CN118126174A

CN118126174A - Anti-BP 230 high-affinity monoclonal antibody and application thereof

Info

Publication number: CN118126174A
Application number: CN202410551544.0A
Authority: CN
Inventors: 杨衡; 王雅楠; 冯素英; 李岷; 梁桂熔
Original assignee: Suzhou Fangke Biotechnology Co ltd; Suzhou Institute Of Systems Medicine; Institute of Dermatology and Skin Disease Hospital of CAMS
Current assignee: Suzhou Fangke Biotechnology Co ltd; Suzhou Institute Of Systems Medicine; Institute of Dermatology and Skin Disease Hospital of CAMS
Filing date: 2024-05-07
Publication date: 2024-06-04

Abstract

The invention provides an anti-BP 230 high-affinity monoclonal antibody and application thereof, wherein BP230 antigen protein is adopted to immunize experimental rabbits for multiple times, and serum titer test is carried out after immunization; and separating spleen tissue of high-titer rabbits and PBMC of peripheral blood, and carrying out single B cell sorting and culture; the positive clone was RNA-extracted and reverse transcribed into cDNA, and all of the antibody VH and VL gene fragments were amplified. The VH and VL gene fragments amplified in vitro are cloned into an expression vector containing a human IgG constant region for recombinant expression. And performing functional verification on the recombinant antibody by an ELISA method, and finally screening 6 humanized monoclonal antibodies with good specificity and strong affinity from the recombinant antibody.

Description

Anti-BP 230 high-affinity monoclonal antibody and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to an anti-BP 230 high-affinity monoclonal antibody and application thereof.

Background

Bullous Pemphigoid (BP) is an autoimmune disease that develops when the immune system attacks the skin and causes blisters, most commonly occurring in elderly people between 60 and 80 years of age. The clinical manifestations characteristic of this disease are tension blisters and severe generalized itching symptoms. Histopathologically, hematoxylin and Eosin (HE) staining was seen to accompany eosinophil infiltration in the subcuticular fissures, direct Immunofluorescence (DIF) was seen to deposit linearly deposited autoantibodies and/or complement along the basal membrane band, and salt split indirect immunofluorescence (ssIIF) was seen to deposit on the epidermal side.

The target antigens for autoantibodies in the patient's serum are BP180 and BP230, also known as BPAG and BPAG2, which have molecular weights of 180KD and 230KD, respectively. BP230 is a intracytoplasmic hemidesmoglein, and there are three main subtypes: skin subtype (BPAG-e), nerve subtype (BPAG-n and BPAG 1-a) and muscle subtype (BPAG-b). They have a certain homology in molecular structure, each with tissue specificity and different epitopes. Most BP sera reacted strongly positively with the different segments of BP230, especially the C-terminus. The N-terminus of BP230 is important for its binding to the hemidesmosome and interaction with the beta 4 subunit of BP180, alpha 6 beta 4 integrin. anti-BP 230 antibodies are believed to be secondary products, which exacerbate the inflammatory response. Thus, detecting anti-BP 230 antibody levels in BP patients is of great importance to aid in clinical diagnosis.

Monoclonal antibodies are widely used in the therapeutic, diagnostic and biological fields due to their high specificity and affinity. Currently, most monoclonal antibodies to human antigens are produced in mice, but many human immunogens do not stimulate the mice to produce an antibody response. Rabbits may respond to a wider range of antigens than other animal models, such as mice and rats. The rabbit immune system develops antibody diversity and optimizes affinity by a different mechanism than mice and other rodents. Thus, rabbits are excellent monoclonal antibody production hosts. In addition, rabbits are larger in size, have larger spleens, and can produce more antibodies. The preparation of rabbit monoclonal antibodies is an important research effort and can be used in a variety of applications including immunofluorescence, immunohistochemistry, flow cytometry, western blotting and ELISA. In the prior art, an anti-BP 230 monoclonal antibody has not been prepared yet.

BP is a common and refractory acquired autoimmune disease in which there are autoantibodies to hemidesmin in the patient's serum, anti-BP 180 and BP230. The diagnosis standard of BP comprises clinical manifestation, histopathology, direct immunofluorescence, indirect immunofluorescence and specific antibody examination, and adopts different treatment schemes according to the severity of illness, mainly depends on glucocorticoid, antibiotics, immunosuppressant and the like. At present, glucocorticoid is a first-line medicine for treating BP, and has obvious clinical curative effect, but a large number of complications can be caused by long-term use, and serious complications even prevent the use of the medicine by some patients clinically. Classical hybridoma technology requires a lot of time and effort to obtain high affinity antibodies, and requires subsequent humanized engineering, resulting in difficulty in obtaining humanized monoclonal antibodies and inability to absolutely quantify antibody levels. Therefore, the treatment modes lack of specificity, have poor curative effect and long treatment course.

In addition, development of immunotherapy in cancer patient populations may also trigger the onset of BP disease. PD-1/PD-L1 checkpoint inhibitors are widely used for treating various solid and hematological malignancies, and are a class of drugs which have been reported to induce BP in recent years. Most cases show blisters or bullae within 6-8 months after the onset of treatment with PD-1/PD-L1 inhibitors, and few cases show mucosal involvement. With the popularity of PD-1 immunotherapy, the future demand for BP detection will be increasing. However, how to quickly and accurately diagnose the diseases lacks effective detection means at present, so the method for detecting the diseases has important application value.

Disclosure of Invention

Aiming at the defects existing in the prior art, the invention aims to provide an anti-BP 230 high-affinity monoclonal antibody and application thereof. The anti-BP 230 high-affinity monoclonal antibody has high activity, good stability and stronger specificity, can be used as a reference standard for qualitatively detecting BP230 positivity, and can also quantitatively detect the level of the anti-BP 230 autoantibody in BP patients.

In order to achieve the aim of the invention, the invention adopts the following technical scheme:

in a first aspect, the present invention provides an anti-BP 230 high affinity monoclonal antibody comprising a heavy chain variable region and a light chain variable region;

the amino acid sequence of the heavy chain CDR1 of the monoclonal antibody is shown in any one of SEQ ID NO.1, SEQ ID NO.6, SEQ ID NO.11, SEQ ID NO.16 or SEQ ID NO. 22;

the amino acid sequence of the heavy chain CDR2 of the monoclonal antibody is shown in any one of SEQ ID NO.2, SEQ ID NO.7, SEQ ID NO.12, SEQ ID NO.17 or SEQ ID NO. 23;

The amino acid sequence of the heavy chain CDR3 of the monoclonal antibody is shown in any one of SEQ ID NO.3, SEQ ID NO.8, SEQ ID NO.13, SEQ ID NO.18 or SEQ ID NO. 24;

The amino acid sequence of the light chain CDR1 of the monoclonal antibody is shown in any one of SEQ ID NO.4, SEQ ID NO.9, SEQ ID NO.14 or SEQ ID NO. 19;

The amino acid sequence of the light chain CDR2 of the monoclonal antibody is selected from LAS, AAS, RAS, EAS or any one of SAS;

The amino acid sequence of the light chain CDR3 of the monoclonal antibody is shown as any one of SEQ ID NO.5, SEQ ID NO.10, SEQ ID NO.15, SEQ ID NO.20, SEQ ID NO.21 or SEQ ID NO. 25.

According to the invention, single B cell sorting and culture are carried out on the obtained PBMC by immunizing New Zealand white rabbits. The high-affinity rabbit monoclonal antibody obtained by analyzing the sequence of positive clone can quantitatively determine the level of anti-BP 230 autoantibody in BP patients, and lays an experimental foundation for researching the pathogenesis of BP, thereby achieving the purpose of diagnosing or treating autoimmune bullous diseases.

Specifically, the invention performs multiple BP230 protein immunity on experimental rabbits, and performs serum titer test after immunization. Spleen tissue of high titer rabbits and peripheral blood PBMC were isolated and single B cell sorting and culture were performed. The positive clone was RNA-extracted and reverse transcribed into cDNA, and all of the antibody VH and VL gene fragments were amplified. The VH and VL gene fragments amplified in vitro are cloned into an expression vector containing a human IgG constant region for recombinant expression. And performing functional verification on the recombinant antibody by an ELISA method, and finally screening the humanized monoclonal antibody with good specificity and strong affinity.

Preferably, the amino acid sequence of the heavy chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.1, the amino acid sequence of the CDR2 is shown as SEQ ID NO.2, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 3; the amino acid sequence of a light chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.4, the amino acid sequence of a CDR2 is LAS, and the amino acid sequence of a CDR3 is shown as SEQ ID NO. 5;

Or the amino acid sequence of the heavy chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.6, the amino acid sequence of the CDR2 is shown as SEQ ID NO.7, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 8; the amino acid sequence of the light chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.9, the amino acid sequence of the CDR2 is AAS, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 10;

Or the amino acid sequence of the heavy chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.11, the amino acid sequence of the CDR2 is shown as SEQ ID NO.12, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 13; the amino acid sequence of the light chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.14, the amino acid sequence of the CDR2 is RAS, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 15;

Or the amino acid sequence of the heavy chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.16, the amino acid sequence of the CDR2 is shown as SEQ ID NO.17, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 18; the amino acid sequence of the light chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.19, the amino acid sequence of the CDR2 is EAS, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 20;

Or the amino acid sequence of the heavy chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.16, the amino acid sequence of the CDR2 is shown as SEQ ID NO.17, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 18; the amino acid sequence of the light chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.19, the amino acid sequence of the CDR2 is SAS, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 21;

Or the amino acid sequence of the heavy chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.22, the amino acid sequence of the CDR2 is shown as SEQ ID NO.23, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 24; the amino acid sequence of the light chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.14, the amino acid sequence of the CDR2 is RAS, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 25.

Preferably, the heavy chain variable region amino acid sequence of the monoclonal antibody comprises any one of SEQ ID NO.26, SEQ ID NO.30, SEQ ID NO.34, SEQ ID NO.38 or SEQ ID NO.44, or an amino acid sequence having at least 80%, 85%, 90% or 95% homology, and functionally identical or similar to any one of SEQ ID NO.26, SEQ ID NO.30, SEQ ID NO.34, SEQ ID NO.38 or SEQ ID NO. 44.

Preferably, the light chain variable region amino acid sequence of the monoclonal antibody comprises any one of SEQ ID No.28, SEQ ID No.32, SEQ ID No.36, SEQ ID No.40, SEQ ID No.42 or SEQ ID No.46, or an amino acid sequence having at least 80%, 85%, 90% or 95% homology, and identical or similar function to any one of SEQ ID No.28, SEQ ID No.32, SEQ ID No.36, SEQ ID No.40, SEQ ID No.42 or SEQ ID No. 46.

Preferably, the heavy chain variable region amino acid sequence of the monoclonal antibody is shown in any one of SEQ ID NO.26, SEQ ID NO.30, SEQ ID NO.34, SEQ ID NO.38 or SEQ ID NO. 44.

Preferably, the light chain variable region amino acid sequence of the monoclonal antibody is shown in any one of SEQ ID NO.28, SEQ ID NO.32, SEQ ID NO.36, SEQ ID NO.40, SEQ ID NO.42 or SEQ ID NO. 46.

Preferably, the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown as SEQ ID NO.26, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 28;

or the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown as SEQ ID NO.30, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 32;

or the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown as SEQ ID NO.34, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 36;

or the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown as SEQ ID NO.38, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 40;

Or the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown as SEQ ID NO.38, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 42;

or the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown as SEQ ID NO.44, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 46.

Preferably, the heavy chain amino acid sequence of the monoclonal antibody comprises an amino acid sequence shown in any one of SEQ ID NO.27, SEQ ID NO.31, SEQ ID NO.35, SEQ ID NO.39 or SEQ ID NO.45, or an amino acid sequence having at least 80%, 85%, 90% or 95% homology with any one of SEQ ID NO.27, SEQ ID NO.31, SEQ ID NO.35, SEQ ID NO.39 or SEQ ID NO.45 and having the same or similar function.

Preferably, the light chain amino acid sequence of the monoclonal antibody comprises an amino acid sequence shown in any one of SEQ ID No.29, SEQ ID No.33, SEQ ID No.37, SEQ ID No.41, SEQ ID No.43 or SEQ ID No.47, or having at least 80%, 85%, 90% or 95% homology with any one of SEQ ID No.29, SEQ ID No.33, SEQ ID No.37, SEQ ID No.41, SEQ ID No.43 or SEQ ID No.47, and having the same or similar function.

Preferably, the heavy chain amino acid sequence of the monoclonal antibody is shown in any one of SEQ ID NO.27, SEQ ID NO.31, SEQ ID NO.35, SEQ ID NO.39 or SEQ ID NO. 45.

Preferably, the light chain amino acid sequence of the monoclonal antibody is shown in any one of SEQ ID NO.29, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.41, SEQ ID NO.43 or SEQ ID NO. 47.

Preferably, the heavy chain amino acid sequence of the monoclonal antibody is shown as SEQ ID NO.27, and the light chain amino acid sequence is shown as SEQ ID NO. 29;

or the heavy chain amino acid sequence of the monoclonal antibody is shown as SEQ ID NO.31, and the light chain amino acid sequence is shown as SEQ ID NO. 33;

Or the heavy chain amino acid sequence of the monoclonal antibody is shown as SEQ ID NO.35, and the light chain amino acid sequence is shown as SEQ ID NO. 37;

Or the heavy chain amino acid sequence of the monoclonal antibody is shown as SEQ ID NO.39, and the light chain amino acid sequence is shown as SEQ ID NO. 41;

or the heavy chain amino acid sequence of the monoclonal antibody is shown as SEQ ID NO.39, and the light chain amino acid sequence is shown as SEQ ID NO. 43;

Or the heavy chain amino acid sequence of the monoclonal antibody is shown as SEQ ID NO.45, and the light chain amino acid sequence is shown as SEQ ID NO. 47.

In a second aspect, the invention provides a nucleic acid molecule encoding the anti-BP 230 high-affinity monoclonal antibody of the first aspect.

In a third aspect, the present invention provides an expression vector comprising a nucleic acid molecule according to the second aspect.

In a fourth aspect, the invention provides a host cell comprising at least one copy of the expression vector of the third aspect, or having integrated into its genome the nucleic acid molecule of the second aspect.

In a fifth aspect, the present invention provides a composition for detecting BP230 protein, the composition comprising an anti-BP 230 high affinity monoclonal antibody of the first aspect.

In a sixth aspect, the present invention provides a kit for detecting BP230 protein in a sample, the kit comprising an anti-BP 230 high affinity monoclonal antibody according to the first aspect and/or a composition for detecting BP230 protein according to the fifth aspect.

In a specific embodiment, the kit for detecting BP230 protein in a sample is an immunofluorescence detection kit comprising the anti-BP 230 high affinity monoclonal antibody of the first aspect.

In a specific embodiment, the kit for detecting BP230 protein in a sample is an immunohistochemical detection kit comprising the anti-BP 230 high-affinity monoclonal antibody of the first aspect.

In a specific embodiment, the kit for detecting BP230 protein in a sample is a flow cytometry detection kit comprising the anti-BP 230 high affinity monoclonal antibody of the first aspect.

In a specific embodiment, the kit for detecting BP230 protein in a sample is a western blot detection kit comprising the anti-BP 230 high affinity monoclonal antibody of the first aspect.

In a specific embodiment, the kit for detecting BP230 protein in a sample is an ELISA detection kit comprising an anti-BP 230 high affinity monoclonal antibody according to the first aspect.

In a seventh aspect, the invention provides the use of any one or a combination of at least two of the anti-BP 230 high affinity monoclonal antibody according to the first aspect, the nucleic acid molecule according to the second aspect, the expression vector according to the third aspect, the host cell according to the fourth aspect, the composition for detecting BP230 protein according to the fifth aspect or the kit for detecting BP230 protein in a sample according to the sixth aspect, in the manufacture of a product for the diagnosis and/or treatment of bullous pemphigoid.

Compared with the prior art, the invention has the following beneficial effects:

the invention uses ELISA method to perform function verification on the recombinant antibody obtained by screening, and verifies the specific binding capability of the recombinant antibody and BP230 antigen. The recombinant antibodies have high activity and good stability, have stronger specificity, can be used as a reference standard for qualitatively detecting BP230 positive, and can also quantitatively detect the level of the anti-BP 230 autoantibody in BP patients.

Drawings

FIG. 1 is an SDS-PAGE electrophoresis of recombinant protein BP 230.

FIG. 2 is a graph showing the result of the effect of specific binding of recombinant antibodies to antigens.

Detailed Description

The screening preparation process of the anti-BP 230 high-affinity monoclonal antibody is as follows:

(1) And recombining the artificially synthesized BP230 gene into an expression vector plasmid pET28b to obtain a BP230-pET28b expression vector. And (3) transfecting the BP230-pET28b expression vector into BL21 (DE 3) competence for culture, and purifying to obtain the BP230 antigen protein.

(2) And (3) performing multiple BP230 protein immunity on the experimental rabbits by adopting BP230 antigen protein, and performing serum titer test after the immunity. Spleen tissue and peripheral blood of immunized rabbits with high serum detection titers were isolated aseptically, and PBMC cells were isolated from both materials by lymphocyte separation. 960 single B cell clones (10X 96 well plate, enriched for antigen) were isolated and cultured by B cell staining and flow sorting, ELISA screening positive clones specifically recognizing antigen.

(3) RNA from single B cell positive clones was reverse transcribed into cDNA using the SuperScript ™ IV SINGLE CELL/Low-Input CDNA PREAMP KIT (Thermo, cat. No. 11752048) kit, and all antibody VH, VL gene fragments were amplified. The VH and VL gene fragments obtained by in vitro amplification are cloned into an expression vector containing a human IgG constant region by a cloning technology, and recombinant expression is carried out.

(4) The expressed recombinant antibody was functionally validated using ELISA to verify its specific binding capacity to BP230 antigen. Finally, the humanized monoclonal antibody with good specificity and strong affinity is screened from the monoclonal antibody.

The technical scheme of the invention is further described by the following specific embodiments. It will be apparent to those skilled in the art that the examples are merely to aid in understanding the invention and are not to be construed as a specific limitation thereof.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.

Example 1 construction method of BP230 protein

Artificially synthesizing a BP230 gene sequence, and recombining the BP230 gene into an expression vector plasmid pET28b to obtain a BP230-pET28b expression vector; cloning site is NcoI/HindIII, the amino acid sequence of BP230 is SEQ ID NO.48:

MGSSHHHHHHSSGLEVLFQGPGSKSTAKDCTFKPDFEMTVKECQHSGELSSRNTGHLHPTPRSPLLRWTQEPQPLEEKWQHRVVEQIPKEVQFQPPGAPLEKEKSQQCYSEYFSQTSTELQITFDETNPITRLSEIEKIRDQALNNSRPPVRYQDNACEMELVKVLTPLEIAKNKQYDMHTEVTTLKQEKNPVPSAEEWMLEGCRASGGLKKGDFLKKGLEPETFQNFDGDHACSVRDDEFKFQGLRHTVTARQLVEAKLLDMRTIEQLRLGLKTVEEVQKTLNKFLTKATSIAGLYLESTKEKISFASAAERIIIDKMVALAFLEAQAATGFIIDPISGQTYSVEDAVLKGVVDPEFRIRLLEAEKAAVGYSYSSKTLSVFQAMENRMLDRQKGKHILEAQIASGGVIDPVRGIRVPPEIALQQGLLNNAILQFLHEPSSNTRVFPNPNNKQALYYSELLRMCVFDVESQCFLFPFGERNISNLNVKKTHRISVVDTKTGSELTVYEAFQRNLIEKSIYLELSGQQYQWKEAMFFESYGHSSHMLTDTKTGLHFNINEAIEQGTIDKALVKKYQEGLITLTELADSLLSRLVPKKDLHSPVAGYWLTASGERISVLKASRRNLVDRITALRCLEAQVSTGGIIDPLTGKKYRVAEALHRGLVDEGFAQQLRQCELVITGIGHPITNKMMSVVEAVNANIINKEMGIRCLEFQYLTGGLIEPQVHSRLSIEEALQVGIIDVLIATKLKDQKSYVRNIICPQTKRKLTYKEALEKADFDFHTGLKLLEVSEPLMTGISSLYYSS.

the gene sequence is SEQ ID NO.49:

ccatgggcagcagccatcatcatcatcatcacagcagcggcctggaagttctgttccaggggcccggatccaagagtaccgccaaagattgcacctttaaaccggattttgaaatgaccgttaaagaatgtcagcatagcggtgaactgagcagccgtaataccggtcatctgcatccgaccccgcgcagtccgctgctgcgttggacccaggaaccgcagccgctggaagaaaaatggcagcatcgcgtggtggaacagattccgaaagaagtgcagtttcagccgccgggcgcaccgctggaaaaagaaaaaagtcagcagtgctatagcgaatattttagccagaccagtaccgaactgcagattacctttgatgaaaccaatccgattacccgcctgagcgaaattgaaaaaattcgtgatcaggccctgaataatagtcgtccgccggtgcgctatcaggataatgcctgcgaaatggaactggtgaaagttctgaccccgctggaaattgccaaaaataaacagtatgatatgcacaccgaagttaccaccctgaaacaggaaaaaaatccggtgccgagcgccgaagaatggatgctggaaggttgtcgcgccagcggcggcctgaaaaaaggcgattttctgaaaaaaggtctggaaccggaaacctttcagaattttgatggcgatcatgcctgcagcgtgcgcgatgatgaatttaaatttcagggcctgcgtcataccgtgaccgcacgtcagctggtggaagccaaactgctggatatgcgtaccattgaacagctgcgtctgggcctgaaaaccgtggaagaagttcagaaaaccctgaataaatttctgaccaaagccaccagcattgcaggtctgtatctggaaagcaccaaagaaaaaattagctttgccagcgcagcagaacgcattattattgataaaatggtggccctggcctttctggaagcacaggccgcaaccggctttattattgatccgattagtggtcagacctatagcgtggaagatgcagttctgaaaggtgtggtggaccctgaatttcgcattcgcctgctggaagccgaaaaagccgcagtgggctatagttatagtagtaaaaccctgagcgttt.

Transfecting BP230-pET28b expression vector into BL21 (DE 3) competence for culture, collecting precipitate, and performing His tag affinity chromatography to obtain BP230 protein; purified BP230 was also subjected to SDS-PAGE (polyacrylamide gel electrophoresis) to verify its purity, and the purified BP230 SDS-PAGE was shown in FIG. 1, with a protein size 90.54 KDa and a purity of greater than 85%.

EXAMPLE 2 preparation of rabbit monoclonal antibody BP230

The major instruments used in this example are shown in Table 1, and the major reagents used in this example are shown in Table 2.

TABLE 1

TABLE 2

1. Immunization of animals

New Zealand white rabbits (laboratory animal research center in Hubei province) were selected as immunized animals. At the first immunization, 250 μg of BP230 protein was emulsified with an equal volume of complete Freund's adjuvant and injected subcutaneously into the back of New Zealand white rabbits at multiple points. A second immunization was performed 15 days later, and 250. Mu.g of BP230 protein was emulsified with an equal volume of incomplete Freund's adjuvant and injected subcutaneously and dorsum at multiple points into New Zealand white rabbits. A third immunization was performed 10 days later, and 250. Mu.g of BP230 protein was emulsified with an equal volume of incomplete Freund's adjuvant and injected subcutaneously and dorsum at multiple points into New Zealand white rabbits. After 5 days, a fourth immunization was performed, 250 μg of BP230 protein was emulsified with an equal volume of incomplete Freund's adjuvant, and injected subcutaneously and dorsum at multiple points into New Zealand white rabbits. Serum titers were determined by ELISA after four immunizations.

2. B lymphocyte acquisition

1 Immunized rabbit with high serum detection titer was taken, spleen tissue was aseptically isolated and peripheral blood was taken. PBMC were isolated by Ficoll density gradient centrifugation, washed 2 times with sterile PBS, counted in suspension, and stored in liquid nitrogen for extended periods.

3. B lymphocyte sorting and culturing

3.1 The PBMC is resuspended by PBS, the cell concentration is regulated to 1X 10 ⁷ cells/mL, B cells are stained by adding flow antibody according to the volume of the resuspended cells, P (Proteintech, cat No. SA 00003-2) and BSA specific-APC are respectively added in a ratio of 1:100, a blank control is carefully arranged, a single-staining control is adopted, and the cells are incubated at room temperature and in a dark place for 30 min; the cells were washed twice with PBS and centrifuged at 300 g ℃for 5 minutes.

3.2 The PBS is used for resuspension of cells, a 100-mesh filter screen is used for filtering the cells before the cells are put on the machine, 2% PI is added for dyeing and removing dead cells 5 minutes before the cells are put on the machine, and voltage regulation and fluorescence compensation setting are carried out by using control; lymphocyte selection is performed by FSC-A/SSC-A, and adhesive cells are removed by FSC-W/FSC-A. And B cells with negative IgM, positive antigen and negative PI are selected.

3.3 By flow sorting, 1B cell per well was added to a 96-well plate to which 100. Mu.L of complete 1640 medium (containing 10% FBS, 1% penicillin-streptomycin, 1% glutamine and 2. Mu.g/mL human IL 2), and the 96-well plate was centrifuged at 300g for 5 minutes and incubated at 37℃for 7 days with 5% CO ₂.

4. Identification of B lymphocytes

ELISA was performed on cell supernatants cultured to day seven. The ELISA plate was coated and BP230 antigen was incubated at 37℃for 2 hours at 100. Mu.L (5. Mu.g/mL) per well.

The liquid in the ELISA plate was discarded and each well was washed three times with 300. Mu.L of 0.05% PBST. mu.L of 3% BSA (PBS dissolved) blocking solution was added to each well, and the wells were blocked at 37℃for 1.5 hours. The liquid in the ELISA plate was discarded and each well was washed three times with 300. Mu.L of 0.05% PBST. 100. Mu.L of the twice diluted supernatant to be tested was added to each well and incubated at 37℃for 1 hour. The liquid in the ELISA plate was discarded and each well was washed three times with 300. Mu.L of 0.05% PBST. mu.L of secondary antibody (Goat Anti-Rabbit IgG H & L Polyclonal antibody, HRP (PTB 96431) brand: antibodysystem) diluted with blocking solution was added to each well and incubated at 37℃for 45 min. The liquid in the ELISA plate was discarded and each well was washed three times with 300. Mu.L of 0.05% PBST. 100. Mu.L TMB was added to each well, incubated at 37℃for 5-10 minutes, and then 50. Mu.L 2M HCl were added to each well to terminate the reaction. Values were read using a microplate reader at 450 nm-630 nm and the results are shown in Table 3.

TABLE 3 Table 3

5. Positive clone antibody variable region amplification and sequencing analysis

5.1 B cells identified as positive were collected, and RNA was extracted by a conventional method and reverse transcribed into cDNA. PCR amplification is performed using amplification primers comprising:

Gene primer for antibody heavy chain:

The upstream primer (SEQ ID NO. 50) 5'-CAGTCGGTGGAGGAGTCCRGG-3';

The downstream primer (SEQ ID NO. 51) 5'-ACTCGAGAYGGTGACCAGGGTGCC-3'.

Gene primer for kappa chain of antibody light chain:

The upstream primer (SEQ ID NO. 52) 5'-GAGCTCGTGMTGACCCAGACTCCA-3';

the downstream primer (SEQ ID NO. 53) 5'-tttgatttccacattggtgcc-3'.

Gene primer for lambda chain of antibody light chain:

An upstream primer (SEQ ID NO. 54) 5'-gagctcgtgctgactcagtcgccctc-3';

The downstream primer (SEQ ID NO. 55) 5'-gcctgtgacggtcagctgggtccc-3'.

The PCR amplification procedure was: a) Pre-denaturation at 96 ℃ for 5 min; b) Denaturation at 96℃for 15 sec; c) Annealing at 58 ℃ for 15 seconds; d) Extending at 72deg.C for 15 seconds; e) Final extension at 72℃for 10 min; f) Preserving at 10 deg.C, and repeating steps b-d for 25 times.

5.2 The amplified products were subcloned into expression vectors containing human IgG constant regions for sequencing analysis and 6 recombinant antibodies were expressed together, designated ATGM925, ATGM926, ATGM929, ATGM930, ATGM931, and ATGM932 (as shown in table 4).

TABLE 4 Table 4

The heavy and light chain sequences of the antibodies are shown in tables 5-7:

TABLE 5

TABLE 6

TABLE 7

/>

Example 3 functional validation of purified antibodies

The ELISA plate was coated and BP230 antigen was incubated at 37℃for 2 hours at 100. Mu.L (5. Mu.g/mL) per well. The liquid in the ELISA plate was discarded and each well was washed three times with 300. Mu.L of 0.05% PBST. mu.L of 3% BSA (PBS dissolved) blocking solution was added to each well, and the wells were blocked at 37℃for 1.5 hours. The liquid in the ELISA plate was discarded and each well was washed three times with 300. Mu.L of 0.05% PBST. 100. Mu.L of the recombinant antibody was added to each well and incubated at 37℃for 1 hour. The liquid in the ELISA plate was discarded and each well was washed three times with 300. Mu.L of 0.05% PBST. mu.L of secondary antibody (Goat Anti-Human IgG Polyclonal Antibody, HRP (PHB 96431), brand: antibodysystem) diluted with blocking solution was added to each well and incubated for 45 min at 37 ℃. The liquid in the ELISA plate was discarded and each well was washed three times with 300. Mu.L of 0.05% PBST. 100. Mu.L TMB was added to each well, incubated at 37℃for 5-10 minutes, and then 50. Mu.L 2M HCl were added to each well to terminate the reaction. Values were read using a microplate reader at 450 nm-630 nm and the results of the assay are shown in FIG. 2. As can be seen from FIG. 2, the humanized anti-BP 230 monoclonal antibody obtained by screening has a strong specific binding capacity with BP 230.

In conclusion, the monoclonal antibody obtained by screening in the invention has strong specific binding capacity with BP230 antigen, and the obtained recombinant antibody has high activity, good stability and stronger specificity, can be used as a reference standard for qualitatively detecting BP230 positive, and can also quantitatively detect the level of the anti-BP 230 autoantibody in BP patients.

The applicant declares that the above is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be apparent to those skilled in the art that any changes or substitutions that are easily conceivable within the technical scope of the present invention disclosed by the present invention fall within the scope of the present invention and the disclosure.

Claims

1. An anti-BP 230 high affinity monoclonal antibody comprising a heavy chain variable region and a light chain variable region;

2. The anti-BP 230 high-affinity monoclonal antibody according to claim 1, wherein the heavy chain CDR1 of the monoclonal antibody has an amino acid sequence shown in SEQ ID No.1, CDR2 has an amino acid sequence shown in SEQ ID No.2, and CDR3 has an amino acid sequence shown in SEQ ID No. 3; the amino acid sequence of a light chain CDR1 of the monoclonal antibody is shown as SEQ ID NO.4, the amino acid sequence of a CDR2 is LAS, and the amino acid sequence of a CDR3 is shown as SEQ ID NO. 5;

3. The anti-BP 230 high-affinity monoclonal antibody according to claim 1, wherein the heavy chain variable region amino acid sequence of the monoclonal antibody is shown in any one of SEQ ID No.26, SEQ ID No.30, SEQ ID No.34, SEQ ID No.38 or SEQ ID No. 44;

the amino acid sequence of the light chain variable region of the monoclonal antibody is shown as any one of SEQ ID NO.28, SEQ ID NO.32, SEQ ID NO.36, SEQ ID NO.40, SEQ ID NO.42 or SEQ ID NO. 46.

4. The anti-BP 230 high-affinity monoclonal antibody according to claim 1, wherein the heavy chain amino acid sequence of the monoclonal antibody is shown in any one of SEQ ID No.27, SEQ ID No.31, SEQ ID No.35, SEQ ID No.39 or SEQ ID No. 45;

the light chain amino acid sequence of the monoclonal antibody is shown as any one of SEQ ID NO.29, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.41, SEQ ID NO.43 or SEQ ID NO. 47.

5. A nucleic acid molecule encoding the anti-BP 230 high-affinity monoclonal antibody of any one of claims 1-4.

6. An expression vector comprising the nucleic acid molecule of claim 5.

7. A host cell comprising at least one copy of the expression vector of claim 6 or having integrated into its genome the nucleic acid molecule of claim 5.

8. A composition for detecting BP230 protein, comprising the anti-BP 230 high-affinity monoclonal antibody of any one of claims 1-4.

9. A kit for detecting BP230 protein in a sample, characterized in that the kit comprises an anti-BP 230 high affinity monoclonal antibody according to any one of claims 1-4 and/or a composition for detecting BP230 protein according to claim 8.

10. Use of any one or a combination of at least two of the anti-BP 230 high affinity monoclonal antibody of any one of claims 1-4, the nucleic acid molecule of claim 5, the expression vector of claim 6, the host cell of claim 7, the composition for detecting BP230 protein of claim 8 or the kit for detecting BP230 protein in a sample of claim 9 for the preparation of a product for the diagnosis and/or treatment of bullous pemphigoid.