CN118126959A - Proteus mirabilis bacteriophage, composition and kit thereof and application of phage - Google Patents

Proteus mirabilis bacteriophage, composition and kit thereof and application of phage Download PDF

Info

Publication number
CN118126959A
CN118126959A CN202410152406.5A CN202410152406A CN118126959A CN 118126959 A CN118126959 A CN 118126959A CN 202410152406 A CN202410152406 A CN 202410152406A CN 118126959 A CN118126959 A CN 118126959A
Authority
CN
China
Prior art keywords
phage
proteus mirabilis
zdpm
bacteriophage
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202410152406.5A
Other languages
Chinese (zh)
Inventor
丁良
卢晓丽
林鑫
肖逍
何四龙
乔欢
徐旭凌
丛郁
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Phagelux Nanjing Biotechnology Co ltd
Original Assignee
Phagelux Nanjing Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Phagelux Nanjing Biotechnology Co ltd filed Critical Phagelux Nanjing Biotechnology Co ltd
Priority to CN202410152406.5A priority Critical patent/CN118126959A/en
Publication of CN118126959A publication Critical patent/CN118126959A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N33/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic nitrogen compounds
    • A01N33/02—Amines; Quaternary ammonium compounds
    • A01N33/12—Quaternary ammonium compounds
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N59/00—Biocides, pest repellants or attractants, or plant growth regulators containing elements or inorganic compounds
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/40—Viruses, e.g. bacteriophages
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
    • A01P1/00—Disinfectants; Antimicrobial compounds or mixtures thereof
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
    • A01P3/00—Fungicides
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23B—PRESERVING, e.g. BY CANNING, MEAT, FISH, EGGS, FRUIT, VEGETABLES, EDIBLE SEEDS; CHEMICAL RIPENING OF FRUIT OR VEGETABLES; THE PRESERVED, RIPENED, OR CANNED PRODUCTS
    • A23B4/00—General methods for preserving meat, sausages, fish or fish products
    • A23B4/14—Preserving with chemicals not covered by groups A23B4/02 or A23B4/12
    • A23B4/18—Preserving with chemicals not covered by groups A23B4/02 or A23B4/12 in the form of liquids or solids
    • A23B4/20—Organic compounds; Microorganisms; Enzymes
    • A23B4/22—Microorganisms; Enzymes; Antibiotics
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L3/00—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs
    • A23L3/34—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals
    • A23L3/3454—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals in the form of liquids or solids
    • A23L3/3463—Organic compounds; Microorganisms; Enzymes
    • A23L3/3571—Microorganisms; Enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/10011—Details dsDNA Bacteriophages
    • C12N2795/10111—Myoviridae
    • C12N2795/10121—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/10011—Details dsDNA Bacteriophages
    • C12N2795/10111—Myoviridae
    • C12N2795/10131—Uses of virus other than therapeutic or vaccine, e.g. disinfectant
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/10011—Details dsDNA Bacteriophages
    • C12N2795/10111—Myoviridae
    • C12N2795/10132—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Environmental Sciences (AREA)
  • Plant Pathology (AREA)
  • Pest Control & Pesticides (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Dentistry (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Food Science & Technology (AREA)
  • Public Health (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Inorganic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Biomedical Technology (AREA)
  • Nutrition Science (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a Proteus mirabilis bacteriophage, a composition, a kit and application thereof, wherein the Proteus mirabilis bacteriophage is Proteus mirabilis bacteriophage (Proteus mirabilis phage) ZDPM-P1, the preservation number is CCTCC NO: M2022475, and the Proteus mirabilis bacteriophage has a nucleotide sequence shown as SEQ ID No. 1. The phage has broad-spectrum sterilization capability, has wider tolerance range to acid and alkali, particularly has higher tolerance to acid conditions and has certain tolerance to peroxyacetic acid, so that the phage can be used together with part of disinfectants in production and culture, and can maintain higher activity while cracking target bacteria; meanwhile, the phage has good tolerance to high temperature, and can adapt to various application conditions in production.

Description

Proteus mirabilis bacteriophage, composition and kit thereof and application of phage
Technical Field
The invention relates to the technical field of phages, in particular to a Proteus mirabilis phage, a composition, a kit and application thereof.
Background
Proteus is a kind of gram-negative, rod-shaped and aerobic bacteria, and is widely distributed in soil, water sources and animals and plants. Proteus has abundant biodiversity and metabolic activity, and some strains have pathogenicity, and can cause diseases of human beings and animals and plants, for example, escherichia coli (ESCHERICHIA COLI, abbreviated as E.coli) in the genus Escherichia can cause diarrhea and septicemia; the most serious is Proteus mirabilis, which has become one of important pathogenic bacteria of intestinal diseases of animals and plants, and is next to Escherichia coli.
The infection pathway of Proteus mirabilis is mainly transmitted through the intestinal tract, resulting in intestinal infections. The intestinal canal is usually a highly acidic environment, the drug resistance is strong, and the prevention and control difficulty is high. Meanwhile, due to the wide distribution of Proteus mirabilis and more susceptible animal and plant groups, preventive measures are particularly important, such as strengthening the sanitation management of water sources, foods and environments, and the like, labor is involved.
Phages are a class of viruses that specifically parasitize or infect bacteria, which are widely distributed in nature. The virulent phage can be propagated in a sensitive bacterial host, so that the host is finally ruptured and the progeny phage is released, thereby achieving the purpose of destroying the host. In the field of antibiosis, the virulent phage has wide application prospect, and particularly has obvious curative effect in the aspect of treating infection caused by special strains.
The invention patent with the publication number of CN115161288B discloses that the Proteus mirabilis bacteriophage is PMP2 (Proteus mirabilis phage PMP 2), and the preservation number is CCTCC M2021671. The phage has a wider acid-base tolerance range, and particularly has higher acid condition tolerance, so that the phage can pass through gastric acid through oral administration, further reach intestinal tracts, and have a strong lysis effect on Proteus mirabilis in the intestinal tracts; meanwhile, the phage has good tolerance to high temperature, and can adapt to the preparation conditions of various preparations in industrial production. The phage provides a good thought for developing biological bactericides for preventing and controlling Proteus mirabilis pollution.
The prior art solutions described above have the following drawbacks: the patent phage sample is derived from Shandong, so that research and development personnel continue to deeply research and develop and prepare the Proteus mirabilis phage with better acid resistance for improving the source diversity, stability and acid resistance of the Proteus mirabilis phage.
Disclosure of Invention
It is a first object of the present invention to provide a Proteus mirabilis bacteriophage to increase the origin diversity, stability and acid resistance of Proteus mirabilis bacteriophage.
In order to achieve the above purpose, the invention adopts the following technical scheme:
A Proteus mirabilis bacteriophage is Proteus mirabilis bacteriophage (Proteus mirabilis phage) ZDPM-P1, the preservation number is CCTCC NO: M2022475, and the Proteus mirabilis bacteriophage has a nucleotide sequence shown as SEQ ID No. 1.
SEQ ID No.1：
AAGCATTTCTTAAAATACGAAAAACAAAAAATTGGGATAGTTCTTTCTTTCTATATATATATTAAAAAAAAGAAAGTCTTAAATATCTATATATAATAATAATAGATAGATCTCCCCGTATTCTATACTATAGTGCAAGAGTAAAAATGTCAAATCTTTTTGTTGACATGAGAATATATTCTAGTATGATGCATCACATAGAAACGAAATGAGGGTTATGTAAATGAAAGAGGTTATTGTATTTGCGAGAGACGCTATTAACCAAGGTGTGTGGCATCACGACGAAGCGATGCAGTGGTTAAAGAATTATTATTTAAGGAACGTAAAATGAAAACAATTAACTACTACGGAAAAGAAATAGAAGTTACTGATTATGCAAAGTATGTGGCTACGGATGATAATGGCGAAATGTGGTGGTATTCCAGCTGTCCGAGATTAGAGCGTGTGTCATGGCGTGGCGGACTTAATTGCGGACCCGTTGGAAATAACCCGAACGTTAAAAACTGGAGAGGGAGTTTAAGAAAATGCTAAAAGTTAAATTATTAAACGATGGTGGTTACGGTGCTATGGCAAGCGTTAAATTCCCGGTCGTTGTTGATGGGTTTTATGACGGAGTTGGCATCAGTATCCTTGGCGGTGAATTGATTAAATTAGGTGCTGAGTTTATTGATAAGGATGAGGATTATTACTTTTCCCTACTATCAGATGAATGCGAGGTTATTGATGAAAAATAAAAATGAAGGTAAAAAGAATATCCAGATTGACGATGATGTTTATTTAAAGCTAAAAGAATTGTCAGTTAAAGTCGGTATGCCAATGCGTCATTATTTGCAGGAGATTATCAATGAAAAAGTTAATGGTTAGTGTAGGATTGCTGTTATCATTCAGTGCAAACGCGGTAGATTTCTATGAGTGTAAAGCTAGAATGGAGAATCTATCTAATGGGCAAGTTATTTCAGTTGATAGATATATTGCTAACGTCGTTGTGTCAGATGATATTATCCTTTACTCATCAGCACCAGGTGCGCCGTTCGATAAATGCGAAGTCACAAAGAAAAGAGACGGTCAATATATCAATGAATATAAGAAGTGCTTCTTTGATGAGAATATGAAGATTATGTTTTTCGTTGAAGGGATGAATGTTTTTGATTTGCACAGCTGTAAAAAAACCCACTAAGAAAAATTCAAAGTGGGTTAAAACAAAGAGGAGAAAGTAAAATGAACAAAGAGATGTTAACAAAGGAAGATATCATTGTCAACATAGAGGCGGTGTGTGGAGACATGGTTCTTGTATTTGATAAGAATTATCACCCCATCTGGATGAAAGAGGAAGAGTATGACCGTATTATTGAGATGCATTAAAGGTGGTGATTTAGCTGATAGGTTCACGTTTGTTCAGCAGTACGAATTAAGGTCAGGGTTCTTGACTGATAATTATGGTATGCGTTGGTTATTCCGTGGGTTTGATGATAATTACGAATTCGAGGTGATGAAGTGAAAATAACAATTCCTTATAAATATATTAAATCGGCAGATATTTTCCGTGATGAGAAAGACGTGCGTACATTCTGCAAGGGTTTCGTTATTAATGATGGTAAGTTAATAACAACAAATGGGCATTACTTATTTATTGCTGATATTGAAAGCGGTGAAACACAGCTAATGTTTAATTTCATTGGTAAGATACCAACCGGTGCTGATATTGTGGAAATTGACTTCACGGAGAAGTTGGCAACATTTGCAAGCGAAAAGAAAGGCACGGTCGCACAGATGGGGGTTGAGATTTTAAGCGGAAGGGTGTTTGACTACAAGCGTGTGACGGACTCATTTGAATCAAAACCTGTTGATGAAATTGGATTCCAGCACAAATACCTCAATGACATTTCTAAAGCCGGTAAAGCTGTTGGCGTCGACGCGATAAAATTAGAGTTCGGCGGCGCCATTGGCTGCTCGCGAGTTGTGCTAGACAAGCATTGCTCAGTCTACCTTATGCCTTGCCGTATTTAATGCTATAATTCCCCGTGACATTAAATTATTTTAACTCACGGGGATTCTACATTGTGTCAGAAGAGCATTTATTAAAGGAGTTTGCACCTGCAATTATAGGTATTATCATGGCTTTTTCTGTCGCAACTGTGCGAGAGCGAAGGGCGGGTAACACTATGAAGAAATCAATCGGTGAAGGATTTATTTGCGCTAGTTTATCATTAGGTGTGATAACTATCTTAGAGAAGATAGGGTTAGACCAATCTTATTCGCAGTTCTTTGGTGTGCTAATTGGATTCATTGGAACAACTAAGTTATCCGATTTAGCATATAATGTATTAGATTTATTTATTCGTAGAGGTAAATGATATGGGGTTTAAATTTAGTTCACGTAGTCAATCAAAACTGGATGGCGTTAATGAACCACTGGTTCGACTTGTTCATCGCGCATTAGAAATTAGTGAAGCTGATTTTGCGATTATTGAGGGGTTGCGTAGCATTGAGAAACAGCAGGAAAACGTGCGTAAAGGTGTTAGTCAGACAATGAAAAGTAAGCACCTAACAGGCGATGCTATTGATGTCCTACCTTCCTCTATTAAGCCCGGCATGAAATGGGAATTACATCATTTTAAACCAGTTTTAAATGCATTCTATCGCGCTAGTGTAGAATTAGGTATTCCATTGCGTTTTGGTATCAACTGGAAAAATGACCCTTCACTGCCTATCGAGACTAAATTCATTGATGCGCCTCATATCGAGCTTGTTTAATATGTTAGATACTAAGACCGTGATAATTATACTCGGTCTTTTCTTTAGCGGTTATTACTTTGGAATTAAATCCAATGAGGATAGCGAAAATGACCGTAGGAAGTTAGCGCAAAATATTGCCCAGAAGGTACAAGAAGATGTTAGTAAGTGGAAACAAAACATTAAGACAGTTAACAAGGTTGAGCCTATCTATCTTAATGAGTGCGTCACTGATGACTATCGCAGGGTGTTCAATGAAAACCAACGCATGTTATCAGGCAAACCTGTGTCAAAAGTGTCAGGTAAATAATTTGCCAGAGCTGAAAGATAATACAGGTTTATCTTTATCTAATATGTTGGACTGGTATCAAAAGGCGTACGGTGAGTGCGCTAAAAATCATAATGGTTTAGTGGAGAGTTTACGATGATTCGTGATATACTAAGGTGCGTAACGACAGTTGTTATTGCTTATTTGATATTCCTGTACGGTACGGAGCAAATACAACAGCAGAAACGCGAAACGATTGCCTCTGTGGTAATGGCAGATAAAGATCCGATTAAAGTAGTTTGCGCGGTTGATGGGACGGTGTTAGCATCTCGTAAAATGTGTATTGAATCAGCTAAGCAGAGTTTAGGGGGGAGTAAATAATGGCGCACTTATGGGAAATAGGGGCAAGCAGGATTGGCAAGCCACCTTGCTTTAATAGCCCAGAAGAAATGCTAGAGCGCGCAATCGAATACTTCAAATGGTGTGAAGAAAATCCGCTTGATGAGCATAAAATCTTTGCGCAGCAGGGTATGATTATTGATGGTGAAGTAAAGCACAAGCGACCATATACGCAGGCTGGCCTATGTGTATACCTTGGTATTTCAGAGGATACATGGCGCAATTATCGGGATAAAAAACCAGCTTATTTCGAGGTCACAAAGTTAATCACTGATGCCATGTATGACCAGAAATTCGCTGGCGCCTCAGCGGGTATTTTTAATGCCAACATCATTGCCAGAGATTTAGGGTTAAAAGACAAGTCTGAAATCGACCATCAATCAAGCGATGGTAGCATGACTCCGAAAGCAACTAGCGATGCGGTGTTAGATATTCTAAAGAAGAAACATGCTGAGTAATCAACAGAAAGCGGATTGCATGTCCGACTTTTACACATTCACGCAAACGATGTTCTTGGCAAGAAAAGGCGTAGAGATGCGCCTTAACTTTCACCAAAAGCTAATCTGCGAAGCATTGGAAAAGGTTGTCCTTGGTAAAACAAAGAGATTAATTATTAACATCCCACCACGCTCAGGTAAGACGGAAATATCGGTGTTAAACTTTGTGGCATGGGCAACTGGGTTGTTCCCAGATTCCGAATGGATACATGTCTCCTACTCAAAAAGACTAGCTTCAAACAATACATACGGAATACGCGAAATAATGAGGAATGAAGCATATAAGGAGATATTCCCATACGTAGAAATAAAATCAGATAGTGACGCCAAGGATGAGTTTAGGACAAATTACGGCGGTATCATTTACGCGACCGGCTCGGATGGTAGTATCACAGGGCGAGGAGCTGGTGGTATGTCTGGAAGATTTCAAGGTGGAATCATAATTGATGACCCACATAAGCCAGGTGAAGCAAATAGCGAACTGGTGAGAAGTGGGGTGTTAAACTGGTTCCAAGAGACATTAGAAAGCCGTAAAAACAACCCTAATACACCAATTATTGTTATTATGCAGAGGCTTCACGAGGAGGACTTGGCTGGATGGCTCATTAATGGTGGCAATGGCGAAGAGTGGGAAACTTTAGTTGTTCCAGCTATAAATGAAGATGGTACATCTTTTTGGGAGCGTCAATTTCCACTTGAAATGCTTGAGCGTCTTGAACGAACAAACCCTTACGTGTTCGCAGGACAATACTTGCAGTTACCAGCACCTAAAGATGGTGGAACATTTAAGCCAGCTAACATTCAAATCATTGATGCCCTACCACACGGTATTAAATGGATTAGAGGTTGGGATTTAGCTTCAACCGTTAAGAAAACGAGCGACTATACGTCAAGCACCAAGATAGGTATCAAGGATGGTGTAACCTATATTGCAGAGGTTCATAGATTTAAGGGAACCCCTGATGAGGTTGAGAATACCATTACACAAAAAGCTAACCTCGATGGTAGGGATGTTTTAATTAGTTTACCGCAAGACCCTGGTCAGGCTGGCGTATATCAAAAGAATGCATTAAGTCGAGCGCTATCTGGCTACACATTTGAATTCACGCCAGAGAGTGGGGATAAACAAACACGCGCATCGCCATTTGCGTCGCAGGTAAACGTAGGTAACGTGAAGATGTTGCGTGGAGAATGGAATGATGAGTTTATTAAAGAGATGCAGATGTTCCCAAATGGTAAACATGATGATATGATAGACTCCACCTCAAGAGCGTACAATAAAGCGTCAAGCAAACCTTTATCTGCGTTTGATGTTTTGTTTTAGTAAAAACAAACCCGCCTAATCGCGGGTTTTTGTCATTAGTGGAAAAACAATAAACATTAATACTGTTGTCACGATAGTACAATAAATAGAAACTACATCACCAAATTTATCTTGTATATACAATGCGCTTAATATATACATAAACATTATCAATAATACGGTTATAAATAATTTCAACTCCTTACCTCCACATCCTTTAACTCAATCCAGTGGGCGATATTGCTATCAATAGGCTGGACTTTAATCTCAACTCCGTCAGTCTCTATGACGTATGCTAACTGACCTGTCTCTTTAATCATTACTAGTTTCATTTACAACTCCAAAAAACAAAGCATCGCGGCGACGAGTGGTTTTTTGTGAGATACGTATTCACCATAATCAAATAGTGCTGAGTACTCGCAGTACAAATCAGAAAAAGCATCATAAAGCCCATTATCACCACGTGTAACACAGATATTATACTTCATCATAATTTCCCAGGCTTGCTCTACGTTGTTGCACGGGTCGAAAGATTTAGTGTAGATGTAACCAAGTTTCTCGGAAACGGCTTTATTAATTTCAAATTCAGTCATTATTGTTCTCCGCTCCACTATCACCTATATAAAACGGCAATCCATCTGCCTCCATTGGCTTTATATCAGTAAACGCGCAAGGAAGAATTATTCCACCGAACTCCTGAGCAAACATTAACGCCTGCTTTGCCTGAAGAGAGACATATTGCTTAGGTAGAGCTATTTGATACGTAACACCGTCAATTAATACTAACGTCGTCATCGCTTGAACTTGTCTCATTGATTATTCTCCGTAAAATCATTCATCATTAAAAATACTTCCATGGCGGCGCGTAGTGGGTTACTGTTAATAGAACCAAATGGAACACCCCACACAGTTTCGGCCATCCAGTTTCCTTCATATCTATTTCTTAGTGAAATTCTATTCTCAATAATAATCGGCATTGCGTCTGATGGGTTATTGCATGGGTCGAAAGGCGTTGCATCCATATCATCAAACAAAACTATTTCAGTGTGTTCGTATGCAATTGTGTTTAATTTAAGACTCTCAGCAACCTTTTTATTAACTTCGAAGTCAGATAGTTCGGTGTAGTTATTCATGGTTATCTCCAATATAAATATGTTCCATATACACTTTAGTTAATTGGGTTGGTAAACAGGTTTCAGATATTGACTTCAAGGCTTTCTCTTTATCCTGTGGGTCAATGTCGTCAACCTTCAATAACGCGTTTATCTTCTCTATTGCTATTTCCACATTCATTCCATCATTCCATCATTTCCGCAATTGCTTTATAAGCATCTTTCACTGATTTTGTGATGTTATTGTTTTTCATGATTTCTAAACGTTGTTCTACTGTTAGATATCCGTGCCAAATATCAGCCGCAATTTCTAGGTCGCCCGCCACGTATCCGAATTTGTTATTGGTTTTCACGACTTCATTTTTAGCGTTTTGAATTAAAGTTTTCATAACTTATCTCCTCATTTGTTTGTGTGATATCATACTATCTATAATGTATAGGTCAAGGAATATATCCAATGATTTTAAATGATTCACTGGCATCGCTAACAACCTCGCTAGGCGAGCAAGTTAAGAAGATGTCATATAGAGACACTAAGCCATTACGCACTAAAGAGCTTGATGCAATGTTTAGTGGTAGCTTCATCTCCAAGAAATACATCACCAAGACAGTGGCTGATATGCTTAAGTTACCCCGCGAATTTGAAGGTGATGTGAAAGAAGATGACATTGCACGTCAGTTCGAGTTCGATAAGGTTCGTAAGTATGCTTTAACATGGTCATCTCTCTATGGTGATGCTTTAGTGGTTGCTGTTACAGATGGTGATATTGAAGCTTTTGAAAATCCGTTAAGTGAAAGTGAATCAGTGGTCAGATTTATTACGTTAGCTCGTGAAGAATACTCACCAAGTTCTGACGTTGATGACGACATTAAGTCACCTAACTTTGGTCAGCCACTTTACTATGAGTTAAAGATTGGTAAAGGTAATCGCATTCATCACACTAGGTGCCACCGGATACGTTTGGGTGAGAGAAGAATTTCTGACAAACAAAAGTATGGTGTATCTGACCTACAAGCACCTTATCAAGCCATTAAAATTTTTGAGTCTGCCGTCGTATCTATTGGTGATATTATTAAAGACTCAAATATCAAAGTTATTGGTATGCAGGAGTTATTCCAAAAGCTAGCGAACGGTCAATGTGACCTAGTGTCAACCTATGGTTACATGATGAAGGAGCAGATGTCTAGCTCTGGCCTGGTAATGATTGATAACCAAGATAGCTTCACGCAGGTTCAAGCTAACTATTCAGGTTTGTCAGAAGTAGTTGATAAAATGCTTACTGTGTTAGCTGGAGCATTGGATAGACCTATCACTGTGTTATTTGGTCAATCAGCTTCCGGATTCGCATCAGGTGAAGAAGATAACAACGCATACTATGAGACTATTAATGGTCTACAAGAATCTCGCCTACGTCCGTTACAAGAGTTTTTAGACTCATTCTTTCCTGAGCTAGCTGATGCTGTTTACAACTATCCATCTATTGATAGTGTTAACGAAAAGCAAAGCAGTGAAATTATGACAGCGGTAACTACTGCTGTGTCAACATTGGTTATGAATGATACTATTACCGATAAGCAAGCAATGGATGAATTGCAGAAGTGGGGTTTCTTTACGGGGGTTAAGTTAGATGAAGCAGAAGCAGAAGAAGAAACAGAAGAAGATGAGAGTTATCCAGCCTTCGAAACGTACGGAGGTTTGGTATAGAGAGCAGTTAGAATTACTGGTAAAGCAACTCAAGGAAGAGGCTTTATCTGCATTCAGAGTTAACAATGATTCAATGTCAGATGCGCAACGTAAGTTATCACTGGCTACTGAGCGCATGATGAATATACCAGTATTTGGATTTGCTAAGCGTGTGTCTGAAATGTTTGTGAGACGCATAAACAAGACTCAATACCAGCGCATGTCAGACGAATACAAAACTCGTTTCGGAATTGATATTGCGCCAAAGGTTGATGAAGAATTACTGCAGGAGATGATAGAGGCTAACGTTAACCTGATTACATCTATCAAGACTGACTTTATATCTCAGGTTGGTGATGAAGTGCGTAAGCAGTTATTCGAAGGTGAGCGATCCACTGGTTTGATTCAGATTATCCATGAGCGAGGCAATGTGACAATGAATAGAGCTAAGTTTATTGCACGTGACCAAACTGCAAAGTTGAATTCTGCTATCACTCGTGAACGCAATGATAAGTTGGGCATTAAAACCTACGTCTGGACTGGAGCAAGAGATGTTAGACAACGTAAAGACCACAAGGTGATGAATGGTAAGCTATGTAGATTTGATGATCCAACGGTATATTCTGATGATAATGGCGAGACTTGGAAGAAGCGCAGGTCGATAGGTGGGGTTGAATTACATCCGGGTGAGGATTACAATTGCCGATGTGGAATGGCGCCTAGATTGGATTGGGATTAAAATAAAAAGCCCCGTTATGGGGCTTCACTCTTATTCTTTGCGCTTGAAATTTTGTAGGAAGTCGCTGTAGCTACTAGTGCTTCTGTAAGTCATGCCACCTACTTTAAACATAAATACAATGGTATCTTCATTTGATTGCACGTTGATAATAACTTCCACCCCCTCCTTACTAACCCAAACTTGACCAACCTGAATTTTAGGTTCTTGTGGTTTTAGGCGGTATTCGAAACACGCATACATAGCTTCATGTTCTGATGTTTTCCATTCTCCATCTAATAACACCTCAAAACTCTCCCAAGGCTTATCGTCGTATTGCGCAATCATTGCATATTTCAACATTAAGTCGGCGTGCGGGTGTGATTTTTCTTCTTCTACCATTTCAAATACTCCATTTCCGTTATTTAATGAAGAGTGGTAACATGTTGCACTCCATTCACTTTCACTGCACAACATTCCACCTTCATACCAAGCTTTATATATTTTACCAACTTCAAACCATGGGTTTCTTTTATTGTCTATGCATTTAATTTTCATTATTTTATCTCCACGTTGTTTTGAATTGTACATTTCTCAAACTCGCCGTAAGTCTCGTAAAACTCACCAGCTAGTGTTGAATGCCATCCATTATACTTTCCAGTGGTTGCCATTTTAGCATTTCGGTTAGCATCTTCACCACTCAGGATGATTCCTTCTTTTTTATCCTCATTCCAAACAATTGTGTAATACATCTTAATTTCCTCATTTGCGTTCAGTGAGTGCATGGTATTCCTTATTTATACCAAATGCAAGTGTTTGCATGCTTAAATTTTAGTGGGTATAATAAGTGCATGATTTGAAAGAGAAATAACACGATTTTTTAAGAATTTAAGCATTTACTTAAACAGCGTTTCTTAAAAAATAAAGTCTATAAATACTTTTAAATCATAGTGTTACAATAATTATGAAAATATAGCTTAAAAACGGTGTTAAAAATAAAAAATTTTACGCAAAACAAGAAATGCGTAAATAATTTTAGAATAAACCGTTTTTAGTTTATTTCTTAAAACAGCAATAAAACATATATAATTCAAAGATTTATTTTTAACACACCCCTGTTAAATCAATGCTTAAAAATTTTACCGCTTCGAAATAAGAAGCGGGGATAGGTATTAGTATTAGTATGTATTATAGATATTTAAGACTTTTCTTTTTTTTATATATAATATATATAATAATAGTATCCCAACTTACATTATCCACAGCTAAAACATCTTGTCAAATAATGCCGTAAAATAATGCTTGCTATAATCAAATTAATGATTATAATCATTACGAATCTAAACAAATAGGAATGTAAGAAATGAGAGATTTAACTACGGGCGAACTAAGAACTATAAATTTTCTACTCGGTGATATTAGTGATTTAACCCCAAACCAAAAGATCGATGTTATCAACTGGTATAGAGGTGGAGAAAACTCAGAAATGACATATAGGTTAAAAGAAAAGATATTAAAAGTGCTGGAGAGGGAGGGTAAATCTACAGTAGCTGTAATTAGAAACAGGACGAGGAATAAATATAGCGAAAAGCAAGTTGTAGATGCTTTCGAGTCACTAGTTGCTGATGATTTGTTAGTTAAGTTTATTTCAGCTAATGGCGTTGATAGCTGGAGATTAAAATGAACAATAAACTATCCATACTGTTTCCTGAATTAACCGTGGAGCAATTAAATGATTTATCCGACTGGTTGTCTGCTCCAACAGAGAAAACCTTGTCAGATAGAATCTACGGAGTTATAGAGCGTAAGAAGAATGCCACGTTGAAAGTTATCAATAATTCATTAAGAATAGATAACCCAGTGGCGGTAATCACAGAAATTAGAAAATTACTTGCAAATGGTAAGATTGAAAGATACAGTCTAAGCAAATTAAAAACAGCGTATAGGATTAAGAAATGAAATTTAAATTACACGATATCGTAACACTAAAAAGCTATGCAAATGACGACATGCCAATGGTTGTAATTTCAAAGGGAATAAATTTCACAGACTGGGTTCTTTTGTCTGGTAATTTATTAATTGATGCCGATGAAAAGGATATGTGCGGTTGGCATGACAGGTTTTTCTATAAGACAGAAGAAGTTAAGTTAAATAAAAAGAAATCAATTAAAAATTTATGGGGTTTATTATGAAGTTTAAAATAGGACAGGAAGTTATGATAATCAGTGGCGCTATGGATGGAAGAAAAGCTACGGTGTTATCACACAAGCCTTCTAAAATGTTTCCAGCAATGAAGTGGTATGAAGTAGAAATTAAAGATATGTTTGATAGAATTTCTTATTTAGAATGCGAACTGGATTACTTGCAATGAATACAGAAGAACTAATGATTAAATGCGTGGTGGAAGGTAGAGGGTTCCCGGGATTATTTTCAATTAAGAACTTACAGTCAGTGGTAGGTGAGCCTGAATGCCAATTAAAGTATGCGGTTAATAAACTTTTAGCTATTCGAGCATTTAAGAAGATGGAGCAGACACGTAGAGGTGCTATGTATGCTGTTTCAGAGGGTGCAATACAAAAGGTAAAGCTTTATATTAACGCTAACAAAGAAACTGACACAATGCCACAGGTTGACGATTTAGGTGATGGTTTAGTGTGGGTAAAGAAAGCTAATGTAGAAGGTATGGGTAACTCATTGTTAAAACGTTTTGATAAATTACTAAGTGGAGTTAGATAAAATGACACCAGAAGAAAGACTAAAGAAACTTGACGAGAAATTGGATGAAGCGCATTCATTGGTTGGCTATCTTATGGAATGCCGACGTGAGTTGATTAACCGTTACAATTTAAATAAGAAGGGAAAATAAAATGAATAAATCAAGAAAACAATTTGAAGAGCTTGCAGTAGAAGAAGGATTATCACTGGAGGTATTTAACGGTGATTATAATTGGATGAACACGCGGATAGCATGGAAATTTTGGCAAGCATCACGCGAGAGTTTGGAGATTGAGTTGCCTCGCAAACACGATGTGGATGATGAGTATGATTATTTCGCAATGGGTTATAATTTAGCGTTAAATAAAATTCATGATTTATTGGTTGACAACGGAGTGAAAGTAAAATGATTACAGGTGAGCATATTATCGAATTTGTAGGTATTGATAGTGAAGGGATGGAGACTGCTAAAGGTAATTCAGTTATTGAGAATATTGAATTTGATAATGCGGTTGACTTTTACAATACAGTGATAAACAGTATTATTAATGACTACCCTATTCTTTCAAGTGTGAGAATTGTAGGAGTATTTAAATTATGAATCTTCTAGTTGGAGCTATCTTGATTGCCATTGCTACTTTTATTGTTTCGTATTTTCAATCTATGATGAAAGAAGTTGAAGAGAAATGGTCTGAGTGGGTTTTTGTTTTGATTAACTTTATATTGGTTGTGTTGTCTGTCAAGTCATTTATGTAGTTGTTGCTATCTATGCTATAATCCCTGTTAACTATTAACGGGGATTTTTTATTTATGAAATTCGAAAAAACTGAGCAGGGGTATTTGAAGGTTCCTGCAAAGATTGCCAGAACTGGAGAGCTTGAATATCTTGCGTCCGAACTAGGAATGAAAGGCGATGATATCATTAAGGTGTATCGTGATAAGGATGAGTTATTCAAAGATGAAGTGATGGATTCTTTTGAGGGTATGCCAATCACTATTGAGCATCCAGAAGGGATGATGGTTGATTCCTACACGTGGGAAGATTCCAGCGTTGGTCATATACAAAATGTTCGTGCGGAGGGTGAGTTTTTAGTTTGTGATGCCTATATTCAAAGCGCGAAGGCTATCGAAGAGATAGAAAAGAATGATATACTAGAGTTATCCTGTGGCTATGATGCTGACCTGTCATTTGATAAAGACGGTAAGGTGTGGCAAAATAATATCCGTGGTAATCATGTTGCAGTTGTTCCATTCGGGCGCTGTGGCTCATCTTGCAAGTTGGGTGATTCTAACGAGGTAATAATGAAATCAAAAGTTAAATTCGGTGACTCAATCAAAGCGATTGCCGAAAAGCTAAAAAACCTAAAGCTGAATGATGATGCTTTAGATGAGGCAGATAAGAAGACGGATGAAGTTGCAACTCAAATTGATGAGATTGTAACAGCTCTGGAAGAAGTGCAAGCAACTGCTGAAGAAGCTAGTGAAGCAACAGAAGTTGCTAACAAGGAGAAAGAAGAAACTCCGGTTAACGATGATGAAGAAACGGAAACGTTGCGCGCTCGCGTAGCTGAGCTTGAAGCTGAAGTAGAAGAGTTAAAAGCAGAAATTGCTAAGCTGAAAGGTGAAGAAGAAAACCGCATGACAGCAAATGATGCGATGGCACGTTTCCCCACTATTAAGTTTGGTGATTGTAAGTCTGCTCGAGAAGTTAAAGAAAAAGCTTTAGTGGCTAAGAAAGTGTTTGACGCCAATACTGTCAAAACTTTGAATGATTCTGCTATCGATGGTGCTTACACTGCTTTACAGGTAAACAACCCTGTTCGCACACTGCAAGCTGGTTCTGTATTCTTAAGTGATAGCAAAGCTAAAAAAGTTAACGTAAATACTGCATTTGGCCGTAAGGGGTAATTAAATGTATACTAATTTCGAATCAAAACCAGTTGGCTATGCAGGCCAGATTGCCCGTGGTGACCAATCTTTAAGTAAAGCGTGGCCTAAAACAAACACTGGGGATACAGATATCCCAGCTGGCGTATTCGTTGCTAATGATGATGCATTTGAAGGCGTTGTAGCCATTAAGTCAGCAGAAGATAAGGTGGCCGGTATTGTTATTCGCCCTTCATTATTCCCTGTTGTGCACCCGGGTAAGAAAGCTGATATCATGCATATCAATACAGGTGATTCAATCTGGGCACAAGTTGCAGAAGGTGATTCATTAAAAGCGGGTGATGATGTAGCTATTGTTGCAACAGGTGATAACGCCGGCATGGTAACAGCTACAGCGGAAGGCAATATCGCCACTAATTATACTGTCGTTCGAGTTTCTGGCGACGTTGCAGAAATTACACGTAAGGAAGTTTAAAGATGGCGGATTTAAATACCGATTTAGCACTGGATATGCTGGAACAAGGTCTTGCTGAGTATGATAACAATATTCAGGAAAAGACATTTCCAGAGATTGTCATTGGTGATTTTGTAGATATTAAGCAAATCTCAGATAAAGGTTTAACAGAAAACATCTACGGCGTTTTAGATGCGCGTGGCGGTCTTGAAGATGGTATTATCGGTAGTAAAACCACTTCATTAGTGACTACTGATGTTAGCGTGACTATGGATAAGTCCGCACTGGTATCATGGGCTAAATCCACCCAGTGGACTATCGAAGAGTTAGCTCAAGCATCTCGACTAGGTTTATCTCTTGACACTACCAAGTTGGATGTGATGTTGAAGAACGCACATCAAACCATTCAGCGTAACGGTTTTGTTGGGCATCGTGTTGAGGGTTTAACTGGTTTACTAAATTCATCTAAAGTTGAAGTTGAAACTGGTGTTACTACAACAAAACCTGTTAAAGATATGACTCCAGAGGAAGCTTTGTCGTTCTTTACTGAGTTGTTTGTTGCAGGTCTTGAGCGTACCGGTGGTCAGATGATGCCTTCGGATTTAGCAATTGATTCATTTGATTTAGCATACTTGACAGCTAAGTCTGCAGGTTATCGTAATAATGATGGTATGTTTATTTCCACATTATCGGTGCTACAAGACCAGTTATCAACAGTGGCAGGTCACGCTGTTAATATCCGAGCTATCCCTAACAAGTATGCGCAAGGTATTGCGGACGCTAAGAAAAACCGCGCTGTAATCTATACTCGTGACCCATCAATCCTTGAATACCCAGTGATGATGCCTGAGACAATTGCGCCAGAGAAGTTTAATCTGATTGCATTCCAAGCTGGTATGTATTGCCGATTCGGTAGTGTCGACATTAAAGACCCGTCAATGATTGCTTATGTTGATTACCCAAATTCAGCAAAGTAAAAGCGGGCGGTTATCCAAGCGGAAATAACTTTCCCGCAGATACCAACTATCCGCAATAAAAAAAGCCCCTTAATTGGGGCTTTTTTGTTATTTAGGGTACAATATAGAGACATTCACAACAGAGGATATAAAAATGGCTTACATTCCAACTAACTGGGAAAATTCACCATCAACCAACACGCCATTAAACGCTGATAACCTGAACAAATTAGAGCAAGGGGTAAAAGCTTTACATGATGCACTCGATAGCGGTGAGCTAAAAGGTGAAAAAGGCGATATTGGTCCGCAAGGTCCACAAGGTCCAGCAGGCAAAGACGGTGCGCAAGGACCGAAAGGAGACCCTGGCGTTTTCGACGTTGAAAACCTGACAGAAGACGACATCACTGCATTAAAACTTAAATTAGGTATTGTCTGATGGATAAATTCAAAACAAGATACCCTGAATTTACTGATGTTCCAGATGGTGTGCTAAATGTCACTATGGAAGATGCACGGATGGATTTATGTAAAAAGATATGGGGTAAATATTATGAGCGTGGATGGATGGCGCTAACTGCGCACAACCTGTGGTTAAAAGGATATCTTGATGATTTGGATGACGATGGCAATCCAATGTCAGATGGCGGTGCTAAGCGCTCGGTATCGTCACGCACAGCCGGCTCATTATCAATAAGCTACGGTGGATCCACCCGTGATGGGTTCGGCAATGGCAATACTTACGGTTACGAGGAATCAATTTACGGGCGTGAGTATTTGCGTTTGCTATATATGGTAACTCCTGGATGGGTGGTGATACGATGATTCAGCATTCTAGAATTATTAGTGAAATGACTGATATTGAATCTGAATTAAAGGAGATGAAAAAGAAGATAGAATTATACAATAAAAAAGACGTAATGATTGGTGTTACCGGTACAACTAATGGGGAGCGCGGAAACGCGTTTCTCATGGCTATTCATGAATACGGAACACAAGATGGTAGAATACCTGAGCGTAGACCAATCAGGTTAACGATGGAAAACAATCAGGAGAAATACGCACGTAGATTACAGCAAGGTATAGATAAGGTGTTAGTGAATGAAATGGATATTATGACAGCACTTAACTCAATCGGCGAAGAAGTTGCTGGTGATGTCAAAATTACTATCATGAATGGCTTGACACCACCTTTAGCTGATAGTACAGTGCGTGCAAGAAAAGATAACTCCGATACGCCTCTGTATGATACTGGCGAATTAGTTAACTCAATTACTCATGATGTGAGGGATAAATGATTGTTAAATTGAAGTGTGTTGATAATTTTTACTGCAATTTACTTACTAGCGGTAAAATTTATAATGGAATTAAGGATGAAAAAGGACTATTTGCTGTTGTGGGCGATGATGGCGGTTTGCTTTGCGACTCACTTGAGCCAAAAGATATGTTATTTGCGATTTGGGAGATTGTAAATTAAATGGAACTTATAGATAGAGCGCAGGAAGAAGTTGAGCGCCAACTTGAACGTAGTTTACAATTAGCTAGAAATCAAAATGTTAAGTATCATGCTATTGGTCATTGCTTGAATTGTGAAGAACCACTTGCGGATGGTGTACGGTGGTGTGATGCAGATTGTCGTGACGATTTCCTGAGATGGGAGAGTAGGGATAAGTAACAATGACAAGAAGAGAGAAAGTAATTGAACTAAGAAAACAAGGTAAGAAGTACAGGGAAATACAGGAAGAATTAGATATTAGTCAGTGCTCAATAAGTAAAATATTAAAAAAGGCAGGATTACACATAAAGAAGGGTAACGACGAATACTTAGAAATGTTAAATATGGCAATGGATGGCGTTCCTTCTGCTGAAATAGCTAACAAATTTAATCTTGCACCGGTAACAGTAAGAGGAATATTGAGTAGACATAAAGTTAAAATAGGTGATGCTAAAGCGAAGATTAGAGAGGAGATAATACAGTTATCCGAAAAATTCTCGTCAACAGAAACTGCTGATATTCTTGGTGTTAGGGTTAGCTACGTCCGCAATGTCAGGTGGAAACATGGAATAAAACTTAATGAGAGTTATTATAGGAAAGTTAGGGCTATAGAGATGATGGAGAATGGTTTATCCATTGATGAAATAGCTGAGAAATTAAATCTACACTATGAAACTGTTGTGAGGTATTACAAATGAATAATTATTTTAGTGTTAATGAATTGCTTCCTGATGAGTTCAGTGAGGTGCTAACTAAGTGTAAAGGTGCAAATGTCAAAGCAATCTACTTCAAGGATGAGTTGGGTAAAGATGTGTTTTTAGCTGTTTCTAATGGCAGTTTTAGGAAATTAAACAACGTAACGGAGTGGAGGTACTACAAATGAATAATCAAGAAAAGACTTTCTGGTTAGGGATGTCACTTGGTATTGTGCTAGGTGGTATTATTTGTAAGTTTATGGAGGTGGTATTGTGAGTAATAGACACTTCAACCCAATATTTAAAGACCCTTATTTCAGACAAAAAGTTAAATTCTCTTTGAATATTAAAGAGACTAATGATTTTGGTCAGCCAGAACTATCCACAGAAGATGTTACTTTGACCTCTATTGTTTACCCATCTACCCCTGATGAATTATCTATTTTACCAGAGGGTGAGCGCCACAAATCAGCGTATACCGTATTTACAAAGCGTCAGGTATCGCACGGTGACTATATGTTCTATAATGGCATTAGATATAAACTAATGACTATGGAAGCATGGAATCACTATGGCTATTATGCAAGTTTGGCAATTAGATATGACGGCACTGAGGCAGACGATAGCGAAGGTTTTGAGCCTCCCTCCATCTAAAATCCTCGATGGTGAAACATCTAACAATGTAACTACTAAAGCGCCTTATGTTGTTGTCCGATTGGTTTCGACAAAAGAACATGGCGCTTCCTCTATTTTCGATGGTGACAAAGAAACTGAAACCATCACTGTGTCATGTACATCGGTTATTTCTGTTAATTTCTACGGAAATAATTCTAGGTCTATGGCATTATTCGCCAAATCATCTTTTCGCACTCAAACGTCTGTTCAGCTATTTAACAAGATTGGGGTTAGTGTGTTACAATGCACTGACAGCCTTTCTTTGCCTACATCTCTAAATTCCGGGCTGGAGCAAAGAGCGCAGTTTGATATGACTATCGGTCATAACCAGATTGTCGTAAACGGCATCAATCGGATTGACGAACAACCAATTATTTTTGAGGTTAACCAATGAGTTTATCAATTAGTGAAGTTGTAGACGTACAACTTACAGAACAGGCTATGGGGGCTTCTCGTAGAGATTTCTCACTATGCTTGATTCTAACACCTGAAAAAGGAACGGCGTTTAATAATGCCGATGAGCGTTATTTTTACGCTTCAAACGCTGACCAAGTTGGCTCAGTGTTCGGATTTGGTTCGGATACGCACTTAGCGTCAGTAGCATTTTTTAGCCGCAAACCTAAATTAAAGCAAGTTATTATCGGTCGATGGAATCGCGAAAAACAAACTATCGAAAAGTCTGACAATCAATTACGTGGCGCACCAATTACCACGGATTTAAACTTCTTTAAAGAGATTGCAGATGGTTACTTTAGCTTTAATCATGGAGATGAGCGGGTTGATTTAACTGGTCTAGATTTTACTAAAGTTACTTCTATCGGTGATATCTCTAACGTTATTAAAGCAAAATTACCAGAAGATACAACAATTGCATTAACTGTTGATACAGTTGGTAAGCGCATCATTATGTCTGATGCTGATAAGGTTATCGGATACGCTAAAAACGAAGAGTTTGAAGGTTCTTATGTTGGTCGAATGTTAGCCTTTGAAGATGGTCAAGCATCTAAGATTAAAGGGCATGAAGCAACGGAAGTCAAAGCAGAGACTGTGATGGGTGCCCTTGCTGAAATTAATAACATGAATCCGTCATTCTACGGTGTTTATGTTGCAGGTCAGCCTACGGACGATGAAATTGATTCAGGCCACGCATGGATTAACTCAGCTACCCCTAGCAAAGTTTTAGCTTACACCGCTATTCGTGATGAGCAAATCGAGTGGAATGAAAGTAATATCATTAAGAAGTGGCACGATATTAATTCAGGCCGTGTAATGGTTCAATATAACCAAACTGGCGATAATCACGCGGGGTTAGCACTGTTAGCTGAGGCCGTATCAACTAACTGGCGCGGAAGTAATACAGCTAAAACTATTAAGTTTAAAACTCAAATCACTCGTTCAGATGGCAGGATTACCATTAATGAAGCTAACAAATGTCGTAGACTAGGAGTTAACTTCTATACTGATTACGATGGAATTCCACTGTTAGCCGAAGGTGTAATGGTTGGCGGTAAATTCATTGACGAGGTAATGGGTTTAGATGCTTATGTTGACGCACAGCAAAAAGCTGTATTCAACTATATTAAATCCGTACCAAAAGTGCCACAGACAGACAAAGGTACAGCATCAATCATTAGTCAGATGATCCCCGTAGCTCAAGAGTTTATCCGTAATGGGTTCTTGGCGCCGGGCAAATGGAATGGTCAGCCAGTGGGTGAATTAGAGACAGGTGATTATCTTGATGATGGGTACTATTTCTACGCTGATTCTTTTGATTTGCAATCTCAAACAGACCGTGAACAACGCCTAGGAATGCCAATTAATCACGCTATCAAACTAGCTGGCGCAATCCATAGTGTTGATGTTATTATTGCATTTAATCGTTAATAAGGAATTATAAAGATGCGCTTTGACCTTAAAGAATGTGTTTTTATTCTGAATGGTCGTGAAATCACGGAGTTCGCCGATGGCGCGGACTCTATCGATTTTGCACCTAATGCAGATATCGGACAAGTAACAATCGGTGCCACTGGCAGCGGTGTGTTTGTCGCTACTAATAACAACTCAGTTGTGGTAACATTCAACCTATTGCAAAACAGCGCAGATAATGAATTTTTATCTGACTTGCAGAATCGCCAAATTAAAGGCTTGAAAACCTTTGAGACATTGTCAGGATATTTTAAAGATACCATGAACGGCGATGAGTATGTTTGTACTGACGGTTATTTTACTACCAAGGGTAATTTCACCCGAGGTAATCAATATAATAGCCAGCAATGGGTTATTACCTTTATTAAAGGTGATCGCAAATTATCAAAAGGTTGGGGTAACTAATGAACGAAGAATTAATTGAAATTAACGGCACAAATTACGAAATGCGCAAAGCTAACTTCTTTGAAGCTCGTGATGTTGCGATGACTTTCCTATCTGTCTTAAATGGTGCTGTATCTATTAAGAATGGTCAACCAGACATTAATATTGGTGCAATGCTTAGCAATTTAACGTCTGCAGAAATGGAGAAGGTTCAAAACTTTATTCTGAAATACACTGTTGTTAACGGTGTTAAGTTATCAAGTAAGGTTGAAGCTGAAAAGCATTTCAATAATCATCGTCAAGATTATTTTCAATTAATGTTTGAGGGTGTTAAATTCCACTTCGTTGATTTTTTGCCAAATGGCAAAGAGTTTGCCGAAAATATGACAATGGAAAATCTAACCAAGGTGCTGGCGTAGGTTTCAAGTCTGATGTAGATTGGATGGTGTGGACTCCTATAACGAAAGGTTATTGTTCATTGCAGGATTTGCGCACCATCTACACATTGGACGATGTAGCCGATATGCACGAGGTTATAGCAGAGTTAATGATTCAGGAGCAAGAGCAAAATGCAAATAGGTGAATTCCTTGTTAAGCTCAGTGTTATCGCTGACTCTGAAAAAGTAGAAAAGTTTAGTAAGTCACTTGCAAAAGTTGGTGCTGTTGCGACTGTTGCAGTGACTGCTTTAAATACAGCGGCAGTTGCCGCTTTTTCTTTTTTAGACGGTCAGATTAGAAAAACGGAAGAGCTAGCTCAAACTAAAAACGGATTAATGCAAATCACCGAAAGTGAAGTTGCTTTATCCAAACAGTATCAAAAATCCACTGAGAAATTAACCAACACTTTCGATATTCTGCGGGCAAAGATAGCGCTCGGTGTTGCTCCGCAGATGATAAAAATAACCGACCGGATGAATAAGTTTCTTGAGTCAAATAAAAAACTTATCACCAACGGATTACAAAAGGGTGTCACGTGGTTATTTAATTTCGTGGAAGGCACTATCAGTATAATGCGTAGTGTTAACGACCTAATAACCAGTACGATAGGATGGAAGAATGCCCTATTAGCGTTAGTTGTTGTTCTAGCGTTAGTTAAAAAAGCAACCATATCAGCATTCCTTGCTAACCCTATAACATGGGTAGTTATCGCTATCGCTGGATTACTTTTGTTATTAGACGACTTGATGACCTACATGAGAGGTGGTAAGTCAGCTCTAGGTGATTTTTGGAAGCCTTTTGTTGGTTTTATTAAGGACGCAAAGAAGTGGTTTAACAATCTAACAGATGATGGAAAACACTTTTTCAAGGTGTTAGGTATGGGAATGATGGCTCTTGCTGTTGTATTTTTAGCAAGCCCTATCATGTTAGTTATAACTGGGATTGCCACCGCTGTATTGTTAATCATAAAAAACTGGAATGATTTGCCAGGGTTCTTTAAAAGAATATGGGACAATATCGTAAGGTTTTTATCCACAGCGGTTAAATCAATCCTTAAATACTTCGGAATGACAGACAAGGACGCTGAAAAAACAGTTAAGGCCATAGGTAAGTCATTTGAGGTTATATTTACTGTAATTACTTACCCGTTTAAACAGGCTTTGAAGTTAATCAAGGGTTTATTTAAGGTATGGACTAACGATTCAGATGATACAGCAACTAAGATAGGAAAATCATTCCTAGTTGTTACCGACCTAATTAAAGAGCCTTTTAAGAAAGCTTTCGATTGGGTTACTGAGAAGTTCTACGGATTGGTTAACTCAGTGAAAAGTGGATTGAGCAAGCTTAAATTTTGGGAAGATGGAGAAGATTCTGATGTAATGACTATAGGCTCATCATTGGGTTCAGGTGTTTCTGGCGCTATGGCTGGAGCTATGCAGAATAGGCAGTTGGGAACAATTAACGGCGGTGATATGAATGTAGAAATCCATGTCAAAGACACTGACACAGCACAAGTAATTAAGCGTGAGATTGAGCACAGTGGTAATAAAATGGCTCAGTATAACGCAACCTTGGCAGGTGGTTACTAATGAATGCATATAACATAATTAGCCGAGAAATCGGCTCTTTCACCCTTGACGTGACCACCGTTGAGATGCACGACTCGACATTGACATTAACGGAAAACCCTATCGAGTCCGGAGCCAATATTGCAGACCATGCGATACTTAACCCTAGAAGTATTACAATAGTTGGCACAATGGTAGGTTACGAACCACCTAAATACTTCGAGAAGGCTTTATCTTTGGAGGGTTACGAGGTTGCTGATTTACCGCTTCCTTTTGAATTGCAAGGGGTAACAACTCAGGCTATATCTTTAGTAAATCGATATGCATCGACATTCACCTATGTGGTTGAGGAGTCAAAACGAGTGCTAGCACCGTGGCTTCCTGACTACCTCACTTTCACTAATGACGAATCAGATACATTAGATAGGGTTGGTAAGGCTAGAAATCAATTGCTTGAATTACAGCGAAGCGGTGAAGTTATTGATATTGTGACAGGTGTTGCTAGGTACTCAAATATGATGATAACTAGCGTAGGGGTATTCCAACAATTTGATGGGAGTGCTGAATTCACCATAACAGCCAGAGAGGTTTTTATTGTTGAATCCAAGATTGCAGGCGGTTTATCAGTAAAAACAACCAGGGCTGGGCAACAATCATCAACAACTAAAGATATGGGCAAAACACAACCTACGCAGGATAGGTCTGCGTTAGATAGGATTAAGGACTTGGTGTTATAATGTATCTATTAAATACAACGCAAGACCCAAAGCAAGCACAAACATTCAACCTGTTTGGTAAAAATATGCGGTTTAGTCTACAGTATAATTCGGTTTTACCGAGTTGGACGTTTGATTTATATGATTTAGATAAAGATGAATTTATCGCTCAAAACTACGGGTTAGCTGTTAATTGCCCTAGCTTAATTGAAATGAATTATGATTTCGTTATCCTAATGCTCGATGAGTCAACGCTTGGTGTAAACCCTGTAGATATAAATGAAATGGGTAAAAGGTTACTTGTTTATATTGTAGATAAGGCTGATTATTATGAAGCGATTCGGTCGTAGGTATAGACTCGTAGTAGGAAACAAAAAAGAATCACTAGTTATAGATCAGTTGAGAATAGCTTTTGACTGTACAAAGACTATTAAATCAGACCCTAACCCAGCTACGGTTAGGGTTTACAACTTATCAGAAACAACCAGAGATAGAATCATATCAGGTGAGTTTAAGTTTGTTAGGTTCGAGGCCGGCTATGAGGAGTTAGGTCTTCTTTTTATAGGTGACATCATAAACCCAGTAATCAGAAAAGAAGGCGCTGATATAATCACTGAAATTCAAGTCGCTGATGGGTTTAAAGCGATAACTGAGTCGGTAAGTGGCGTAACTGTAAAATCTGGTAGCACGAATAAGGATATCGTTAATCAAGTGGCTAAAACTATGCCTGACACCCAAGTTTCCATTGCTGATGTTGATACAGGTTCACCACTTCCGAGAGGGAAGGTGTTGAATGGTGATTCCAGATTTATTTTAAATCAAGTTGCCAAAGATAGTAATGCCGACTGGTCAATACAAGATGGAAATCTAATTGTATTACCTAAAGATAAAGTATTGCCAAGTGGTTCAGGTTTTGTAATCTCTCAAGAGACTGGAATGATTGGCTCTCCTGAAAAATCAGATTCAGGAATGGAGCTAGTGTATCTTCTTGAGCCGAAGATAGTTATAGGTTCATTAATTCGCGTTGATTCCATACTGAAGCAATATAATGGAGATTACAAAGTTACGGATATAAAAATGACTGGCGATACTCACGGAGATACTTGGTATTCCCATATTACATGTATAGGTGGAAAGTTCCAAAATGCAAAGAAATAGAGAACCCAATTTAACAGAAGTTCTTCAATCGCAAGATGAGGCCACTAGCGCTAGAATCAGGGTGGCAATGCCAGCCAAAGTTTTGTCGTTCGATGGAAAACATACTGTCACAGCACAGATAATGATTAAGCAGAATGTGAACGGTGAACACGTTAGCTACCCACCTATTCCAGATGTTCCAGTTAGCTTTCTTAGGGCAGGTGGTTTCTCTCTAACTGTTCCGGTGAAGGTTGGCGATGAAGGAACGTTATTGTTTTATGATCGATGTATCGATGGGTTTTACGCTAGCGGAAAAGAAAGTGAGATACTTGATTTTAGGTTGCACGATTTAAGTGATGCATCATTCTTACCCGGAGGAATAACCAGTCAACCGAACGCTTTAGGTGGTGTTTTTACAGATGGGTTATCGCTACAAACTGATGATGAAAGTACTTACTTGCGAGTTACCAATGGTAAGATTTTAATTAAAGGGGACTTAGAAATAGAAGGTAACACTAGCCAGATTGGCGATACAATCCAAACTGGTAATATAGCAACTCAAGGTATGATGTCAGCTGTGGGTGGAGGTAGTTTTGCTGGTATCAGCGTTGAAAATCATACTCACAGTGGAGTTGAATCAGGAGATAAAAATACCGGTACTCCAAACAAGTAAAATAAAAGCCCCTTAATTGGGGCTTTGTTATTAAATAATTTCTTCTGCTTCCGCGTCTTCATAAAAGAAATCTCTATCATCTCTAGTAAAAATTTCCTCCCCGCATCCGCTTTGAAATTTATTTATAGCTTCTTCTTTCGTGTTTGCTTCTATTTCACAGATTGATGTTCCTCTACAGTAGCCCTGAAAAGGTATTCTTACTATAAATTTTTTCATGATAAATCACCCACTTTGTACCAATAAGGTTCATTAAATTCGTAATTAAATACTTTATGAGTGTAATGATCCGGATCTTCCTCGTCAATTTCAATAACTACTCCCTTGCATTTAAAATCAACCCCGCACTCATCAATGTTTACTATGTCACCTATTTTAAATTTCATGAGAAAAAACCTCTTTTTAGCTTAATTGTTGTGATTGGTGCATTGTTCTTTTTAATGTATTTAATGCTTTCTTTCGCTAACTTCAAATTTAATTCAGCATGCATGATACGTCGTTCTTGTCTTTTAAGGAAACTATTCCATGCTGACTTTAACGTATGGTGGATTCTACGGCATTTATCAGGGTTTTTAGGTACTCTGTATTCTTTGTATGCATTTTTATACTTTTCCCTTACTATATAAAAACAAGGCGTCTCTCTAACCATTTTGTATGTGTGTTGCTTGATGTAAACAAAGCCATCTTCATCACAATAGTTTGTATATCTATAAAATAACATAATTAAAATCTCTTCTTCATAAAAAATTCAATGGTAATTAGCGACGATATCCCGCACATAACAGCAATAACTACAGCAGTAACATCAGACTGAAAACCAAACTCTTTAGTTAAGAATAATCCTATAAGAATAGTTGATAACCATGTTGATATTACATTTATAGGCTTCCATAATTTCTTTTTAGATTCCTCTTTATCAACTAAACCCTGAGCAACAAGCATTGCATTATGACGGTTGTTTGCGTTGGTTATTAGAACCCACGGGATAACCCAGATTAGAGTAAAAAGAGTTATAATCGCATGTAACAAATGGTTTGTTTTCTTTAGTTTGACTTTCTTCATTTCATTTCTCCTAATGCTTTTGCGATTGCTACATCTGCTTTATCATGAAATGCAACTAACTTGCGAATTTCAATCAAAGCCTCTAATAAATCTGGTGCCGCTGCGATTAGATGGGCGTTGGCATTATGTTTACAACCATAAACATCGTTAGGTAATCCGTGATGCGAATAATTAACTAGTGCAACATGCTTACTTTCAGAATTTATACCTGTCATACTCCATTCATCTATCACCCAAGGTGCAGGTGTTCCTTTAAATCTGTTCATCTTATTTCTCCTTAAAATTATTTACTGTTAGTGATTTTTTAAAATCATCTGGCTCCCACTTTTGATTCACTGAATCTGTCCATTTAATGCCTCCTGTACGCCACACCCCAAATTTATTTTTATACCACACGGCTCCATCATCGCGATCCCAATACAAAGTAGTTTTCATATACACCTCTCGTTTCGTTGAGGTAACTATATGTGCGATGGGTTATAATGTACAATAGATTGCACCTATTAATAACAGAGACAGAATATATGAGAGTTAGAAAGGTAGATAAAAATCACGATTGGGTATTTGGTAGGGGGTTGTCTGATTATTCTGCCGGTAGTGAGTCAATTTACCAGTCGGTGAAAATGATTTTATTATCAGTAAAGAACGATTGGTTTTTAGATTTAGAACACGGCATAGATTGGTTTGATTACTGGCGTAAGAATCCAAACATGTTAAAGATGGAAATGGATATAAAATCTCATGTTTTATCAGTTGAAGGAGTGGTTAAAATTGATAAATATGATGTTTCATTAGATGAAAATACACGTAAGTGCATAGTTGAAATTGATTACACGGACATTCACGGAGAACAAAGAAATGTTACAAATAACGGATAAGGGAATCACCACAGAATCTTTACCGGAAATATTAGAGCGAGTATCAAATAGATTTCGTGAGATTTATGGTAGAGATATAAACCTTGACCCATCTGCACCAGATGGTCAACTGATTGGTTTCTTTGCACAAGAAATGGCTAACGCAAACCAAATTATCTCCGCTATTGCGCGCATGTTAAACCCTTACACAGCAACTGGGCGATGGTTGACTGATAGAACCCTATACGCTGGCGTTGTTCGCCGTGGTGCTGATTATTCAAGAGCTAACAATGTTATTGTGACAGGTAATAAAGGTGTTCAATTGCCAAGTGGTTTAGTTTTGCGTGACGGTAACGGTAATAAGTGGGTTACTGAAATCCCTTACCGACTGAATCAAGATGGTAGTGCAATAATTAAAGTTAGATCACAAGAGCTAGGCGTGTATCAACTAAACAAAAATGATGAGCTAACAACTGAATCACTGGTAGTTGGTATTGATAAAATCGTTGTTGATGAACCTAGTATTGATGGTAAGGAGGAGGAGACTGACGGTGAGTTACTTGTCAGATTCATGAAGTCACACGCTATCAATAACGAAGATGATAGAGACGGGATTCAAGCTTCAATCCTATCACTTGATGATGTCAAGCAATGTGTTGTTTATGAAAACCCAACCGGTGAAACTGACGCTATAGGGGTTCCTCCTCACTCGATAAACGCTGTTGTTGTAGGTGGAAGCAACAAAGATATTGCCACAGCTATCATACGCAAGAAAAAAGGTGGTTGCGGAATGATGGGTGAAATATCCGAAAGCGTTGAGGTTAGCGGTCTACCTAGAGTCGCCAAATTTGATAGAGCTAAAGATAAAAAAGTCTCAGTCAACGTAACTGTTAAGCGCGTTGAGATGTTTACTGATTATGATGAAGATAAAACAAAACAAGCTTTATCTGAAACGCAATTCAGTATCGGTGAGGATGTTTACTCCACAAGATTGTATTGCCAGATACCAAATCAAAAGGGATTTATTGTTACCAATATTACAGTGAATGACGGTGATACCGTTGAAGTTTCACCTCGTGAATTAGCCGTCATCAGCAAGGAGGGTGTAAATGTTGATATGGCAGTATAGGGGGAAACCTAAGGCAAATGCAACAGTAAACCTAATTAGCGATGAAGCATCAAAGGTTTACCAGAGCGCCGTTGATGTTGGAGATATTCTAAATATAGATAAAGCTAGAGGTTACGCGCTAGATTTAGTTGGTTATCACGTCGGTGTTAATCGCTCTTTAGCTTCATTTATACCTCGCAAGTTCTTCGGATTTGCAAGGACGGGGCAACTTGGATTTAATGAGGGTAAATTCTACCGCTACGGTGAATCCACAGGCGAATCTACACGGTTAAGTGATGAAGATTTTAGGTTTATGATAAAAGCTAAAATACTCAAAAACTACCAAATTGGATCCGTTGAAGATATTACTAATTCGATTAGTTTTTTATTTGGTAGAGATGCAAGAATTATCGATAATTACGATATGACCATGACAGCAATTATTCCGTCCACTGTCATGACACCCATTAAAAAGTATGCAATTGAAAACCTTGATATACTAGTCCGTCCTGTGGGTGTTATGTATAAGTATGTTATAATCGAACCTGCGAAATATTTTGGCTTCTATGAAGATAGATACGCTAGCGGATTTGATGAGGGTGTTTTCGTGGAGTTTTCAAATGAATATACAAGATAAGCCGGATTACAAAGTCTTTGCCTCGGAGGCTAGGGGTGGAGAGGTTACAGATTTCCCTAACCTTGAAAGGGGATGGGGAGAGACGATTGATAAAACAGAAAAGATTCCACCTATGGAGTGGTTCAACTTAGTTGGAAAGCGAGCTGACGAGTGGTTACTTTACCTAACTCAAAGGGGCGTTGCAGAATGGGATGCTAAAGTTAAATATCCTCAATATGCTATGTGTCAGTTAGGCGGTAAATTCTATATCGCCACAGAGGAGAATGAGAATAGAAATCCTGCAACATCTCAAACGGTATGGTTTGACTTAGCCAAGTATTTAGGTGTCGACGGTAAGCTTGATGCCAACAAAGTAGTACAAACCACAGGGCAATCAACAACAAACGTTATGAGTCAGAAGGCGGTAACTGATGCGTTGCCTAAGGTTACAGTAAATACAGCGTTAAAGCAGAAGCGCGGCTGGTGGAAGTGTGCTGATACGGGGATTATTTATCAGTGGGGGACTGTTGATTACACCTCAAAACCTAATGAAAAAGACTATACATTCTCGTTCAACATTGAGTTTCCTAATGATTCATTAAATGTCTCATTAACTAGAAAAGTAAAAAGCAATTCTGGAACTATGGATAATGATGGTGGCGTGTTGTTGGTGGCACATGGGAAAAGTGACTTTATAGTAAATCTAGCTAACTTTTCTAGTGAAAATTCAGGCCTTAGAGGTTTTTCATGGTTCGCAATAGGATATTAAATAATGACTAAAAAAATTGAAGTTTTCGCATCAGAAGCACTTCCGGGTGAATTGGAAGATTTTCCAGATATTAAGCGTGGCTGGGGTACAACAAAAGAATCAACAGGCGGTATTCCACCAATGAAGTGGTTTAATGCTATTCAGAAGCGTACTGATGAAGCAATTAACGCTTTAGCAACCGGTTCTATTAATGGTCACTCATTTGAAGAAGGTGCAATCTTAGAGTCAAAAAACGACTTTATTTATGATGAAGGTAGTAAATTATGGTACTTTTGGGGTGGTGATTTTCCTAAAGTCGTCCACCAAGGGGGTAGTCCAGATGGTGAAAATTGGTTTGTTTTTTCTGGAGACGACATAAAGGATACTTTATTATCAGATGGTACGGGGATTATAAATCATTGTAATGACGGTAATTGTATTTCACTTAAGAAAATCATAGATATGAACGGTGTATATCCTGAAATGTTTGGAGCGATATCTACAAATGGATCATCAAAGCCTATAGATTCAACCGTTGCTATACAAAAAGCTTACTCACTAGCTATGTCACTTGGTGTTCCGTTAATTCTTAAGGGTAGACATTACGGTATAACAAACTTGAGTTTCTTTGATGACGTACCATCCTCCGGTAGGGCTAATGGTACAACTATTATTGGCAACAATAGCGGAACCTATCTAAGGGTTCTTACTGACAGTGATAGTTATGATAAAAATAAAGCATCACTAATTATTGGAAATGAGAAGTCTTACTTAAAAAGATTGGTTGTTGAGAATATTATTGTTCTACCTTGGGACAAGGAGACTCTTGATTCAGGAGATGGTATTCTATTGAGAAAAGCTAGCAATGGTTCAAGGATGCTTGGGGTTGAGGTTAGGGGTATGAGAGATGGCATTGTTATAAATGACTCATTTACTGTTAATTTTCAATCGTGTAATTTTTCACAAAACAGAAGGCATGGAGTGTATGCTCCGAAGGTTCCAACCACGGCTGGTTCATTTACTTATAATAATAATATTGGTTTTATTAACTGCGTGTGTAATTTCAACGGTGGCTCTGGAATTTTCACCGAATCTAGATCAGCTTCAATGGTTAGTGTGAATTGCGAAGGGAATAAATCTCACCAGTTTCACGGTGAGGGTTCCTCAATATTTATCTCTGGCATGTATTGCGTGACTCTACCGTTATCACCTTTAGCGTGTATTAATCTAAAGGATTGCAACGGTGGTTTCGTGGCTTCAAATTATTTAGACACGTGGGGTGGCGAGCAAGGTGATAAAACTTTAATAAGACTAACAGGAACAACCCATGGAGTAACTGTTTTCACAGGAGGTTATAATGTTAGGTCAGGAACAAAGGCTACTATAGTAGACCTTGGTGAATCCACAGAAAAAAATACAGTGTTTGCATTAATGGGTAACACTATATCAGATAAAAGCGGTGGTAAAAACAGTATCGTATGGACAGATAAAGTTAAAAACACCTTGAGTGGGGAGTCATCCATTAAACATTACGGAACCGTTAGTCATGGCCTAAAGACAAAGCCTTCAAATATAAATATTACACCAGTTACTACTGATGTTTTATTTATTAGCGTGATACCAGACTCCATTAATGAAAACTCATTTTCAATAAGTATTAAGAGACCTGATGGTAGTGTTTACGACGGCGTAGTTAAAATTCTGTGGAGCGTGTCACAATAGTAATAACAAAAAGGGGCTCACGCCCCTTTCTTGTTTACCTTTTCGCAGAATTTTCTAAGTCTGGTGTTAGCATGGAATCTACCCTTATTGTATTTCTTATATGGAACTTCTTCTAAATCCCACCAATAGTCAAATTCCATCCACCAACCGTCCAGTGCTTTTCTGCGATACTGCCAGGGTAAAGCGTTAATCATTGCTTTTGCTTTTGGATCCATCTCTCGAAAGCCAGCCATCCCATCTCCCAACCGTAACATAAGTAAGCCTCATGACCTGCATCAGCAACCATATCAAGAAATATAATTTGTCTGTCAGTTGGTTTTGAGCTTTTTGATTTCTTCTTAAACTCAATAAACAACATTGGGTTCCCAACAATTATAACGTCAACAACACCAGACAAAACCCCTTCTGCCTTATCCCTCATTGCCTCACCAATTGACTTCTTTCCTTCATTCTTAACATGAAATGCACCCTTTGCTATTTCAGGATAATGCTTACGCAACTGATTGAAGAATGTAATCTGCTCGATAGACTCACTTGGTGCTTTCTTTGGAAATTCATCGGGTTTTAGTGTTATGAATTTATTTGTCATTTAAAACCTCTCTATCAGTCAAATATTCGTAAGTGTCACCGCCGAAATAACAAAGATATTTATTGTCTGTAATTTTTATAATCTCACCTCTCCCTAGCGCCCAGTGGTATATATGGTCTCCTAACTTAAATCTCATTTTAATCTTCCTCATCATTATGTTTATAAACCCGAAAGAATTCACCCTCTTTCTTTACCGTTACTGTGCTAGGCATTTTACCGTGTCCGCGACGCAATGCAAGCATAAATAACTCCGGCGACGGTGCAACTTTTCCAAATACACACATGCATAAATCTTTCCATAACTCTTGTTGTGCAATATTATTGGCGTACGGGCTATACCACACAGGAAACGTTCGATATTCAGTGGTGTAGTCAATTCTTAGCGTTTTATTTCCGTAGCTACTCATCCATTCTTTGCACTCCCACCTAATAACCTTATCAGTGGTCATGATACGTGGATTCTTTTTCATCTTCTTGTAGTCAATCTCCAACTTAGTGTTAGGGTCAACCAATTCGTGACGGCAAGCACTGCAATATTTAGATGCAATATCATTCTCTTCTTCACATTCTGGACAAATCTTTAATGACCAACGGTGTGAGCAACGAACGTAATGACCTGAAACGCGAATTTCACCGAAGCATCTACGCCCCATATGCGCCGGAACAGGCTGTCCATCTAACATAACCCTATCGCCAGCTAGGTCTAACTGATAACCTTCACTGTCAACATTATCTAAATCAGCACCTTTACGCACAGAAAAACTATTCACACAACTACAATCAGGACAAACTACTTCTAACTTACCGCTACCGCTACCTCCACCCGCAACCTTAATATCTGGTGCAAATAAATCATCTTCCAGTCCGTGACGTTCAATGTTTCCGGCGTAATCTAACACTAAGCAGAATAGCTTACCTTCATCAAGACGCAAGCCACGGCCAATAATTTGTTGTAGTAGGGAAGCTGATTCAGTAGCCCTTAATATAGCAACAACATCAACATGTGGAGCGTCAAATCCTGTGGTTAATGCAGACACATTAACAAGGTACTTAAACTCTTGGTTCTTAAATCTTCTTATTATTGACTCACGGTCTTTCTTTTTCGTCTTACCTGTTACCACCTCGACCTGTTCTTTGGGTAAAGAAGATGCTATTTCGTAAGCGTGCTGAATTGTAGCGCCGAAAAACATAACCCCCTTACGATTACGTGACTTTTCAACTACGTCCGCCACAATGTCAGCCGTTAACCTTCCCTGCCCCTCAAACACCGCTTCAACATCTTTTGAGTTAAACTGATTGCGTGAATTCAACTGCAAGTTTTTAGCGTCATACTCAAGCGCTAGCTCTGCATCCGCAATCGGTGGCGTAAGATACCCTTGAGCTATTAACTCTTGAGCCGTTATTCGGTAAACTAACTTCTTAAAGAATGGGTTACGAGTTTGATCTTCCCCTACAGGCGCACCGTCTGGAAAGATAGAAAATATATAACCATCACCAAGTCGATAAGGCGTAGCTGTCATGCCAATAACCCGTAAGTTAGGGTTATGTTCTTTCATGTGAGCCACTATCTTTTTGATAGTCGGACTAATCTGATGGCAATTGTGAACTAGTATACCGTTAGCGAAAAAATTATGATGCTTTGGCATAGATATATCGTAAACAACTTCCTCACCAACGGGGGTAATATCAATAACTTTAGCTTGTTTTGTATTCCATGCCTTTAGCCATATGTTTTTTAATTCTTTTAATAAACTCATCACTTCCCCTTTTGTTTAATCTAACCATATATCTTTCTTTTTTTGGTGTTCCGCCTAGATAGCAACACACTTTTCCGGCGTCCATTCCTAGGTAAGTATTTAAGCATTCAAGGCATATCTTTGAACCCTCCTCACCTAGCCCCTCAGTGTGAAGAAATACCAACCCTCTCCTGCTATCATAGTGACCGTCATCCCCGTAAAACCAAGCCCACCCGACAGCATCAAGTAATGGAAATATTCTTCTAGCTCTTTCAACTCTATCATCAAGTCTAAATTCACTATATATCTCAACAAGAGCGGGAAGACATGGCGTTCTAACCTGGAACCACTCGCTACCCCAACCGGGATTTTCACTCTCTTTCATATCCGCGCCAAACCTAGAAAAGAAGTCTCGCTTATATTCAGCGTGATTTTTATCCCCCATATTCCAGGTTAATCGAGGGAAATTTGAGCGTTTATTTGGGTAGTTCATATAGCCGTCACCTAGCAGTGATGATATAACAGCCTGAAACTCATCATTTGTTAGCTTAAACGGATAATTGTGACCAGGTAGTTTTTTGCCGTATTTAACATCCACCACACCGGAATTCATGTATTTACAAAACTTTTTTACTTTGTCGGTTAAAACATTAGTCTTTTCGCCACAGCCACAACTGCACGTAGGAGCTTTTTCATAACAAAGTCCTTCGAACCGTCTAACGTCATCAACTGACCAATCTTTACATCTTTCGAGTAAATCCACGAATCCTTGCTGTGAAGTAAATGGTTTTCTGTACACTTGATTTCCCCCTCTGTTGTTTTAATTAATGATACATGTTTTATGCCATTATTCCAAACCTTATTTGGCTTATGATAATAAATCTTACCGCTTTTCTCGTCAATGCACTTTATTAACTTATCTTTTAATTTAGGGTCATCAAGCCTTATTTGTCCTTCTGATGTCTCTATTAGCGAGTCACCAGTTAAACACTCGTCAATTACAATAGCAGAAAATTTATCGTCAAACTTATGTAGGTCATTGACGATGCTTCCCGGCGTACCAAATACGACATCCTTTGCAATAGATTTCTTGCCCACTGAAGCGGAATACATGGAGCAAGCAAACCCATAAGAGCGATACTTTTCCGCGTTTTGCTCCACTAATTCTTTAGATGGCGCTGTACACAATACTTTTTTACCGCTAGTTTCTTTGAGCCATATTGCTAGTTCTGATACAAGTAGTGATTTTCCGCAACCTGTCGCACCCTCAATAAGAATAGGGTCTACGCATTTTTTTAATTCTTCTTTTGCAGATTCAACCGCATCTCTTTGATACGGTCTCAACTGAAATGACATTATCTAACCCCCCAACTAACAGATGGTTTACCACGGTATTTTTCTAAGTCTGCGTCAGGAAATAATTCCTTTACCGCTTTTGAGTAAGATATACTACCTTGTTTTTCGATAGGGTAAACCAACAAATCTCCTATTACAGTTTTATTTCCATTAGCTAACTTAACTAACTCTTGCTTAGCTTCGTCTAATTCTGATTTAGCATCGTTAAATGTTTTCAGTGCTTCCTCATAGCGAATTGAAGCTTTACATGCATCAAGTGTTTTAACTAACGGGGTTAAGTGTTTATCTGGATTCTTTAGCTCTTCCTGATATCTATCGTAGAATTCTTTTAGTCTTGGTAAAGTTACGTCAATAAATGACTGGTTAAAATCCACCACTTCAAGCATGGTGCCTTTTGGCGACCACTGGAAAAAATAACACTTCTTACGTCCCGTGCAGAACATCTCATATTGAATTTGAGCCATGTAATGCATTTGCTCATCAATAGAAATAAAATCATCACTATCACGCTTACCGAATGGGCACTTAATCTCAATCACTGCGTCATCACCAACAAACCCATCTGGAGATGCGCCAAGCCAATCGTAGTTAGGATGGACGTGAAACCCTGTCTCTTCAACAGTCATTCCCGTTTCTAACATAAAATCCATAGTTGCAACAGGCTCATTAGCTTGACCGTAATTAGTGGCAATATTTCCAGTGAATTCACTTTCCGCACCGTTTGCATCACGCACCATTCTACGCATAACATCTTTAGGTTTAGTGAATGGCGAAACACCTAAAATAGCTCCTATTGCAGAACCTGTAATTCTACCTTTACGTTGTTCAAACCATTCTTTTGAGCGTTGTTCAATCATTCTAAAATCTCCAATTCTGTTATGTTATAAAACCCATAATAACCACATTCGAATCTAACTTCGTAATCATCATTAATCTGGTAAACAACTTCACCAACACTGCCTATTGGGACAGGTGAATATTCATTTACGGTGTTTTTTATAAATTTAACTCGCATAAATCACCTATAAAAAAGCCACCTATTTACAAGATGGCTCGTATTCTATACTTGATAAGAATATATTCAAGTTATTTATTTTTCATAGCCTCTTCTGTCATCAGCGCGCGATAATTAATCCCATCTACAAGACTATCTTCATGTGGTTTTTCAGTATTTTGAAAGAATCGAACATCTTTTAATACTTGCATGAAATACCATCCTTCAACCACTGATAGGTTTTGACCTGTTTGCAAGTTGAAAATTTTAACAATCTTTTCCATTGAGCGTTCTTCGCCTGATTTATCGTACTGTTTACCGCGCTCTTTTAATAATTTAGCACCTTCTTCAAGGTAGTCACTAGCTGATTTATTTTCTTTAACTTGATTATAATGCGTGATTAGCGAGATGTTGCCGTTTTTTACCATGTATTTATCCATAGTGTAATTTATTACACCAACTGCTAACACAGTACCTTGACAATAAACACCTCCTCCAGTTACATACTCATAAATACCATCCGATAACTTACTTCTATTCTCTTCCAACCACTCTAATAATGTTTTCATAACCCTTTCTCCCGATAATTATTTGCCATTTCTAGGTAATTAATATCACCCGTCTTTTCAAACATCATGTCACACCATTCGCTTAGTTTCATTATTCACCTTTATTATTAAGGGGCGCGTAGCCCCTTTTGTTATTTTAAATCACATGAATAGCAACGCTTGGGTACATCAATCCGATTGGAGCAAAGGGGATATCGTCATCAAAATCCATTGGTGGTTCTTGATTTTTCGCTGGAGTGCTTTGTTGCGGTGCCTGTTGCGCACCGCGTTTACGCTCACTTACAGCACAAATCCAGTTGCCTTTGTTACCGTTCATTTCGTATTCTTTAATCATGATGTACATCGGGCTATGAAGTAATGACGCTAAACCTTGCGCTGTTGGCTCTACTCCAGCTTGTGCAATAGCACCTTTGCAGTTAGCGTCGATAGCGATTAACATTTTTTGAGCTTTAATTACTTTATCTTTGTCCGACTCAAATAATTTAATCTTTTGGAACACCTTACGCCCTTTAAACTCACCCTCTACGATATCCCATGTTAAAGAGATATGCTTAGCGTTATACTCGTTAGCTTCACGCCATTCTGCGTTAGTGATAACAGCTAAAGCCTTTGTGTTATCAGGAATTACTTCGAATGAGTTAGAATCAAATGAACCTGATTTTGCTTCTTCTAATGCTTCTTGGCTGAAAAATGACATGTTACTTATCTCCTAAAGCTTTAATAATGTTGGTAAATGGGTTAACGCCTTGCTCAAAACGAATATCTTCTGTAACACCATATCGATTTTTTGTAACGCTTGAGCTTGTTGCATTCATGCAAATAACTCGCTCTCCTGATGAAATAGCTTTCTTTCTATCTCCATCTCCTGTAAAGAATGTTTCTAACTTAACTAATGCTACTGCGTCAACATCATCAACATAATGGGCAATTGATTTCTTACCTAAGCGTAAACTATAACGCATATACGGGTCAGAATCTGGTAACTCAATCGTCTCAGTGTCAGCGTGGGCAATGAAAATAACACACATGCCTTTAGCATTCAACATTCCTGACGCTTTACGAATGCGACCGTGTAGATTTGCTACCGCTGACATACCCGCACCATAACCGCCCATCGCTTGATTGATACTCTTTGGTTTCTTTGGGTCATTATCAATAATGTACTTTTCAAAGATACGGTCTAACTTAGTTACTGAATCAAATACAACGGTTTTGTAATTATGTTCATTTTGAACCAATGCGTTAATCTGTTTAAACAGCAACTCAACATCATCACCAACTTCTGGAAACGCGTCAGGGCGATTAACCTCTGGAATTGCCTGCAAGCCATCTTCAATACGAATAAAAATAGGCTTTGGAAATGTTGCACCTAAGCTTGTTTTACCCGTTCCAGCCTCTCCGAGGATTGTAATAATTGGCATTCTATCCTGTGGCTTTTCAATCATATCTAGCATTGACATAATTTTTCCTTAACTGCTTTTAATTGTTGTTTTGAATGAACCAGTGCGCCAATTGCTTTGTTCGCCCATGGTTTATCATTCTCAGCAAAGCATTTTAACTGCTCTTTGATAAACTCAATTTTAAACTCAAGGTACGATTTAGCATCTTCTAAATCTTCTTTATCTAACTCATCAAGTTCGTAGAAGTTATTGTGGATTTCAATTTTCATTCTTAGATAACCTCATAATCACCAAGTAACTCAGAGAAGTAATATGTCTCATTCTCATCAAAATCCTTAGCACCTAAAGAAATCAATGTGAATCCACTTACATTGACACCCATATCATATTTTACCGCGTCAATAATAACTGGAAATTTCACATTCTCCATATCACCATAACCGCCGTCATTCAGTAATTTAATTTTCATTCTTAATCGCCTCTTCTAACAACTTATTAATATACGCGGTTCGTGACATTTCATTCTTGTATGAAAGCTTAGTTAACTTATCATACAGTTCTTTTTTAATTCTGACATTGGTTGTCATTTGTTAACTCCTTAATAAAACTATGAAGTTCATGTTTATGATGAATAGCTTCATTCCAGTCTAATTCTGAATAATTTTCATCTCCGACTAGCGCCCACCTATTGTATTTATACTGCGAACCTAAAACCTTATTAATTAAACCATTGAGAGTTTCCGCTTGTTGTTTAGTAATCATTTTATTCAACCCCGTTTCGTTTCAATGAGTGCATAGTACGCTATGAACACTTGGGTGTCAACAATTATTTTAAAAAATATTTCTTTCCGTCCTGTTTAACTTCATTATTGTTTATAAGCCACTCTAGTCCTTGAGTAATTTCCTCAGTAGTAAATTTATTGCGGAAGCGGTTTTTAAGTACAGCAACAGTTAGACCACTTTCTTTCTGCAGTCGTGTGCGAATACGAGTAATTAACTCCATACCTTTGTTGTTATCTTGAGACGCCAAGTCTGAGCGCACCAGTTCAAGCTTACGCTTAGCGTCATCAACGACTAACTTAAACGCATATTGAACGTGCTGGACATCGATAACCCCACCATCTCCGATAGCAACAACAGCAGACACACGTTGCATCATCTCGACTGTGCGGTTAAGCATAGTTTCAAGCCCGCCAGTCTCACGCTCAGCTTCTTTTAATTGCTCCTTACGAATGTATTTCTTCGCTTGCGCGATAGCTCTACGTGCTTCATCGGTGGCGTAAATGGTAGTAACCGGCCTATCCCACACGATACGGTCTAAGTCTTGGTCAAATAGCAATTTGCTATCACCACCGCACGCTAGTGTTTGCAGTCTCGCCTTAATGTCAGCAGGAATTTTCTTACTGATAGGATTGGTGTTTTCCTCCATGATAGTGTTTGTTTCTTCAAAGATAAAACAACGACCAATTAAACCTGTATCTACCTGTTCTTTTGTCATCATGTGGTAGAAAGTCTCAGGGGTTGTTGCACCCCAGATGGTTAAGAACGTATTTTTGATACCGCCGTTATTCAATTCTTTAATCTGGTTCTTCAGGAATTCAATATTCCTATTAGCCCAATCCTCTTTACCATCTAACTCATGCTCTTCTAACGCCTTGGTAATTTGGTTCAACTTCTTTCCTGCGTGTTGTAATGCGTCACGTCTAACATCACCTGAAAAATTCTCCCAATAACCATGGCCTTTTGAGTATTGAGATAACAAGATGGTTACAGTAGCCTGCATAAAGTCGGCAACGTTTTTACCAACCATGCGTTTGAGTTTTAAGCCAAGCTCATCAATAACATAGCAGTTTAGTTGCTCACTTAGCGCGTTGGTGACCATCTCCTTGGTTGATTTAATATCAGTAAATACACCACGCCCAGCTTCTAGCTCTTGCATATAAGCTGAAATCATGTTTTTAGGGTGGTCTTTACCCGTACCAGATGGGGCGACACAAAACGAATAAATTGCAATCGGTGTTTCCCCGTGCCCTAAACCAAAGTCGAAAACGTATTGCATTCCAAGGCAATTACTCATGATTTGCAGTGCGGCGCTGGTGGCTAAGTTCTCACATTTAGCAAACGCACTTCTTCTTATATGGTTAGCAATATCACCAGTTAGTCCAGGGGGTTGATTTACGTCAACCCAAGAGGTATCAAGCAGTGAGAACTCATCAAGTGGTGTCTCTTTCTCTATGGGTGCTGGTTCAGGGAATGTAACCGACTCAGCCCATCCGTTTTCAGACGCAAGTTTCTTTAGTGTCGCGATAGTAATTGGCTCACCATGCGGGGAACCGAATGACGACCACTTGGTGCGAATAGCGTTCTCATTGTACTTGCTAGACTGACGACTCCAGTTATCCCATAGCATAATCCCTTTACCATCTGTGGCGTTATGGATTGCCATCCCGACCGCTAACCAATCGTCGTAATCATCGTACGATTTGATATAAGAGAGCAGTTCTTTTACTTCATCATCATCAGCCTTTGTGATTACACTTTTAAACACCGCTGGGTTACGTTTGAGGGCATCAACCAGTTGTTGTGGAGCATCGCCAACATCATGAGGAAAGCCTTTCAGCTTCTCATAGTGCGCGCCTGATTTGTGCAATGAGCCATTACCGACAACGAAGCCACTTACTTTGAAATCAATACCAGGTAGTTCTTTTATGTGTGAATCAAGATTAACACCCTGTGGCGCACGAAAGTAGATATGCAATCCACCGCCACCGGTTTGCACTATATAGTTAGATGCTTTATCAATAGCAACATCCATATATTTATTAAGTTGTTCAAGTGATCCACCGTTCCGCGGGTCAATATCAACAATTAACCAACCGTCACATAAGACGCCAAAACCATCTCTAAGTTGCCCGAACTCAATCATATTCTCTATCTGCTGGTCATCCCAACTGATAGGTGTTTGCCAGTTGTTAGCGCGTGGATGCTTACCAACGGCCTGACAATCATCAAAACCACACGAACATTTGCCTTGTTCTATATTATGAAGAGGGAATATGTGAAATCCGCCTTCCAGATAATCGTATACTTGGTTCATTTATTTATCTTCCCTACTAAACTAATCAACATTGCAATCGGGTAACACATTACATACCTTGACTTATCTATCACCGTTATTAATTTTCTTAAAAACCATATAAGGGAAAGCAATAAAAAGTTGATTATTATAAATGGGATTCCAATTGGCAAAACGATAAACCAACCTATCGTGTTTTGTATTGGTCTATCTTTGAAGTTTTGCACTATCTCTTTCAGTGATTTGTTCATCTCTACCTCATTTGTTTTGTTTGATGCGTGCATGATATAATACTCACGTTGTTTTGCAAGAGAAATTCATTTTTAAGCATAAAAATAATACGCTCTGATTAAAGAATAACGTTCATTCGCTCTTTAAAAATCAATAACTTATCGTATTTTAAGTAGTTAAGGATTAAAAAAATAAGATTTGAAAATATTTTTACGCATTTAAAAATTTGCGTAAATAAATTTAGATTTTATTTTCACTGCTTAAATGCTTAAACGTGATAAACTTCTTGTTAAACATTAACTTAGCGGTTTATGATTTTT
Further, the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 was cultured under MOI=0.001 for 8 to 10 hours, and the titer was 3.0X10 11 PFU/mL.
Furthermore, the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 has tolerance to peracetic acid and still has more than 70% survival rate after being treated in 6mg/L peracetic acid solution for 6 h.
Furthermore, the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 has tolerance to temperature, the potency of the Proteus mirabilis phage is not reduced in the water bath at 65 ℃ for 2 hours, and the Proteus mirabilis phage has stability at different temperatures, so that the Proteus mirabilis phage is suitable for long-term storage.
A second object of the present invention is to provide a composition containing the Proteus mirabilis phage, wherein the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 can be combined with other phage or mixed with other substances to meet the specific requirement. The technical proposal is as follows:
a composition comprising said proteus mirabilis bacteriophage, said composition comprising at least said proteus mirabilis bacteriophage (Proteus mirabilis phage) ZDPM-P1.
Further, the composition also contains one or more of the following phages: proteus mirabilis phage (Proteus mirabilis phage) PMP2 with a preservation number of CCTCC M2021671; coliphage (ESCHERICHIA COLI PHAGE) EC35P1 with preservation number of CCTCC NO: M2020438; salmonella phage (Salmonella pullorum phage) SG8P3 with a preservation number of CCTCC NO: M2020205; staphylococcus aureus phage (Staphylococcus aureus phage) J1P2 with a preservation number of CCTCC NO: M2016185.
Through the technical scheme, the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 and other phages are combined to obtain a better killing effect on target bacteria. Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 and compositions thereof can be used to treat and prevent bacterial infections caused by Proteus mirabilis, and are not limited to Proteus mirabilis; and can be used as a biological agent for controlling bacterial diseases caused by Proteus mirabilis, and is not limited to Proteus mirabilis. As an exemplary illustration, the proportional relationship between the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 and other phages can be determined by one skilled in the art in combination with the present invention and the actual field of application and general knowledge in the art.
The composition further comprises a chemical disinfectant. Preferably, the chemical disinfectant is aqueous chlorine dioxide solution with the mass concentration of 0.0002% or the novel Jieli with the mass concentration of 0.01%.
The Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 and other antibacterial agents are mixed for use, so that the antibacterial broad spectrum can be obtained, and meanwhile, the Proteus mirabilis can be specifically killed. Antibacterial agents that can be used herein in combination with the phage in the present protocol include, but are not limited to, antibiotics and chemical antibacterial agents. As an exemplary illustration, the proportional relationship between the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 and other antibacterial agents can be determined by one skilled in the art in combination with the present invention and the actual field of application and general knowledge in the art.
A third object of the present invention is to provide a kit comprising said Proteus mirabilis bacteriophage. The technical proposal is as follows:
A kit comprising said amoeba mirabilis phage, said kit comprising a composition of said amoeba mirabilis phage (Proteus mirabilis phage) ZDPM-P1 or said amoeba mirabilis phage (Proteus mirabilis phage) ZDPM-P1.
A fourth object of the present invention is to provide the use of said Proteus mirabilis phage. The technical proposal is as follows:
The application of the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 in biological bactericides and disinfectants.
By adopting the technical scheme, the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 can be used as a daily bactericide, and can specifically kill Proteus mirabilis in the environment and improve the microbial distribution in the environment; the microbial inoculum can also be used as a biological bactericide for livestock and poultry product cultivation, transportation and preservation, and is used for preventing and treating pathogenic Proteus mirabilis pollution in the livestock and poultry cultivation, transportation and preservation process; can also be mixed with other bactericides for use, and sprayed on food production workshops to prevent and treat pollution caused by Proteus mirabilis and other bacteria in the food processing process.
The application of the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 in preparing a therapeutic drug or a health-care product for bacterial infection caused by Proteus mirabilis.
By adopting the technical scheme, the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 can be used for treating and preventing bacterial infection caused by Proteus mirabilis, and is not limited to the bacterial infection caused by Proteus mirabilis.
The application of the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 in preparing medical equipment for treating and preventing bacterial infection caused by Proteus mirabilis.
By adopting the technical scheme, the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 and the composition thereof can be used for preparing medical equipment, and the medical equipment is used for treating and preventing bacterial infection caused by Proteus mirabilis and is not limited to the bacterial infection caused by Proteus mirabilis.
The beneficial effects are that: the invention has the following beneficial effects:
(1) The Proteus mirabilis bacteriophage (Proteus mirabilis phage) ZDPM-P1 has good acid resistance, can grow normally in a 6mg/L peracetic acid solution and can lyse host bacteria efficiently.
(2) The Proteus mirabilis bacteriophage (Proteus mirabilis phage) ZDPM-P1 sample is convenient to obtain, has high toxicity to host bacteria, has MOI of 0.001, can complete mass proliferation with a small amount of initial phage, and provides a high-quality phage strain source for industrial production of phage bactericides.
(3) The phage of the Proteus mirabilis (Proteus mirabilis phage) ZDPM-P1 has the sterilization rate of 10 5～106 PFU/mL of phage to Proteus mirabilis with the concentration of 10 2～103 PFU/mL in the Proteus mirabilis culture medium of more than 95%, and has broad-spectrum sterilization capability to Proteus mirabilis.
(4) The Proteus mirabilis bacteriophage (Proteus mirabilis phage) ZDPM-P1 has good high-temperature resistance and long-term stability, the potency of the Proteus mirabilis bacteriophage is not reduced in the water bath at 65 ℃ for 2 hours, and the potency of the Proteus mirabilis bacteriophage still has 10 6 PFU/mL in the water bath at 75 ℃ for 2 hours; when the phage ZDPM-P1 is stored at 25 ℃ and 30 ℃ for a long time respectively, the survival rate of phage ZDPM-P1 is reduced, but the recognition capability of the phage to host bacteria is not reduced with time; phage ZDPM-P1 can be stored at 4℃for a long period of time.
(5) The Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 is a virulent phage separated from nature, and toxicity experiments prove that the phage is safe and has no side effect; the test phage DNA cannot encode proteins that may pose potential health risks and does not contain virulence genes or undesirable genes; the invention did not make any genetic modification to the test phage.
(6) The Proteus mirabilis bacteriophage (Proteus mirabilis phage) ZDPM-P1 has good high-temperature resistance and long-term stability, the potency of the Proteus mirabilis bacteriophage is not reduced in the water bath at 65 ℃ for 2 hours, and the potency of the Proteus mirabilis bacteriophage still has 10 6 PFU/mL in the water bath at 75 ℃ for 2 hours; when the phage ZDPM-P1 is stored at 25 ℃ and 30 ℃ for a long time respectively, the survival rate of phage ZDPM-P1 is reduced, but the recognition capability of the phage to host bacteria is not reduced with time; phage ZDPM-P1 can be stored at 4℃for a long period of time.
(7) The Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 of the invention can be used to prepare compositions, reagents, or kits;
(8) The Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 can be used singly or in combination as a biological bactericide, a feed additive or a therapeutic drug, a health product and a medical instrument for bacterial infection caused by Proteus mirabilis.
(9) The Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 can be applied to industrial production, can be specifically amplified by host bacteria, can be highly purified by a standard virus purification method, and has excellent popularization prospect;
(10) The product forms of the invention can include, but are not limited to, being applied to the body surface, mouth, rectum, pleura interior, etc. of the host to be controlled in the form of carrier carrying, concentrated injection, or drug infusion, etc.; as one embodiment, the carrier-carrying forms include, but are not limited to, oral aqueous carriers, oral anhydrous carriers, cream formulations, and the like; concentrated injection forms include, but are not limited to, vaccine injection, pleural cavity injection, transvenous injection, and the like; the form of medicament infusion includes, but is not limited to, aerosols, rinse agents, and the like.
(11) The Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 and its composition of the present invention can be prepared by a person skilled in the art according to the description of the present invention and general knowledge in the art into a biopharmaceutical that can be applied to control of diseases caused by Proteus mirabilis, and is not limited to Proteus mirabilis.
Drawings
FIG. 1 is a schematic representation of Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 plaque.
FIG. 2 is a schematic representation of the morphological structure of Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 under a transmission electron microscope.
FIG. 3 is the tolerance of Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 to peracetic acid.
FIG. 4 is the stability of Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 to survive different storage temperatures.
Detailed Description
The invention will be further explained with reference to examples. The invention may be better understood with reference to the following examples. However, those skilled in the art will readily appreciate that the specific material ratios, process conditions, and results thereof described in the examples are merely illustrative of the present invention.
In the examples below, the strain numbers referred to are all named numbers of the company.
Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 has a preservation number of CCTCC NO: M2022475, a preservation unit of China center for type culture Collection, and a preservation address of 2022 years, 04 months and 25 days in eight paths 299 of Wuchang district of Wuhan, hubei province.
Proteus mirabilis phage (Proteus mirabilis phage) PMP2 has a preservation number of CCTCC NO: M2021671, a preservation unit of China center for type culture Collection, a preservation address of eight paths 299 of Wuchang district of Wuhan, hubei province, and a preservation time of 2021, 06 and 04 days. The invention is described in the patent CN115161288A, namely acid-resistant and high-temperature-resistant Proteus mirabilis phage, a composition, a kit and application thereof.
Coliphage (ESCHERICHIA COLI PHAGE) EC35P1 with a preservation number of CCTCC NO: M2020438, a preservation unit of China center for type culture Collection, a preservation address of eight paths 299 of Wuchang district of Wuhan, hubei province, and a preservation time of 2020, 8 months and 20 days. The invention is described in the patent CN112680423A, which discloses a broad-spectrum coliphage capable of simultaneously lysing four bacteria, and a composition, a kit and application thereof.
Salmonella phage (Salmonella pullorum phage) SG8P3 with a preservation number of CCTCC NO: M2020205, the preservation unit is China center for type culture Collection, the preservation address is in the eighth path 299 of Wuchang district of Wuhan, hubei province, and the preservation time is 2016, 6, 12 days. The salmonella bacteriophage and the composition thereof are recorded in the patent publication No. CN112029732A, namely, a salmonella bacteriophage with high temperature resistance and wide cracking spectrum.
Staphylococcus aureus phage (Staphylococcus aureus phage) J1P2 with a preservation number of CCTCC NO: M201685, a preservation unit of China center for typical culture collection, a preservation address of the eight-path 299 of Wuchang district of Wuhan, hubei province, and a preservation time of 2016 years, 5 months and 26 days. The invention is described in the patent CN107779439A of the invention, "novel staphylococcal phage and its composition, preparation method and application".
In the following examples of the present invention,
The formula of the LB liquid medium is as follows: 10g of tryptone, 5g of yeast extract, 10g of sodium chloride, 1000mL of distilled water and pH 7.0.
The formula of the LB solid medium is as follows: 10g of tryptone, 5g of yeast extract, 10g of sodium chloride, 15g of agar, 1000mL of distilled water and pH 7.0.
The semisolid agar medium comprises the following formula: 10g of tryptone, 5g of yeast extract, 10g of sodium chloride, 7g of agar, 1000mL of distilled water and pH 7.0.
The SM buffer solution formula is as follows: 5.8g of sodium chloride, 2g of magnesium sulfate, 50mL of 1mol/L Tris-HCl, 0.25g of gelatin and 1000mL of distilled water.
Compositions 1-9 of Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1, proteus mirabilis phage (Proteus mirabilis phage) PMP2, E.coli phage (ESCHERICHIA COLI PHAGE) EC35P1, salmonella phage (Salmonella pullorum phage) SG8P3, and Staphylococcus aureus phage (Staphylococcus aureus phage) J1P2 were prepared as described in example 9.
Composition 9 of Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1, chlorine dioxide at a final mass concentration of 0.0002% was prepared as described in example 9.
EXAMPLE 1 screening and purification of phages
Sample collection and processing
The sample in the invention is collected from urban sewage of Jiangsu Nanjing.
The collected sample was centrifuged at 5000r/min for 10min and filtered through a 0.22 μm filter.
Phage enrichment against Proteus mirabilis of interest in sample (II)
The above filtrate was mixed with 2-fold LB liquid medium at a ratio of 1:1, inoculated with 100. Mu.L of the target Proteus mirabilis strain, and enriched overnight.
Phage selection and purification
Centrifuging the enrichment solution, taking supernatant, passing through a 0.22 mu m membrane, taking 1mL of the supernatant and 5mL of LB semisolid culture medium containing target Proteus mirabilis, uniformly mixing, pouring the mixture onto a culture dish containing LB solid culture medium, culturing overnight at 37 ℃ after the semisolid culture medium is solidified, observing whether plaques exist the next day, and recording an experimental result.
The single plaque is picked up in 1mL SM buffer solution, vibrated for 15min at 150rpm, diluted in a gradient way, the diluted solution is evenly mixed with 5mL LB semisolid culture medium containing target Proteus mirabilis, poured onto a culture dish containing LB solid culture medium, and cultured overnight at 37 ℃ after the semisolid culture medium is solidified. This step was repeated 3 to 5 times to obtain a phage monoclonal sample designated Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1). The form of the Proteus mirabilis bacteriophage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) is shown in figure 2, and the form is a polyhedral symmetrical head and a telescopic tail, wherein the diameter of the head is 85-95 nm, the length of the tail is 105-115 nm, and the diameter of the tail is 6-10 nm. In the figure, the diameter of the head of the Proteus mirabilis bacteriophage ZDPM-P1 is 90nm, the tail length is 112nm, and the diameter of the tail is 8nm. The phage has a nucleotide sequence shown as SEQ ID No. 1. The sequence of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) was aligned on the NCBI website and combined with transmission electron microscopy observations to obtain phage belonging to the Myoglycetaceae (Myoviridae) family.
(IV) phage particle preparation
The Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) was amplified using a host strain, after the medium was clarified, 8000g was centrifuged for 10min, the impurities were removed, solid polyethylene glycol (PEG 8000) was added to a final concentration of 10% (w/v), dissolved with stirring, overnight at 4℃and 8000g centrifuged for 20min at 4℃and the pellet resuspended in SM buffer. The phage suspension obtained was stored at 4℃until use.
Example 2 determination of the optimal multiplicity of infection (MOI) of phage
(1) Determination of Proteus mirabilis phage titers
Stock solution of Proteus mirabilis phage ZDPM-P1 (prepared in example 1) was serially diluted 10-fold to l0 8 -fold using SM solution as diluent. Taking L000 mu L of phage culture solution with dilutions of L0 5、l06、l07 and L0 8 respectively, uniformly mixing with 300 mu L of host bacterial solution, and standing for 15min to enable the phage culture solution to be fully combined with receptors on the surface of bacteria. Adding the mixed solution into 5mL of semi-solid agar culture medium cooled to 50 ℃, uniformly mixing, immediately spreading on a solidified solid agar plate, and after agar solidification, inversely culturing for 6-8 h at 37 ℃. Three replicates were made for each dilution and the average of the three replicates for this dilution was taken at the time of counting. Wherein phage titer (PFU/mL) =average plaque number x dilution fold
(II) determination of optimal multiplicity of infection (MOI) of Proteus mirabilis phage
And selecting single bacterial colony of Proteus mirabilis, inoculating into a test tube containing 3mL of LB culture solution, and carrying out shaking culture at 37 ℃ and 150rpm for 8 hours to obtain host bacterial suspension. The bacterial suspension was transferred to l0mL LB medium at a ratio of 1:100 and cultured with shaking at 37℃at 150rpm until the logarithmic phase. Pure culture of Proteus mirabilis phage PMP1 (prepared in example 1) and host bacteria (MOI = number of phages/number of bacteria) were added in the ratio of multiplicity of infection, and LB liquid medium was added to make the total volume of each tube the same. Shake-culture at 150rpm in a shaker at 37℃for 8h. After the culture, 5000g was centrifuged for 0min and the supernatant was collected to determine phage titer. Each point was averaged in duplicate replicates to produce the highest phage titer MOI as the optimal multiplicity of infection. Experiments were repeated 3 times.
TABLE 1 titers of Proteus mirabilis phage ZDPM-P1 at different infectious complex numbers
As a result, as shown in Table 1, the MOI of Proteus mirabilis phage ZDPM-P1 reached the highest titer (3.0X10 11 PFU/mL) at 1:1000. The method has the advantages of small initial input amount and high propagation speed, and can be applied to industrial production.
EXAMPLE 3 test for detecting deletion of virulence Gene or adverse Gene of Proteus mirabilis phage ZDPM-P1
In this example, 103 virulence genes identified as originating from lysogenic phages in pathogenic bacteria were selected as shown in Table 2, and the whole genome of Proteus mirabilis phage ZDPM-P1 was determined and subjected to bioinformatic analysis to determine whether it contained the following virulence genes. The results show that Proteus mirabilis phage ZDPM-P1 does not contain the following virulence genes or adverse genes, and therefore cannot encode proteins that may pose a potential health risk, and therefore Proteus mirabilis phage ZDPM-P1 does not affect the health of the human or animal body.
TABLE 2 major known virulence genes of lysogenic phages in pathogenic bacteria
/>
/>
Example 4 toxicity experiments
The experimental mice were divided into two groups (phage group, control group) at random after three days of adaptive breeding, 10 groups (5 groups each) were given with phage group comprising Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) (prepared in example 2) of 10 10 PFU/kg, control group was given with an equivalent amount of physiological saline, and the experimental mice were sacrificed by neck breakage and examined for visceral conditions after 15 days of adaptive breeding.
Experimental results show that this dose of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) has no effect on the daily behavior of mice. No abnormality was seen in the dissected examination viscera. The Proteus mirabilis bacteriophage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) has biological safety and can be applied to feed additives. Of course, proteus mirabilis phage ZDPM-P1 can also be used as a health product or a medicament, and is safe in the toxicity test.
Example 5 Heat stability test of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1)
Mu.L of each phage pure culture (prepared in example 2) was placed in sterile EP tubes and allowed to act for 2h, 24h, 48h in a water bath at 55deg.C, 65deg.C and 75deg.C, respectively. After the action time is over, the sample tube is taken out and immediately placed in an ice bath for cooling, and phage titer is measured by adopting a double-layer flat plate method after proper dilution. Experiments were repeated 3 times.
TABLE 3 titers of Proteus mirabilis phage ZDPM-P1 at different temperatures
The results are shown in Table 3, in the experimental group, proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) was more viable at 55 ℃. Proteus mirabilis bacteriophage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) has good high temperature resistance, and compared with a control, the potency of the phage in water bath at 65 ℃ for 2 hours is not reduced, and the potency in water bath at 75 ℃ for 2 hours still has 10 6 PFU/mL.
Example 6: acid resistance test of Proteus mirabilis phage ZDPM-P1
1. Phage counting method: the procedure is as described in example 2.
2. A sample of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) (prepared in example 2) having a titer of 9.3X10 10 PFU/mL was adjusted to pH 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, and the titers were measured after treatment for 1h, 4h, 8h, 24h, 96h, respectively. The test results are shown in Table 4.
TABLE 4 stability of Proteus mirabilis phage ZDPM-P1 at different pH conditions
The results show that: proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) still has a titer of 10 2 PFU/mL after being treated for 24 hours under the condition of pH=1.0, and can stably maintain higher titer after being treated for 96 hours under the condition of pH 2.0-8.0. Proteus mirabilis phage ZDPM-P1 is extremely resistant to acidic environments, proving that it can withstand low pH environments.
Example 7: determination of Proteus mirabilis phage ZDPM-P1 for Peroxyacetic acid tolerance
1. Phage counting method: the procedure is as described in example 2.
2. The peracetic acid is diluted with LB liquid medium to prepare a peracetic acid solution with the concentration of 6mg/L, then 900 mu L of each peracetic acid solution with the concentration is placed in a sterile EP tube, and L00 mu L of phage ZDPM-P1 filtrate (3.7X10 9 PFU/mL) (prepared in example 2) is added; 900. Mu.L of SM solution was placed in a sterile EP tube, and then, 00. Mu.L of phage ZDPM-P1 filtrate (3.7X10 9 PFU/mL) was added thereto as a control, and the above-mentioned treatments were thoroughly mixed and allowed to stand at room temperature. Phage ZDPM-P1 titers were determined every 0.5h samples, up to 6h. The test results are shown in FIG. 3.
The results show that Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) still has more than 70% survival rate when treated in a 6mg/L peroxyacetic acid solution for 6 hours. It was demonstrated that phage ZDPM-P1 had a certain tolerance to low concentrations of peracetic acid.
Example 8: survival stability test of Proteus mirabilis phage ZDPM-P1
5ML of pure culture solution (5.7X10 9 PFU/mL) of phage ZDPM-P1 was taken in sterile test tubes (prepared in example 2), placed at 4℃and 25℃respectively, and phage titers were determined by a double-layer plate method after regular dilution.
As shown in FIG. 4, the value of Proteus mirabilis phage ZDPM-P1 was not reduced by 50 weeks in storage at 4deg.C; the titer of phage ZDPM-P1 after storage at 25 ℃ for 12 weeks is still 10 9 PFU/mL, and the titer of phage ZDPM-P1 after storage for 30 weeks is still 1.2x10 4 PFU/mL; phage ZDPM-P1 can maintain the titer of 10 8 PFU/mL and above within 16 weeks at 30deg.C, and can be completely deactivated after storage for 28 weeks; phage ZDPM-P1 has stronger lysis ability to host bacteria at all preservation temperatures. The test phage ZDPM-P1 was suitably stored at 4 ℃.
Example 9: preparation of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) and Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) compositions
Preparation of Proteus mirabilis phage PMP2 (Proteus mirabilis phage PMP 2) stock solution: the Proteus mirabilis phage PMP2 host bacteria were inoculated into a conical flask containing 500mL of LB medium, and when the OD value was 0.2 by shaking culture at 37℃at 150rpm, 1000PFU/mL Proteus mirabilis phage PMP2 (Proteus mirabilis phage PMP 2) was added thereto, and shaking culture was performed at 37℃at 150rpm for 12 hours. The fermentation broth was centrifuged at 8000rpm for 15min and the supernatant was filtered with a 0.22 μm filter to obtain a Proteus mirabilis bacteriophage PMP2 stock.
Preparation of Salmonella pullorum phage SG4P1 (Salmonella pullorum phage SG P1) stock solution: salmonella pullorum bacterial SG4P1 host bacteria are inoculated into a conical flask containing 500mL of LB culture medium, when the culture medium is shake-cultivated at 37 ℃ at 150rpm until the OD value is 0.2, 1000PFU/mL of Salmonella pullorum bacterial SG4P1 (Salmonella pullorum phage SG4P 1) is added to the culture medium, and shake-cultivated at 37 ℃ at 150rpm for 12 hours. Centrifuging the fermentation broth at 8000rpm for 15min, and filtering the supernatant with a 0.22 μm filter membrane to obtain Salmonella pullorum phage SG4P1 stock solution.
Preparation of E.coli phage EC35P1 (ESCHERICHIA COLI PHAGE EC P1) stock solution: e.coli phage EC35P1 host bacteria were inoculated into conical flasks containing 500mL LB medium, and when shaking culture was performed at 37℃at 150rpm to an OD value of 0.2, 1000PFU/mL E.coli phage EC35P1 (ESCHERICHIA COLI PHAGE EC P1) was added thereto, and shaking culture was performed at 37℃at 150rpm for 12 hours. The fermentation broth was centrifuged at 8000rpm for 15min, and the supernatant was filtered with a 0.22 μm filter membrane to obtain E.coli phage EC35P1 stock solution.
Preparation of staphylococcus aureus phage J1P1 (Staphylococcus aureus phage J P1) stock: staphylococcus aureus phage J1P1 host bacteria were inoculated into a conical flask containing 500mL of LB medium, and when shaking culture was performed at 37℃at 150rpm to an OD value of 0.2, 1000PFU/mL Staphylococcus aureus phage J1P1 (Staphylococcus aureus phage J1P 1) was added thereto, and shaking culture was performed at 37℃at 150rpm for 12 hours. The fermentation broth was centrifuged at 8000rpm for 15min, and the supernatant was filtered with a 0.22 μm filter membrane to obtain a Staphylococcus aureus phage J1P1 stock solution.
Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) (prepared in example 2) and Proteus mirabilis phage PMP2 (Proteus mirabilis phage PMP 2) were prepared by mixing 2 phages in equal volumes to prepare a 1:1 composition (composition 1) of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) and Proteus mirabilis phage PMP2 (Proteus mirabilis phage PMP 2), respectively, in titers of 1X10 9 PFU/mL.
Stock solutions of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) (prepared in example 2) and Salmonella pullorum phage SG4P1 (Salmonella pullorum phage SG P1) were taken at titers of 1X10 9 PFU/mL, respectively, and 2 phages were homogeneously mixed in equal volumes to prepare a 1:1 composition (composition 2) of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) and Salmonella pullorum phage SG4P1 (Salmonella pullorum phage SG4P 1).
A1:1 composition (composition 3) of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) and E.coli phage EC35P1 (ESCHERICHIA COLI PHAGE EC P1) was prepared by uniformly mixing 2 phages in equal volumes with a stock solution of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) (prepared in example 2) and E.coli phage EC35P1 (ESCHERICHIA COLI PHAGE EC P1) having titers of 1X10 9 PFU/mL, respectively.
A1:1 composition (composition 4) of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) and Staphylococcus aureus phage J1P1 (Staphylococcus aureus phage J1P 1) was prepared by uniformly mixing 2 phages in equal volumes with stock solutions of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) (prepared in example 2) and Staphylococcus aureus phage J1P1 (Staphylococcus aureus phage J1P 1) having titers of 1X10 9 PFU/mL, respectively.
Stock solutions of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1), proteus mirabilis phage PMP2 (Proteus mirabilis phage PMP) and Salmonella pullorum phage SG4P1 (Salmonella pullorum phage SG4P 1) with titers of 1x10 9 PFU/mL respectively were taken, and 3 phages were uniformly mixed in an equal volume of 1:1:1 to prepare a composition (composition 5).
Stock solutions of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1), proteus mirabilis phage PMP2 (Proteus mirabilis phage PMP), salmonella pullorum phage SG4P1 (Salmonella pullorum phage SG4P 1) and E.coli phage EC35P1 (ESCHERICHIA COLI PHAGE EC P1) with titers of 1x10 9 PFU/mL respectively were taken, and 4 phages were homogeneously mixed in equal volumes of 1:1:1:1 to prepare a composition (composition 6).
Stock solutions of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1), salmonella pullorum phage SG4P1 (Salmonella pullorum phage SG4P 1), E.coli phage EC35P1 (ESCHERICHIA COLI PHAGE EC P1) and Staphylococcus aureus phage J1P1 (Staphylococcus aureus phage J1P 1) with titers of 1x10 9 PFU/mL respectively were taken, and 4 phages were uniformly mixed in equal volumes of 1:1:1:1 to prepare a composition (composition 7).
Stock solutions of Proteus mirabilis bacteriophage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1), proteus mirabilis bacteriophage PMP2 (Proteus mirabilis phage PMP 2), salmonella pullorum bacteriophage SG4P1 (Salmonella pullorum phage SG P1), escherichia coli bacteriophage EC35P1 (ESCHERICHIA COLI PHAGE EC35P 1) and Staphylococcus aureus bacteriophage J1P1 (Staphylococcus aureus phage J P1) having titers of 1x10 9 PFU/mL were respectively taken, and 5 phages were uniformly mixed in equal volumes of 1:1:1:1:1:1:1 to prepare a composition (composition 8).
The phage Proteus mirabilis ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) and chlorine dioxide with a final concentration of 0.0002% were uniformly mixed in an equal volume of 1:1 to prepare a composition (composition 9) at a titer of 1X10 9 PFU/mL, respectively.
EXAMPLE 10 Bactericidal effects of Proteus mirabilis phage ZDPM-P1 and compositions thereof in liquid
1. Proteus mirabilis counting method
BS proteus mirabilis selective medium is adopted, the bacterial colony is counted by a dilution coating method, and is cultivated for 24 hours at 37 ℃, and the bacterial colony with black metallic luster is a positive bacterial colony.
2. Bactericidal effect experiment of Proteus mirabilis bacteriophage ZDPM-P1 in liquid
Culturing Proteus mirabilis to logarithmic growth phase, subpackaging into different test tubes, diluting bacterial liquid with equal volume of liquid LB culture medium until the final concentration of Proteus mirabilis is 2.55x10 3 cfu/mL, inoculating into Proteus mirabilis bacteriophage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) with different concentrations, and setting the concentration of Proteus mirabilis bacteriophage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) in the sample as 1.79x102PFU/mL、1.79x103PFU/mL、1.79x104PFU/mL、1.79x105PFU/mL、1.79x106PFU/mL., wherein a control group and a blank group (CK) are simultaneously arranged, and the control group gives Proteus mirabilis with the final concentration of 2.55x10 3 cfu/mL; the blank group was given an equivalent amount of physiological saline. After 4 hours, the residual quantity of Proteus mirabilis was detected. The results are shown in Table 5.
TABLE 5 Bactericidal effects of Proteus mirabilis phages ZDPM-P1 at different concentrations in liquid
The results in table 5 show: when the concentration of the Proteus mirabilis bacteriophage ZDPM-P1 is 10 5～106 PFU/mL, the Proteus mirabilis bacteriophage ZDPM-P1 has the best sterilization effect on Proteus mirabilis in the liquid LB culture medium, and the sterilization rate is more than 95%. Shows that the Proteus mirabilis bacteriophage ZDPM-P1 has potential of being applied to biological bactericides.
1. Sterilization effect experiment of composition containing high-concentration Proteus mirabilis phage ZDPM-P1 in liquid
Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) composition 1-composition 9, and its preparation method is described in example 9.
Culturing Proteus mirabilis to logarithmic growth phase, subpackaging into different test tubes, diluting bacterial liquid with liquid LB culture medium to make the final concentration of Proteus mirabilis be 2.55x10 3 cfu/mL, inoculating composition 1-composition 9 with Proteus mirabilis bacteriophage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) with the final concentration of 1.79x10 6 PFU/mL. A control group and a blank group (CK) are set, and the control group is given with the Proteus mirabilis with the final concentration of 2.55x10 3 cfu/mL; the blank group was given an equivalent amount of physiological saline. After 4 hours, the residual quantity of the Proteus mirabilis is detected, and the detection method is shown in step 1 of the embodiment. The results are shown in Table 6.
TABLE 6 sterilizing Effect of compositions containing high concentration Proteus mirabilis phage ZDPM-P1 in liquid
Table 6 test results show that: when the concentration of the Proteus mirabilis bacteriophage ZDPM-P1 is 1.79x10 6 PFU/mL, the composition with the Proteus mirabilis bacteriophage ZDPM-P has good sterilization effect and has no antagonism on other combined components. The composition of Proteus mirabilis phage ZDPM-P1 has potential for application as a biological bactericide.
EXAMPLE 11 Proteus mirabilis phage ZDPM-P1 and composition thereof for control of Proteus mirabilis contamination during preservation of chicken samples
1. Phage counting method: the procedure is as described in example 2.
2. The method for counting the Proteus mirabilis comprises the following steps: the procedure is as described in example 10.
3. Preparation method of composition 1 to composition 9: the procedure is as described in example 9.
4. The autoclaved chicken breast was cut into 1cm square cubes 60 pieces, each of which was divided into 12 groups (single phage ZDPM-P1 group, composition 1, composition 2, composition 3, composition 4, composition 5, composition 6, composition 7, composition 8, composition 9, control group and blank group), 5 pieces each, and placed in a sterile dish. Each experimental group was inoculated with 1.5x10 5 CFU of proteus mirabilis and a dose of 1.5x10 8 PFU/kg of phage tested; inoculating 1.5x10 5 CFU of Proteus mirabilis and equal amount of sterile water into each control group; the blank group was given an equivalent amount of sterile physiological saline. Each treatment was placed in an incubator at 37℃for cultivation. Every 2 hours, a piece of chicken is placed in 10mL of sterile water, and the chicken is fully vibrated, so that the content of Proteus mirabilis in the liquid is measured, and the results are shown in Table 7.
TABLE 7 control results of Proteus mirabilis phage ZDPM-P1 and its composition on Proteus mirabilis contamination during preservation of chicken samples
Table 7 the results show that: after 8 hours, a large amount of Proteus mirabilis grows on the chicken surface of the control group; in each experimental group, the Proteus mirabilis on the surface of chicken was always controlled at an extremely low level due to the addition of Proteus mirabilis phage ZDPM-P1 and the combination thereof. The Proteus mirabilis bacteriophage ZDPM-P1 and the composition thereof can be used as biological bactericides to effectively kill Proteus mirabilis on the surface of chicken and prevent and treat pollution of Proteus mirabilis in the storage process of the chicken.
EXAMPLE 12 preparation and use of kit of Proteus mirabilis phage ZDPM-P1 and compositions thereof
The kit contains 5-10 mL of a composition of the Proteus mirabilis bacteriophage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) or the Proteus mirabilis bacteriophage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) with the titer of 4 multiplied by 10 9, 1L of LB semisolid culture medium and 1L of LB solid culture medium.
The using method of the kit comprises the following steps: the split spectrum of the test phage was determined by double-layer plate drop method using phage liquid of Proteus mirabilis ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) or phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) composition having a titer of 4X 10 9 PFU/mL. And selecting single bacterial colony to be detected, inoculating the single bacterial colony to be detected into a target liquid culture medium, and carrying out shake culture under the condition of combining the growth characteristics of the strain to be detected at the target temperature to prepare bacterial liquid of the strain to be detected. mu.L of bacterial suspension of the strain to be detected is respectively mixed with 5mL of LB semi-solid culture medium and paved on an LB solid plate, and 10 mu.L of liquid of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) or composition of Proteus mirabilis phage ZDPM-P1 (Proteus mirabilis phage ZDPM-P1) is dripped on the plate. And (3) culturing at a target temperature according to the growth characteristics of the strain to be detected after natural air drying, and observing the result.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (12)

1. A proteus mirabilis bacteriophage, comprising: the Proteus mirabilis bacteriophage is Proteus mirabilis bacteriophage (Proteus mirabilis phage) ZDPM-P1, the preservation number is CCTCC NO: M2022475, and the Proteus mirabilis bacteriophage has a nucleotide sequence shown as SEQ ID No. 1.
2. The Proteus mirabilis bacteriophage of claim 1, wherein: the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 is cultured for 8-10 h under the condition of MOI=0.001, and the titer is 3.0X10 11 PFU/mL.
3. The Proteus mirabilis bacteriophage of claim 1, wherein: the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 has tolerance to peracetic acid and still has more than 70% survival rate after being treated in a 6mg/L peracetic acid solution for 6 hours.
4. The Proteus mirabilis bacteriophage of claim 1, wherein: the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1 has tolerance to temperature, the potency of which is not reduced by orders of magnitude in water bath at 65 ℃ for 2 hours, and has stability at different temperatures.
5. A composition comprising the Proteus mirabilis bacteriophage of any one of claims 1 to 4, characterized in that it comprises: the composition contains at least the Proteus mirabilis phage (Proteus mirabilis phage) ZDPM-P1.
6. The composition of claim 5, wherein: the composition also contains one or more of the following phages: proteus mirabilis phage (Proteus mirabilis phage) PMP2 with a preservation number of CCTCC M2021671; coliphage (ESCHERICHIA COLI PHAGE) EC35P1 with preservation number of CCTCC NO: M2020438; salmonella phage (Salmonella pullorum phage) SG8P3 with a preservation number of CCTCC NO: M2020205; staphylococcus aureus phage (Staphylococcus aureus phage) J1P2 with a preservation number of CCTCC NO: M2016185.
7. The composition of claim 5, wherein: the composition further comprises a chemical disinfectant.
8. The composition of claim 7, wherein: the chemical disinfectant is aqueous chlorine dioxide solution with the mass concentration of 0.0002% or the benzalkonium bromide with the mass concentration of 0.01%.
9. A kit comprising the Proteus mirabilis bacteriophage of any one of claims 1 to 4.
10. Use of the proteus mirabilis bacteriophage of any one of claims 1 to 4 in a biological bactericide or disinfectant.
11. Use of a proteus mirabilis bacteriophage according to any one of claims 1 to 4 for the preparation of a medicament or health product for the treatment of bacterial infections caused by proteus mirabilis.
12. Use of a proteus mirabilis bacteriophage according to any one of claims 1to 4 for the preparation of a medical device for the treatment and prevention of bacterial infections caused by proteus mirabilis.
CN202410152406.5A 2024-02-03 2024-02-03 Proteus mirabilis bacteriophage, composition and kit thereof and application of phage Pending CN118126959A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410152406.5A CN118126959A (en) 2024-02-03 2024-02-03 Proteus mirabilis bacteriophage, composition and kit thereof and application of phage

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410152406.5A CN118126959A (en) 2024-02-03 2024-02-03 Proteus mirabilis bacteriophage, composition and kit thereof and application of phage

Publications (1)

Publication Number Publication Date
CN118126959A true CN118126959A (en) 2024-06-04

Family

ID=91229484

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410152406.5A Pending CN118126959A (en) 2024-02-03 2024-02-03 Proteus mirabilis bacteriophage, composition and kit thereof and application of phage

Country Status (1)

Country Link
CN (1) CN118126959A (en)

Similar Documents

Publication Publication Date Title
CN112029732B (en) High-temperature-resistant salmonella bacteriophage with wide lysis spectrum and composition thereof
CN112680423B (en) Wide-spectrum escherichia coli bacteriophage capable of simultaneously cracking four bacteria and composition, kit and application thereof
CN113416712B (en) Wide lysis spectrum salmonella bacteriophage and application thereof
CN110846283B (en) Escherichia coli bacteriophage with wide lysis spectrum, and composition, kit and application thereof
CN113337480B (en) Broad-spectrum coliphage and application thereof
CN113430176B (en) Stable and efficient salmonella furnacalis bacteriophage RDP-SA-21004 and application thereof
CN113755450B (en) Escherichia coli phage GN4-1 and application thereof
CN113583971B (en) Salmonella bacteriophage capable of simultaneously cracking escherichia coli and application thereof
CN105331587A (en) Vibrio parahaemolyticus phage and preparation method and application thereof
CN111647567B (en) Acid-resistant salmonella bacteriophage and composition, kit and application thereof
CN115717126A (en) Duck drug-resistant escherichia coli bacteriophage, bacteriophage composition and application thereof
CN115612675A (en) Salmonella phage nct1 and application thereof
CN111363724B (en) Novel bacteriophage, bacteriophage mixed preparation and application of novel bacteriophage and bacteriophage mixed preparation in medicine for preventing and treating hemorrhagic pneumonia of mink
KR20210142679A (en) High Temperature Tolerant Salmonella Phage with Wide Dissolution Spectrum and Combinations thereof
CN116083374A (en) High Wen Ji-resistant salmonella pullorum bacteriophage, bacteriophage composition and application thereof
CN113444695B (en) Escherichia coli bacteriophage with high fermentation efficiency and good clinical effect and application thereof
CN114940977A (en) Salmonella anatipestifer bacteriophage, bacteriophage composition thereof and application of salmonella anatipestifer bacteriophage in prevention and treatment of salmonella anatipestifer infection diseases
CN118126959A (en) Proteus mirabilis bacteriophage, composition and kit thereof and application of phage
CN111187757A (en) Escherichia coli bacteriophage and application thereof, and bactericidal composition and application thereof
CN115161288B (en) Acid-resistant and high-temperature-resistant Proteus mirabilis bacteriophage, composition and kit thereof, and application of acid-resistant and high-temperature-resistant Proteus mirabilis bacteriophage
CN117737001B (en) Coliphage for preventing and treating canine bacterial diarrhea and application thereof
CN113528461B (en) Isolated aeromonas salmonicida phage, compositions and uses thereof
CN118147088B (en) Pseudomonas aeruginosa phage composition, phage preparation and application thereof
CN118406661A (en) Riemerella anatipestifer phage and composition, kit and application thereof
CN113528470B (en) T4SS targeted phage vB _ EcoM _ X4 and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination