The present example performs the application of animal models.

The C57BL/6J mice are induced to generate pulmonary fibrosis by using bleomycin, 1.6mg/kg bleomycin is injected into the mice in a tracheal intubation mode, and whether the activation of Wnt signal channels can inhibit the occurrence and the development of the pulmonary fibrosis or not is explored in the model, so that the injury repair of epithelial cells is promoted.

Experiments were set up as prophylactic and therapeutic experiments, the prophylactic experiment was performed 14 days before bleomycin injury with AAV injection of the second packaging format in example 6, mice were harvested on day 14 (fig. 10A), whereas the therapeutic experiment bleomycin injury was followed by AAV injection of the second packaging format in example 6 on day 6, mice were harvested on day 17 (fig. 11A). The effect of Wnt signaling activation on fibrosis progression in epithelial cells was investigated by qRT-PCR, western Blot and immunofluorescent staining.

The results showed that the expression levels of the fibrotic genes Fn1, col1a2 and Col3a1 were down-regulated at the transcription level (fig. 10D-G, fig. 11D-G), the protein levels of fibratectin were down-regulated, and the SPC expression levels were increased (fig. 10B-C, fig. 11B-C) after Wnt signaling pathway activation. Immunofluorescent staining indicated that the areas of the fibrotic regions, i.e., myofibroblasts ACTA2 ⁺ and fibroblasts PDGFRb ⁺, were reduced and that the areas of type II alveolar epithelial SPC ⁺ and type I alveolar epithelial RAGE ⁺ were increased (fig. 10H-M, fig. 11H-M), suggesting that Wnt signaling pathway activation in the epithelial cells promoted regenerative repair of the alveoli to some extent, inhibiting the development of pulmonary fibrosis.

The above embodiments are merely illustrative of the principles of the present application and its effectiveness, and are not intended to limit the application. Modifications and variations may be made to the above-described embodiments by those skilled in the art without departing from the spirit and scope of the application. Accordingly, it is intended that all equivalent modifications and variations of the application be covered by the claims, which are within the ordinary skill of the art, be within the spirit and scope of the present disclosure.

Claims (16)

1. An RNA editing element comprising an RNA fragment targeting Axin1 and an RNA fragment targeting Axin 2.

2. The RNA editing element of claim 1, wherein the RNA editing element comprises an RNA fragment targeting an Axin1Exon region and an RNA fragment targeting an Axin2Exon region; preferably, the Axin1Exon region is selected from Exon2, exon6, exon9 or Exon10 of Axin1, and the Axin2Exon region is selected from Exon2, exon6, exon10 or Exon11 of Axin 2; more preferably, the Axin1Exon region is selected from Exon9 of Axin1, and the Axin2Exon region is selected from Exon10 of Axin 2.

3. The RNA editing element of claim 1, wherein the spacer encoding gene of the RNA fragment targeting Axin1 comprises SEQ ID NO：2、SEQ ID NO：3、SEQ ID NO：4、SEQ ID NO：5、SEQID NO：6、SEQ ID NO：7、SEQ ID NO：8、SEQ ID NO：10、SEQ ID NO：11、SEQ ID NO：12、SEQ ID NO：13、SEQ ID NO：14、SEQ ID NO：15 or SEQ ID NO:16, a sequence shown in seq id no; the coding gene of the spacer of the RNA fragment of the targeting Axin2 comprises SEQ ID NO: 17. SEQ ID NO: 18. SEQ ID NO: 19. SEQ ID NO:20 or SEQ ID NO:21, a sequence shown in seq id no; preferably, the coding gene of the spacer of the RNA fragment targeting Axin1 comprises SEQ ID NO:14, the coding gene of the spacer of the RNA fragment targeting Axin2 comprises the sequence shown in SEQ ID NO:19, a sequence shown in seq id no;

and/or, the Axin 1-targeting RNA fragment and Axin 2-targeting RNA fragment further comprise a DR sequence, preferably the coding gene of the DR sequence comprises an amino acid sequence as set forth in SEQ ID NO:1, and a sequence shown in 1.

4. The RNA editing element of claim 1, wherein the gene encoding the RNA fragment targeting Axin1 comprises a sequence as set forth in SEQ ID NO：22、SEQ ID NO：23、SEQ ID NO：24、SEQ ID NO：25、SEQID NO：26、SEQ ID NO：27、SEQ ID NO：28、SEQ ID NO：29、SEQ ID NO：30、SEQID NO：31、SEQ ID NO：32、SEQ ID NO：33、SEQ ID NO：34、SEQ ID NO：35 or seq id NO:36, the coding gene of the RNA fragment of the targeting Axin2 comprises a sequence shown in SEQ ID NO: 37. SEQ ID NO: 38. SEQ ID NO: 39. SEQ ID NO:40 or SEQ ID NO: 41; preferably, the coding gene of the Axin1 targeting RNA fragment comprises SEQ ID NO:34, and the coding gene of the RNA fragment targeting Axin2 comprises a sequence shown in SEQ ID NO: 39.

5. The RNA editing element of claim 1, wherein the coding gene of the RNA editing element comprises the sequence set forth in SEQ ID NO: 42.

6. A biomaterial selected from any one of the following:

1) The biological material is a polynucleotide encoding the RNA editing element of any one of claims 1 to 5;

2) The biological material is a nucleic acid construct comprising 1) the polynucleotide;

3) The biological material is a host cell comprising 2) the construct or the genome having the polynucleotide of 1) integrated therein.

7. A gene editing system, the gene editing system comprising: the RNA editing element of any one of claims 1 to 5, or a gene encoding the same; and, a nuclease or a gene encoding the same, or a complex of an RNA editing element according to any one of claims 1 to 5 and a nuclease.

8. The gene editing system of claim 7, wherein the nuclease is a CRISPR nuclease; preferably, the nuclease is selected from Cas9, cas12, cas13 protein family or variants thereof; further preferably, the nuclease is selected from Cas13d.

9. The gene editing system of claim 7, further comprising a vector comprising the RNA editing element-encoding gene of any one of claims 1 to 5, and/or a nuclease-encoding gene;

and/or the gene editing system further comprises a Cre enzyme for tracing or a coding gene thereof.

10. The gene editing system of claim 9, wherein the vector is an AAV vector; preferably, the AAV vector is selected from AAV5, AAV6 or AAV9 serotype vectors.

11. The gene editing system of claim 10, wherein the AAV vector comprises regulatory elements; preferably, the regulatory elements include cis-acting elements and promoters; preferably, the cis-acting element comprises an inverted terminal repeat; the promoter comprises one or more of CMV, PGK, CAG, EF1 alpha, AFP and U6; more preferably, the promoter regulating the expression of the nuclease is CMV and the promoter regulating the RNA editing element is U6.

12. The gene editing system of claim 10, further comprising:

The RNA editing element coding gene and the nuclease coding gene are positioned in the same vector;

and/or, the Cre enzyme encoding gene is not located in the same vector as the RNA editing element encoding gene and nuclease encoding gene.

13. A pharmaceutical composition comprising the gene editing system of any one of claims 7 to 12, and a pharmaceutically acceptable carrier.

14. Use of the RNA editing element of any one of claims 1 to 5, the biomaterial of claim 6, the gene editing system of any one of claims 7 to 12 or the pharmaceutical composition of claim 13 for the preparation of a product having the function of any one or more of:

a) Activating the Wnt pathway;

b) Treating a lung injury-related disorder;

c) Promoting lung regeneration;

d) Promote proliferation and differentiation of type II alveolar epithelial cells.

15. A gene editing method, characterized in that the gene editing system according to any one of claims 7 to 12 is contacted with Axin1 and Axin2 genes to effect editing of Axin1 and Axin2 genes.

16. A cell obtained by gene editing by the gene editing method according to claim 15; preferably, the cell is a mammalian cell; more preferably, the cells are lung epithelial stem cells.