CN118160687A - Application of targeting Rbm24a to control fish fertility - Google Patents

Abstract

The invention belongs to the technical field of genetic propagation, and particularly relates to application of targeting Rbm24a to control fish fertility. In particular, the invention has found through research that Rbm24a is a novel fish germplasm component which plays a role of germplasm organization. The loss of function of the parent protein can lead the original germ cells not to form and show sterile phenotype, but does not affect the development of other tissues and organs, so rbm a is a novel target gene for controlling fish fertility. Furthermore, the invention also develops a strategy for inducing degradation of the parent Rbm24a protein by using auxin treatment, thereby realizing control of fish fertility, and simultaneously, the degradation of Rbm24a can be induced by zGrad to generate sterile offspring. The method is convenient, safe and thorough in control of fish fertility, and therefore has good practical application value.

Description

Application of targeting Rbm24a to control fish fertility

Technical Field

The invention belongs to the technical field of genetic propagation, and particularly relates to application of targeting Rbm24a to control fish fertility.

Background

The disclosure of this background section is only intended to increase the understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art already known to those of ordinary skill in the art.

Fish is a good quality food source for humans, and the yield in China is 52.2% of the aquaculture yield (national fishery economic statistics publication of 2022), which is far superior to other aquatic species. Therefore, the improvement of the yield and the quality of the economic fish has very important strategic and economic values. The gonad development of fish can sometimes have negative influence on economic character, because the gonad development is very energy-consuming and competes with nutrient growth, thereby causing the bad consequences of slow growth rate, meat degradation and the like, and thus the cultivation of sterile fish has wide economic value. In addition, control of fertility is also critical in that transgenic fish can be allowed for production. This is because transgenic fish with excellent properties may escape from the culture environment into nature and mass-reproduce to cause ecological invasion and destruction. From the ecological safety point of view, the delivery of sterile fries for production is a perfect solution to avoid the invasion of species. Therefore, it is very critical to establish a convenient, safe and thorough method for controlling fish fertility.

Rbm24a is an RNA-binding protein, and the inventors found in previous studies that the gene encoding the protein is expressed very specifically in the basal plates of the sensory organs, especially the lens, in addition to the heart and skeletal muscle. It was further found by tissue section that the gene was very specifically expressed in the cytoplasm of the primary and secondary fibroblasts that were differentiating. And finally demonstrated that Rbm24a is a key post-transcriptional regulator that regulates lens terminal differentiation and transparency, regulating the translation efficiency of lens-specific mRNA by controlling the length of the mRNA poly (A) tail in the cytoplasm through a cytoplasmic polyadenylation mechanism (PNAS, 2020,117 (13): 7245). However, there has been no report on what kind of role it plays in fish fertility.

Disclosure of Invention

Aiming at the technical problems, the invention provides an application of targeting Rbm24a to control fish fertility. In particular, the invention has found through research that Rbm24a is a novel fish germplasm component which plays a role of germplasm organization. The loss of function of the parent protein can lead the original germ cells not to form and show sterile phenotype, but does not affect the development of other tissues and organs, so rbm a is a novel target gene for controlling fish fertility. Furthermore, the invention also develops a strategy for inducing degradation of the parent Rbm24a protein by using auxin treatment, thereby realizing control of fish fertility; meanwhile, the degradation of Rbm24a can be induced by zGrad to generate sterile offspring. Based on the above results, the present invention has been completed.

In order to achieve the technical purpose, the invention adopts the following technical scheme:

in a first aspect of the invention, there is provided the use of a targeting Rbm24a for controlling fish fertility.

Specifically, in the experimental research of zebra fish, the Rbm24a protein is a new germplasm component in fish, and the knocked-out Rbm a leads to specific loss and sterility of germ cells, so that the targeting of Rbm24a can effectively control the fertility of fish.

Thus, the application is embodied as: knocking out gene rbm a results in specific loss and sterility of fish germ cells.

In a second aspect of the invention, there is provided a method of controlling fertility in fish, the method comprising treating with auxin to induce degradation of a parent Rbm24a protein in fish;

alternatively, the control method may be to induce degradation of Rbm24a at zGrad to produce sterile offspring, in which case auxin treatment is not required for induction.

In a third aspect of the invention there is provided the use of the control method described above in any one or more of:

(a) Producing sterile fish in large scale;

(b) And breeding excellent strains of fish and controlling fertility.

Wherein, in the application (a), the sterile fish comprises a sterile fish embryo;

in said application (b), controlling fertility is embodied in controlling fish infertility.

The beneficial technical effects of one or more of the technical schemes are as follows:

According to the technical scheme, rbm24a is a novel germplasm component, and the loss of functions of parent proteins can lead original germ cells not to form and show sterile phenotype, but the development of other tissues and organs is not affected, so Rbm a is a novel target gene for controlling fish fertility.

The further developed strategy for inducing degradation of the parent Rbm24a protein by using auxin treatment can realize control of fish fertility, and the scheme has incomparable advantages: firstly, the germ cells are thoroughly removed by targeting rbm a, so that the effect of complete sterility can be achieved; secondly, the method has no influence on the health of the fish, and the germ cells are specifically removed, so that the development of other tissues and organs is not influenced. Thirdly, the human and animal cells do not react to auxin, and the safety of auxin treatment is not worried about; fourth, the treatment procedure is simple, the cost is low, the time is short, and thousands of embryos can be treated on a large scale; meanwhile, the technical scheme also provides a method for inducing degradation of Rbm24a to generate sterile offspring by zGrad.

The rbm a-gfp-degron KI strain is established in economic fish, so that large-scale sterile embryo production can be directly used for production, and the rbm a-gfp-degron KI strain can be used as a chassis for breeding, and the bred excellent strain has the characteristic of fertility control, and the sterile embryo can be used for production without worrying about the influence of the sterile embryo on ecological safety, so that the method has good practical application value.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.

FIG. 1 shows that Rbm24a is a germplasm protein component in the examples of the invention; a, knocking the gene into the exogenous DNA insertion site of the fish. b, rbm specific localization of the Rbm24a-GFP parent protein in germplasm and germ cells was observed in Rbm a-GFP KI embryos. c, 4-cell phase, rbm24a protein co-localizes with germplasm RNA ddx4, dazl and germplasm protein Piwil 1. d,24-hpf (hours after fertilization), rbm24a co-localizes with germplasm Ddx4 in PGCs.

FIG. 2 shows that the knock-out rbm a of the parent product resulted in specific loss and sterility of germ cells in the examples of the present invention; a, a method for producing rbm a parent mutants. b and c, the spawning of the mother source mutant male fish and the wild type female fish cannot be split, and the mating spawning of the wild type male fish and the wild type female fish is normal. d and e, the rbm a parent mutant males had no apparent testis structure compared to wild type testis on either side of swim bladder. f and g, rbm a parent mutants contain only gonadal cell structures, exhibit cavitation, and have no germ cells. Markers for germ cells detected at h,24hpf all showed complete loss of germ cells in the rbm a parent mutant. i and j, in rbm a parent mutant, germplasm protein Ddx4 was completely absent. k and l, the germplasm protein Piwil1 was completely absent in rbm a parent mutant. m and n, injection of YFP-nano 3' UTR reporter gene into wild type showed clear PGC, but no brightly fluorescent PGC was seen in the mutant. o,6hpf, no signal was detected in rbm a mutants. The p, single cell RNA-seq data showed complete disappearance of PGC populations in the 6-hpf rbm a parent mutant, while none of the other cell populations had significantly changed.

FIG. 3 shows the construction rbm a-gfp-degron KI (a) of the examples of the invention to achieve auxin-induced germ cell loss in this line (b).

FIG. 4 is a diagram showing the induction of degradation of Rbm24a based on zGrad in an example of the present invention to produce sterile offspring; a is the co-expression of GFP fusion protein in zebra fish and zGrad will trigger ubiquitination of GFP fusion protein, b is two methods of generating sterile offspring, c is the complete disappearance of PGC marker gene nanos3 expression in embryos injected with 6 and 24hpf of zGrad mRNA.

Detailed Description

It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention. As used herein, the singular is also intended to include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that the terms "comprises" and/or "comprising" when used in this specification are taken to specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof. It is to be understood that the scope of the invention is not limited to the specific embodiments described below; it is also to be understood that the terminology used in the examples of the invention is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the invention.

In an exemplary embodiment of the invention, there is provided a use of targeted Rbm24a for controlling fish fertility.

Specifically, in the experimental research of zebra fish, the Rbm24a protein is a new germplasm component in fish, and the knocked-out Rbm a leads to specific loss and sterility of germ cells, so that the targeting of Rbm24a can effectively control the fertility of fish.

Thus, the application is embodied as: knocking out gene rbm a results in specific loss and sterility of fish germ cells.

In yet another embodiment of the present invention, there is provided a control method of fish fertility, the control method comprising inducing degradation of fish parent Rbm24a protein with auxin treatment;

in yet another embodiment of the present invention, the method comprises:

Knocking in a modified Rbm a fourth exon into a Rbm a third intron of the gene, and fusing a green fluorescent protein and a degradation subsequence into an endogenous Rbm24a protein (degron); simultaneously, the E3 ubiquitin ligase gene TIR1 responding to auxin is connected beside rbm a gene, and the E3 ubiquitin ligase gene TIR1 is driven by a promoter, so that the TIR1 protein is expressed in eggs and early embryo in a large amount; through passage, a rbm a-gfp-degron KI homozygote strain is bred; then applying auxin to the early embryo for treatment; the promoter is not particularly limited as long as it can drive the expression of a gene in a large amount in an oocyte, and in one embodiment of the present invention, the promoter is zp3b (zpc) promoter.

The homozygous knock-in fish Rbm a-gfp-degron KI is viable but its early embryo treated with auxin will cause the endogenous Rbm24a (with degron tag) to be recognized by the mother expressed TIR1 and specifically degrade after ubiquitin ligation, thus causing reproductive assembly impairment and sterility.

In a further embodiment of the invention, the auxin is in particular potassium 1-naphthanoacetate, the auxin analogue, applied in a concentration of 1-5. Mu.M (preferably 3. Mu.M), the treatment time being 1-10 hours, preferably 6 hours; in one embodiment of the invention, the primordial germ cells PGCs in the embryo are completely deleted by applying 3. Mu.M 1-naphtalene potassium acetate to fertilized eggs for 6 hours.

Further, it is also possible to dispense with the step of auxin treatment, thus providing another method for controlling fertility of fish, specifically: zGrad was co-expressed on the basis of rbm a-gfp KI. zGrad is an artificial E3 ubiquitin ligase targeting GFP fusion protein comprising GFP targeting nanobody (vhhGFP) and an F-box domain from zebra fish F-box AND WD REPEAT domain containing b (fbxw b) gene, co-expression of GFP fusion protein and zGrad in zebra fish would trigger ubiquitination degradation of GFP fusion protein; therefore, introduction of mRNA of zGrad into fertilized eggs of Rbm a-gfp-degron KI homozygous line also effectively depletes Rbm24a protein, resulting in sterility.

Of course, if the Tg (ef1α: zGrad) transgenic fish were to be constructed for mass production purposes, the homozygous male fish of the strain would be mated with the homozygous female fish of rbm a-gfp-degron KI, and the resulting offspring would be sterile.

In yet another embodiment of the present invention, there is provided the use of the control method described above in any one or more of the following:

(a) Producing sterile fish in large scale;

(b) And breeding excellent strains of fish and controlling fertility.

Wherein, in the application (a), the sterile fish comprises a sterile fish embryo;

in said application (b), controlling fertility is embodied in controlling fish infertility.

In the present invention, the fish is preferably an economic fish, but the fish may be a fish for basic research, such as zebra fish, etc., and is not particularly limited herein.

The invention is further illustrated by the following examples, which are not to be construed as limiting the invention. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. In the examples described below, materials, reagents, carriers, strains and the like used, unless otherwise specified, were all obtained commercially.

Examples

1. Rbm24a was found to be an essential germplasm component of primordial germ cells

To understand the function of the parent Rbm24a protein, we first studied the subcellular distribution of this protein within cells during early developmental stages. Since no specific antibody is directed against zebra fish Rbm24a protein, we attempted to construct a knock-in strain with a C-terminal GFP tag linked to the endogenous Rbm a coding region using an intron genome editing strategy (FIG. 1 a). By replacing the endogenous last exon with a GFP-tagged version, we successfully obtained rbm a-GFP knock-in line (abbreviated rbm a-GFP KI) F0 embryo with a GFP pattern that highly matched to rbm a mRNA expression. The zygote-expressed Rbm24a-GFP protein in these embryos was clearly expressed in lens, heart, skeletal muscle and hair cells, indicating successful knock-in occurred during the early cleavage stage.

Next, we examined the localization of the maternal Rbm24a-GFP in early embryos produced by F1 Rbm a-GFP KI fish, finding that GFP signals were localized in germplasm and germ cells (fig. 1 b). In the 1-cell stage, rbm24a-GFP was localized as tiny spots throughout the layer. They actively migrate during the first few cell divisions and accumulate along the cleavage furrow (fig. 1 b). In the 1-somite stage, the parent Rbm24a-GFP protein was specifically present in germ cells and was divided into left and right groups by chordae (FIG. 1 b). At 24 hours after fertilization (hpf), maternal Rbm24a-GFP was still visible in the Primordial Germ Cells (PGCs) that had migrated to the genital ridge (arrows in FIG. 1 b). The parent Rbm24a-GFP was present as large particles around the germ cell nuclei, whereas in the adjacent sarcomere, the syngeneic Rbm24a-GFP was almost uniformly distributed in the cells (FIG. 1 b). Rbm24a-GFP co-localizes with ddx4, dazl and Piwil1 in early cleavage embryos (FIG. 1 c), and at 24hpf it co-localizes perfectly with Ddx4 proteins in PGCs (FIG. 1 d). Since the homozygous Rbm a-GFP KI line is viable and fertile, GFP labeling does not affect the function of the endogenous Rbm24a protein. Thus, the localization pattern of Rbm24a-GFP should represent the state of the endogenous protein. These results indicate that the Rbm24a protein is a novel germplasm component in fish.

2. Knock-out rbm a resulted in a completely sterile phenotype

Since the rbm a zygotic mutant exhibits fatal phenotypes such as heart failure, cataract and hair cell defects, homozygous mutant female fish and mother mutant embryos thereof cannot be obtained by conventional genetic methods. Heart defects can be rescued by driving the expression of rbm-gfp using the cmlc promoter, but the resulting fish still do not survive because the larvae display a unbalanced phenotype. Thus, to facilitate selection of maternal mutants, we first constructed a knock-in line, fusing RFP to the C-terminus of the Rbm24a protein, and simultaneously inserting a zpc: cas9 vector downstream of the Rbm a gene. We named this knock-in strain rbm a-RFP KI ^zpc:cas9. Similar to the rbm a-GFP KI line, the homozygous rbm a-RFP KI ^zpc:cas9 line is healthy and reproductive. The Rbm24a-RFP signal is present in the correct tissue for endogenous Rbm a gene expression. Maternal Rbm24a-RFP also showed germ cell cytoplasmic localization. At the same time, zpc: cas9 insert supports sufficient maternal expression of Cas9 protein, since injection of bmp2b sgrnas into embryos produced by rbm a-RFP KI ^zpc:cas9 females resulted in nearly 100% of the dorsal phenotype. The high genome editing efficiency of rbm a-RFP KI ^zpc:cas9 remains stable over the consecutive three generations.

On the other hand, we constructed a transgenic vector expressing a parent BFP marker and four high efficiency sgrnas for rbm a coding sequences. This sgRNA expression vector was introduced into homozygous rbm a-RFP KI ^zpc:cas9 embryos by Tol2 transposition, resulting in a rbm a maternal mutant (Mrbm a) in BFP positive embryos in the next generation (fig. 2 a). The Mrbm a mutants were readily selected because their Rbm24a-RFP signal disappeared (bottom right panel of FIG. 2 a). Mrbm24a embryos look normal and survive to adulthood. The maternal and zygotic mutants of Rbm a (MZrbm a) exhibited the same lethal phenotype as their zygotic mutants, indicating that the maternal Rbm24a protein was unable to complement the function of the zygotic Rbm a. However, mrbm a adult fish exhibit a fully male trait. They have mating behaviour but only produce unfertilized eggs (fig. 2b and c) and are therefore sterile. In wild males, the testis is found on both sides of the swim bladder. In contrast, rbm a parent mutant fish deposited adipose tissue at the location where the testis should be present (fig. 2d and e). The section and HE staining analysis indicated that sperm and immature male germ cells were not observed in Mrbm a fish. In contrast, only empty spermary tubular structures remained in Mrbm a mutant fish, very similar to the phenotype of dnd1 deficient fish (fig. 2f and g). Due to the lack of germ cells in Mrbm a adult fish, we speculate that primordial germ cell formation may have been disrupted. To investigate this possibility, we examined the expression of several germplasm mRNA in the maternal mutant after rbm a 24 hours, including nano 3, ddx4, ca15b, tdrd7 and kop. Notably, PGC-specific expression of these germline mRNA disappeared in Mrbm a embryos after 24 hours (fig. 2 h). In agreement with this, protein markers of PGCs, such as Piwil1 and Ddx4, were also not detectable in the mutants by immunofluorescence (FIG. 2 i-l). We also injected YFP-nano 3-3' utr mRNA into wild-type and Mrbm a embryos, but in the latter no YFP-positive PGCs could be detected (fig. 2m and n). Loss of PGC in the mutant could even be observed at the initial developmental stage after 6 hours (fig. 2 o). The results of single cell sequencing also indicated that Mrbm a embryos specifically lost PGCs, a cell type (fig. 2 p). Together, these results indicate complete disappearance of PGCs in rbm a mutant, which can be a target gene for manipulating fish fertility.

3. Construction of a zebra fish line in which auxin induces degradation of Rbm24a

To enable the Rbm24a to respond to auxin-induced protein degradation (Auxin induced protein degradation, AID), we performed a gene knock-in procedure at the same position as the third intron of Rbm a, with GFP tag and a degradation subsequence on the endogenous protein of Rbm24a (FIG. 3 a). Through passage, rbm a-gfp-degron KI homozygote strain is bred. Fertilized eggs produced by rbm a-gfp-degron KI homozygous line were placed in 3 μ M K-NAA (1-NAPHTHALENEACETIC ACID, patassium salt, auxin analog, dissolved in E3 buffer) and treated for 6 hours, and the untreated and treated groups of embryos, 6hpf and 27hpf, respectively, were fixed and probed for the presence of PGC using nano 3 as a probe. The results showed complete deletion of PGCs in auxin treated embryos (fig. 3 b).

Wherein, the third intron of the rbm a gene performs the gene knock-in sgRNA sequence: TAATACGACTCACTATAGGGCTGCTGTCATGTTGGGTGTTTTAGAGCTAGAA (SEQ ID NO. 1)

Zpc: tir1 KI ^{rbm24a 3rd intron} Gene knock-in plasmid sequence information:

Wherein the black bolded portion is the sgRNA target region and the blue underlined portion is the rbm a last exon region; the green part is EGFP sequence; the red underlined part is the degradation subsequence; the orange moiety is rbm a 3' untranslated region; the gold underlined part is zpc promoter sequence; In the form of a Kozak sequence, For FLAG sequence, the purple underlined portion is the tir1 sequence and the blue italic portion is the SV40 poly (A) signal sequence.

ZGrad induces degradation of Rbm24a to produce sterile offspring

Another idea for controlling degradation of Rbm24a is to coexpress zGrad on the basis of Rbm a-gfp KI. zGrad is an artificial E3 ubiquitin ligase targeting GFP fusion protein comprising a GFP targeting nanobody (vhhGFP) and an F-box domain from the zebra fish F-box AND WD REPEAT domain containing b (fbxw b) gene, co-expression of GFP fusion protein and zGrad in zebra fish would trigger ubiquitination degradation of GFP fusion protein (FIG. 4a, eLife,2019, 10.7554). Therefore, injection of zGrad mRNA (100 pg/embryo) into fertilized eggs of Rbm a-gfp-degron KI homozygous line also effectively depletes Rbm24a protein, producing sterile effects. For scale-up purposes, a Tg (ef1α: zGrad) transgenic fish can be constructed, and the homozygous male fish of this strain mated with the homozygous female fish of rbm a-gfp-degron KI, the resulting offspring of which will be sterile (fig. 4 b). This approach can eliminate the auxin treatment step, but requires maintenance of both strains. As shown in FIG. 4c, the expression of PGC marker gene nano 3 completely disappeared in embryos injected with zGrad mRNA at 6 and 24hpf, indicating the effectiveness of this strategy.

Among them, the sequence information of pCS2-zGrad plasmid for expressing zGrad mRNA is as follows:

/>

Wherein, The Sp6 promoter sequence, the green part is the F-box sequence, the orange part is the GFP nanobody sequence, the pink part is the SV40 poly (A) signal sequence, the green underlined part is the AmpR sequence, the blue part is the AmpR promoter sequence, and the gold underlined part is the CMV IE94 promoter. /(I)

It should be noted that the above examples are only for illustrating the technical solution of the present invention and are not limiting thereof. Although the present invention has been described in detail with reference to the examples given, those skilled in the art can make modifications and equivalents to the technical solutions of the present invention as required, without departing from the spirit and scope of the technical solutions of the present invention.

Claims (10)

1. Use of targeted Rbm24a for controlling fish fertility.

2. The application of claim 1, wherein the application exhibits: knocking out gene rbm a results in specific loss and sterility of fish germ cells.

3. The use according to claim 1 or 2, wherein the fish comprises economic fish, and fish for use in basic research.

4. A control method for fish fertility, which is characterized by comprising the steps of treating a fish parent Rbm24a protein with auxin to induce degradation; specifically, the control method comprises the following steps:

Knocking in a modified Rbm a fourth exon into a Rbm a gene third intron, and fusing a green fluorescent protein and a degradation subsequence into an endogenous Rbm24a protein; simultaneously, the E3 ubiquitin ligase gene TIR1 responding to auxin is connected beside rbm a gene, and the E3 ubiquitin ligase gene TIR1 is driven by a promoter, so that the TIR1 protein is expressed in eggs and early embryo in a large amount; through passage, a rbm a-gfp-degron KI homozygote strain is bred; and then applying auxin to the early embryo for treatment.

5. The control method according to claim 4, wherein the sequence of sgRNA for performing gene knock-in is shown in SEQ ID NO. 1; the knock-in plasmid is shown as SEQ ID NO. 2;

The auxin is auxin analogue 1-naphthalene potassium acetate, the application concentration is 1-5 mu M, and the treatment time is 1-10 hours.

6. A control method for fish fertility is characterized by comprising the following steps: introducing zGrad mRNA into fertilized eggs produced by rbm a-gfp-degron KI homozygous line to produce sterile offspring fish;

Or constructing Tg (e1α: zGrad) transgenic fish, and mating the homozygous male fish of the strain with the homozygous female fish of rbm a-gfp-degron KI to produce sterile offspring fish.

7. The control method according to claim 6, wherein the plasmid expressing zGrad mRNA is shown as SEQ ID NO. 3.

8. Use of the control method of any one of claims 4-7 in any one or more of the following:

(a) Producing sterile fish in large scale;

(b) And breeding excellent strains of fish and controlling fertility.

9. The use of claim 8, wherein in application (a), the sterile fish comprises a sterile fish embryo;

in said application (b), controlling fertility is embodied in controlling fish infertility.

10. The use of claim 8, wherein the fish comprises economic fish, and fish for use in basic research.